cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Annytha Ina Rohi Detha
Contact Email
jurnalkajianveteriner@undana.ac.id
Phone
+628113816881
Journal Mail Official
jurnalkajianveteriner@undana.ac.id
Editorial Address
Faculty of Veterinary Medicine, Adi Sucipto street, Penfui - Kupang, East Nusa Tenggara
Location
Kota kupang,
Nusa tenggara timur
INDONESIA
JURNAL KAJIAN VETERINER
Published by Universitas Nusa Cendana
ISSN : 23564113     EISSN : 25286021     DOI : https://doi.org/10.35508/jkv
Core Subject : Health, Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Medicine & Pharmacology Public Health Veterinary
Jurnal Kajian Veteriner is a scientific journals was published since May, 2012. This journal used to be sharing information and communication about the result of research at veterinary scoup. Jurnal Kajian Veteriner publish twice a year at Juni and December.
Arjuna Subject : Kedokteran Hewan - Kedokteran Hewan (Lain-Lain)
Articles 256 Documents
 20   21   22   23   24 
Evaluasi Efektivitas Antibiotik Komersil Terhadap Agen Penyebab Gejala Snot pada Ayam Broiler di Kabupaten Kupang Soge, Bergitha; Tangkonda, Elisabet; Widi, Antin Y. N.; Sanam, Maxs U. E.; Deta, Herlina Umbu
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.13075

Abstract

Snot is a symptom of upper respiratory system infections in poultry, characterized by exudate production from the nasal cavity, swelling of infraorbital sinuses, snoring, sneezing, and dyspnoea. The aetiology of snot that have been isolated are Avibaterium paragallinarum, Pasteurella multocida, Ornithobacterium rhinotracheale, and Mycoplasma sp. Snot symptom can be eradicated with antibiotic treatment; however, antibiotic resistance makes antibiotic treatment ineffective. This study is aimed to evaluate the effectiveness of some commercial antibiotics against bacteria isolated from broiler chicken with snot symptom in Kupang Regency. Amoxycillin, ampicillin, tetracycline, cefoxitin, and ciprofloxacin were tested using the Kirby Bauer method with McFarland Turbidity Standard against Avibacterium paragallinarum, Ornithobacterium rhinotracheale, Pasteurella multocida, and Mycoplasma sp isolates. Inhibition zones were measured and compared to the standard of the Clinical Laboratory Standard Institute (CLSI) to determine the sensitivity or resistance percentage. The result showed that Avibacterium paragallinarum, Ornithobacterium rhinotracheale, Pasteurella multocida, and Mycoplasma sp were highly resistant to amoxycillin and ampicillin, yet most sensitif to ciprofloxacin. This suggests commercial antibiotics that are productive to eradicate snot symptom and implies some antibiotics that are ineffective to overcome snot symptom and hence should not be used in the field.
Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province Pandarangga, Putri; Ticoalu, Abigail E.; Gelolodo, Maria A. E. G. A; Toha, Larry R. W.
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.13118

Abstract

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.
Kurkumin sebagai Agen Penghambat Penurunan Bobot Badan dan Skleroderma pada Mencit Akibat Induksi Bleomisin Rahmi, Annisa; Baharun, Abdullah; Juniantito, Vetnizah; Setyono, Agus
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.13228

Abstract

Curcumin is the main active ingredient from turmeric plant (Curcuma longa) has been known as anti-oxidant and anti-inflammatory agent. Bleomycin is an anti-cancer drug which have side effects such as scleroderma and body weight loss in animals or human. This study was aimed to determined biological effects of curcumin to bleomycin-induced scleroderma and body weight loss in mice (Mus musculus). Sixteen male mice (ddy strain) were devided in to four groups: (i) negative control, received aquadest injection 0,1 ml (SC); (ii) bleomycin (BLM), received 0,1 ml bleomycin 1 mg/ml SC injection; (iii) curcumin (CMN), received aquadest injection 0,1 ml (SC) and 100 mg/kg BW curcumin in 0,5% carboxymethylcellulose (IP); and (iv) BLM+ CMN, received 0,1 ml bleomycin 1 mg/ml SC injection and 100 mg/kg BW curcumin in 0,5% carboxymethylcellulose (IP). All treatments are given every day for 4 weeks and body weigh were measured every week. The dorsal skin as injection’s dot evaluated by histopathology assessment with HE stains. BLM group showed body weight and hair follicles were loss significantly with skin fibrosis and inflammatory cells infiltration. However, CMN treatment showed opposite results in BLM-treated mice. Conclusively, this study showed CMN treatment may inhibit skin fibrogenesis in BLM-induced scleroderma and body weight loss.
Evaluasi Kerusakan DNA Spermatozoa Semen Cair Babi Menggunakan Pewarnaan Toluidine Blue Parera, Hermilinda; Lenda, Victor; Foeh, Nancy Diana; Sirat, Muhammad Mirandy Pratama
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.14732

Abstract

The integrity of the deoxyribonucleic acid (DNA) in sperm plays a crucial role in the fertilization process and embryonic development. This study aimed to evaluate the level of the DNA fragmentation of boar sperm in tris-citrate-fructose extender preserved at temperatures between 16-18°C for 3 days. The level of sperm DNA damage was analysed using toluidine blue (TB) staining. Pig semen collected from 4 male pigs aged 1.3-1.8 years was used as the research sample. Semen collected was conducted twice a week. The experimental method using a Completely Randomized Design with 4 storage duration groups as follows: Group I (0 hours of storage), Group II (24 hours of storage), Group III (48 hours of storage), and Group IV (72 hours of storage), each with 5 replications. The data were analysed using analysis of variance (ANOVA) and, if significant differences were found, Duncan's test was performed. The results of the evaluation of the percentage of DNA damage during the storage process at 16-180C at 0 hours, 24 hours, 48 hours and 72 hours was: 0.33 ± 1.66%, 0.80 ± 0.447%, 1.60 ± 1.14% and 2.80 ± 0.447%, respectively. These results demonstrate that liquid boar semen preserved with tris citrate fructose extender at 16-18 °C for 3 days has spermatozoa DNA damage levels within the normal range, making it suitable for artificial insemination and ensuring optimal AI success.
Gambaran Hematologi Darah Pasca Vaksinasi Porcine Reproductive and Respiratory Syndrome (PRRS) pada Ternak Babi di Kabupaten Kupang Sole, Marsyella Gloria; Simarmata, Yohanes T. R. M. R.; Gelolodo, Maria Aega
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15129

Abstract

The potential for expanding pig farming, particularly with native pigs, in East Nusa Tenggara (NTT) Province is significant due to the predominant non-Muslim population in NTT who utilise pigs in traditional and religious ceremonies. However, the high number of pigs in Kupang Regency and conventional farming practices can elevate the likelihood of infections like Porcine Reproductive and Respiratory Syndrome, known as PRRS. Porcine reproductive and respiratory syndrome (PRRS), caused by the PRRS virus (PRRSV), is a significant disease in the pig farming sector. The porcine reproductive and respiratory syndrome virus is highly contagious within pig herds. It can spread through direct contact or contaminated aerosols. Vaccines have been used to limit the disease’s transmission, despite often being considered ineffective. This study analyses the variations in blood haematological parameters before and after PRRS immunisation, including RBC, HGB, PCV, MCV, MCH, MCHC, and WBC. Fifteen pigs were included in the sample. Sampling was conducted two times from the same pigs: before PRRS vaccination and one month post-immunization. SPSS was used for the data analysis. A statistical study using SPSS showed no significant difference in blood hematology following the PRRS vaccination.
Gambaran Hematologi dari Pemberian Anestesi Kombinasi Ketamin-Xilazin dan Ketamin-Diazepam pada Pelaksanaan Kastrasi Anjing Utami, Tri; Tophianong, Tarsisius Considus; Semarabawa, I Gede; Darang, Calvin Lummu
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15221

Abstract

Carrying out castration on dogs requires anesthesia to prevent movement and relieve pain during the operation. The aim of this study was to determine the effect of administering two combinations of general anesthesia, ketamine - xylazine and ketamine-diazepam on the blood features of dogs undergoing castration procedures. The dogs used in this study were 6 dogs, domestic breed, male and aged between six months and one year. Blood sampling from the cephalic antebrachii vein of 1 ml was carried out twice, thirty minutes before surgery and sixty minutes after surgery. The average results of post-operative complete blood tests in dogs given ketamine (10 mg/kg body weight, iv) – xylazine (1 mg/kg body weight, iv) anesthesia, include: total erythrocyte count 5.84 x 106/µL, haemoglobin 12.27 g/dL, haematocrit 36.7%, and leukocytes 15.4 x 103/µL. The average results of post-operative complete blood tests in dogs given ketamine (10 mg/kg body weight, iv)–diazepam (0.2 mg/kg body wight, iv) anesthesia, include: total erythrocyte count 5.98 x 106/µL, haemoglobin 11.77 g/dL, haematocrit 36.23%, and leukocytes 16.4 x 103/µL. Based on the results of statistical analysis using the independent t-test, the number of erythrocytes, haemoglobin, haematocrit and post-operative leukocytes between the two groups was not significantly different (P>0.05). The use of the combination of ketamine-xylazine and ketamine - diazepam during castration did not cause changes in the number of erythrocytes, haemoglobin, haematocrit and leukocytes.
Profile of Antibiotic Residue and Antibiotic Resistance in Broiler Chicken Meat in Indonesia: Public Health Importance Bura, Maria Antonia Yersi Dua; Effendi, Mustofa Helmi; Puspitasari, Yulianna
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15360

Abstract

Keamanan pangan merupakan isu global dan menjadi perhatian bersama. Di bidang peternakan, penyalahgunaan antibiotik dalam praktik kesehatan hewan berdampak pada bahaya residu dan resistensi antimikroba pada produk pangan asal hewan bagi kesehatan masyarakat. Penelitian ini mengkaji profil residu dan resistensi antibiotik pada daging ayam broiler di Indonesia. Kajian dilakukan melalui tinjauan pustaka terhadap artikel penelitian yang dipublikasikan di jurnal ilmiah nasional dan internasional, prosiding seminar, dan laporan penelitian. Hasil penelitian mengungkapkan, dalam lima tahun terakhir (2018-2023) masih ditemukan residu antibiotik pada daging ayam broiler di beberapa daerah di Indonesia. Pada periode yang sama, resistensi antibiotik juga ditemukan pada sampel daging ayam broiler di beberapa wilayah Indonesia. Resistensi antibiotik yang ditemukan adalah pada satu jenis antibiotik dan beberapa jenis antibiotik (multidrug resistance) sekaligus. Temuan ini dapat dijadikan bahan evaluasi perbaikan manajemen rantai produksi dan distribusi produk daging ayam broiler dalam negeri tentang jaminan keamanan pangan asal hewan.
Aktivitas Antioksidan dan Antibakteri Ekstrak Etanol Kulit Batang Lunasia amara Saputra, Agus; Laut, Meity Marviana; Ndaong, Nemay Anggadewi
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15438

Abstract

Nowadays, there is an increasing demand for medicines to treat many types of diseases. Lunasia amara is one of the medicinal plants used by Indonesian people for a long time. This study aimed to identify the secondary metabolites of L. amara stem bark using phytochemical analysis and then assess its antioxidant and antibacterial activities. Metabolite extraction will be carried out with an ethanol solvent, and antioxidant activity will be determined using the α, α-diphenyl-β-picrylhydrazyl (DPPH) assays. Antibacterial experiments were conducted against two types of bacteria: Escherichia coli and Staphylococcus aureus. From the results of the phytochemical investigation, the predominant compound group is alkaloid. The ethanol extract metabolites have antioxidant activity and belong to the strong antioxidant group with an IC50 value of 77.96 ppm. Antibacterial activity was weak at concentrations as high as 20%. Based on these findings, further assays can be conducted, such as cytotoxic activity against various cancer cells.
Strategi Pengembangan Usaha Ternak Kerbau di Kabupaten Sumba Timur Bulu, Bernardus A.; Krova, Maria; Lole, Ulrikus R.
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15521

Abstract

Buffalo livestock in the culture of the people of East Sumba have a large role, both as working livestock, social and cultural livestock such as traditional mourning events, weddings and traditional houses. However, the government's role in developing the buffalo farming business is very low and the lack of development by breeders causes a decline in buffalo livestock productivity, resulting in a decline in population and an impact on fluctuating buffalo livestock prices. This research aims to: (1) develop a strategy for developing the buffalo population in East Sumba Regency. This research uses SWOT analysis to formulate a strategy for developing a buffalo livestock business. This research uses a survey method and purposive sampling with the minimum criteria of having three buffalo, having sold livestock in the last two years and being a fairly influential figure in the village. Primary and secondary data are used to answer the objectives of this research. The results of the SWOT analysis show that the buffalo farming business is in quadrant I with an X value = 0.16 and a Y value = 0.52. The strategy used is an aggressive strategy. The strategy for developing buffalo livestock is optimizing pastures by using feed processing technology so that feed is always available and increasing the production and productivity of buffalo livestock to maintain the availability and demand for buffalo livestock.
Identifikasi Mikroplastik pada Ikan Tongkol Lisong (Auxis Rochei) dan Ikan Tuna Makarel (Euthynnus Affinis) di Pangkalan Pendaratan Ikan (PPI) Oeba, Kupang Larasati, Gendhis; Wuri, Diana A.; Kallau, Novalino H. G.
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15531

Abstract

Waste management in Kupang City is still very poor. The waste will eventually reach the sea and will be degraded into microplastics. Microplastics, which are less than 5 millimetres in size, are made from plastic waste in marine waters through physical, mechanical, chemical and biological processes. This research was conducted to determine the characteristics (shape and colour) and abundance of microplastics found in digestive tract samples, and meat/muscle samples of lisong tuna (Auxis rochei) and mackerel tuna (Euthynnus affinis) obtained from PPI Oeba, Kupang City. Each organ was extracted using 10% KOH for 48-72 hours and microplastic characteristics were observed visually using a stereo microscope. The research results found microplastics in the digestive tract and meat of A. rochei and E. affinis. The forms found in digestive tract A. rochei include films and fragments, with transparent colours. Meanwhile in meat, fragments, films and fibres were found in red, blue, black, transparent and purple. The forms found in digestive tract E. affinis include fragments, pellets, fibers and films with blue, black, transparent and yellow colours. Meanwhile in meat, fragments and pellets were found with black and yellow colors. The abundance of microplastics detected in digestive tract A. rochei included 1.2 MP/individual, while in meat it was 0.2 MP/gr. In E. affinis it includes 0.8 MP/individual in digestive tract and in meat 0.06 MP/gr.

Page 22 of 26 | Total Record : 256

 20   21   22   23   24 

Filter by Year

2018 2025


Reset
Filter By Issues
All Issue Vol 13 No 2 (2025): Jurnal Kajian Veteriner Vol 13 No 1 (2025): Jurnal Kajian Veteriner Vol 12 No 2 (2024): Jurnal Kajian Veteriner Vol 12 No 1 (2024): Jurnal Kajian Veteriner Vol 11 No 2 (2023): Jurnal Kajian Veteriner Vol 11 No 1 (2023): Jurnal Kajian Veteriner Vol 10 No 2 (2022): Jurnal Kajian Veteriner Vol 10 No 1 (2022): Jurnal Kajian Veteriner Vol 9 No 3 (2021): Jurnal Kajian Veteriner Vol 9 No 2 (2021): Jurnal Kajian Veteriner Vol 9 No 1 (2021): Jurnal Kajian Veteriner Vol 8 No 2 (2020): Jurnal Kajian Veteriner Vol 8 No 1 (2020): Jurnal Kajian Veteriner Vol 7 No 2 (2019): Jurnal Kajian Veteriner Vol 7 No 1 (2019): Jurnal Kajian Veteriner Vol 6 No 2 (2018): Jurnal Kajian Veteriner Vol 5 No 1 (2017): Jurnal Kajian Veteriner Vol 4 No 2 (2016): Jurnal Kajian Veteriner Vol 4 No 1 (2016): Jurnal Kajian Veteriner Vol 3 No 2 (2015): Jurnal Kajian Veteriner Vol 3 No 1 (2015): Jurnal Kajian Veteriner Vol 2 No 2 (2014): Jurnal Kajian Veteriner Vol 2 No 1 (2014): Jurnal Kajian Veteriner PROSIDING SEMINAR NASIONAL KE-7 Vol 6 No 1 (2018): Jurnal Kajian Veteriner Vol 5 No 2 (2017): Jurnal Kajian Veteriner More Issue