cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Jurnal Sain Veteriner
Published by Universitas Gadjah Mada
ISSN : 012660421     EISSN : 24073733     DOI : -
Core Subject : Health,
Veterinary
Arjuna Subject : -
Articles 824 Documents
 56   57   58   59   60 
Swab Bukal Sebagai Bahan Sexing Piyikan Burung Kenari (Serinus canaria) dan Burung Merpati (Columba livia) Afif Muhammad Akrom; Soedarmanto Indarjulianto; Yanuartono Yanuartono; Trini Susmiati; Alfarisa Nururrozi; Slamet Raharjo; Rief Ghulam Satria Permana; Yeremia Yobelanno Sitompul
Jurnal Sain Veteriner Vol 38, No 1 (2020): April
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.49032

Abstract

Teknik sexing pada burung secara molekuler dengan metode PCR telah banyak dikembangkan, tetapi sampel yang digunakan adalah darah dan bulu yang dianggap invasif. Penelitian ini bertujuan untuk mempelajari efisiensi sampel swab bukal sebagai sumber DNA dalam sexing dengan metode PCR. Penelitian ini menggunakan 10 ekor burung kenari (Serinus canaria) yang terdiri dari 6 ekor burung dewasa (3 jantan dan 3 betina) dan 4 ekor kenari piyikan (umur 14 – 18 hari) yang belum diketahui jenis kelaminnya serta 6 ekor merpati (Columba livia) dewasa (3 jantan dan 3 betina) dan 7 ekor merpati piyikan (umur 14 – 25 hari) yang belum diketahui jenis kelaminnya. Amplifikasi fragmen gen dilakukan menggunakan metode PCR dengan pasangan primer CHD1F/CHD1R.Hasil visualisasi produk PCR menunjukkan semua burung jantan dewasa menghasilkan satu band (± 500 bp), sedangkan burung betina dewasa menghasilkan dua band (± 500 bp dan ± 300 bp). Amplifikasi gen dari swab bukal burung kenari muda didapatkan 2 ekor jantan dan 2 ekor betina, sedangkan dari swab bukal burung merpati muda didapatkan 6 ekor jantan dan 1 ekor betina. Berdasarkan hasil penelitian ini dapat disimpulkan bahwa sampel swab bukal terbukti efisien sebagai sumber DNA dalam sexing burung khususnya burung piyikan.
Pemberian Ekstrak Etanol Daun Jambu Mete (Anacardium occidentale) terhadap Produksi IL-6 dan SOD pada Mencit Fibrosis Hati yang Diinduksi CCl4 Mariana Ruth Theresia Hutabarat; Fithria NIsa Hanifah; Siti Hadijah; Djoko Winarso; Sri Murwani
Jurnal Sain Veteriner Vol 38, No 1 (2020): April
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.49070

Abstract

Fibrosis hati merupakan akumulasi berlebih matriks ekstraseluler. Prevalensi fibrosis hati hewan kecil dilaporkan mencapai 10% dari keseluruhan penyakit sistemik hewan kecil di Amerika Serikat. Salah satu bahan toksik yang menimbulkan fibrosis hati adalah carbon tetrachloride (CCl4). Penelitian ini bertujuan untuk mengetahui pengaruh preventif ekstrak etanol daun jambu mete (Anacardium occidentale) terhadap produksi Interleukin-6 (IL-6) dan kadar superoxide dismutase (SOD). Daun jambu mete mengandung bahan aktif flavonoid yang memiliki efek antiinflamasi dan antioksidan. Penelitian ini merupakan studi eksperimental, post-test control only design dengan menggunakan Rancangan Acak Lengkap. Hewan coba mencit (Mus musculus) dibagi dalam 5 kelompok perlakuan, yaitu kelompok kontrol negatif, kontrol positif, kelompok preventif dengan dosis 500 mg/kg BB, 1000 mg/kg BB, dan 1500 mg/kg BB. Produksi sitokin IL-6 dihitung menggunakan metode flowcytometry, sedangkan kadar SOD diukur menggunakan spektofotometri. Data hasil uji dianalisa secara statistik ­one way ANOVA (α=0,05) dengan uji lanjutan Post Hoc Tukey. Simpulan dari penelitian ini yaitu preventif menggunakan ekstrak etanol daun jambu mete mencegah peningkatan produksi IL-6 dan meningkatkan kadar SOD pada mencit model fibrosis hati. Persentase produksi IL-6 pada kelompok perlakuan dosis 1500 mg/kg BB sebesar 2,58%. Kadar SOD pada kelompok perlakuan dosis 1500 mg/kg BB sebesar 4,23%.
Methionine Hydroxy Analog Supplementation to Increase Feed Utilization for Indigenous Sheep Bambang Waluyo Hadi Eko Prasetiyono; Mulyono Mulyono; Widiyanto Widiyanto
Jurnal Sain Veteriner Vol 38, No 1 (2020): April
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.55678

Abstract

In the tropical area, productivity of ruminant has not optimized caused by the low quality of nutrition that leads to low-efficiency metabolism at the level of ruminal fermentation, post rumen digestibility, and intermediary metabolism. The study aimed to analyze effect of methionine hydroxy analog (MHA) on ruminal fermentation profiles of indigenous sheep specifically in the increase of ruminant productivity. In vitro utility test was conducted using rumen fluid of the indigenous sheep and sample of rational ration having a proportion of grass and concentrate 30%:70%, dry matter basis. The treatments implemented were three levels of MHA supplementation; T0: 0 g/day, T1: 3 g/day, and T2: 6 g/day. Variables measured were dry matter digestibility (DMD), organic matter digestibility (OMD), production of VFA, NH3, as well as total protein, and molar proportion of partial VFA of rumen fluid. Data were analyzed using analysis of variance (ANOVA) in a completely randomized design (CRD). The 0.2% MHA supplementation increased OMD with the highest production of total protein was from 28.57 mg/g (T0) to 40.49 mg/g (T2) (P<0.05). Meanwhile, the lowest ratio of acetate : propionate was from 2.74 (T0) to 2.33 (T2) (P<0.05). Supplementation of MHA up to 6 g/day concentrate increased the performance of fermentation and/or feed utility. 
Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development Narendra Yoga Hendarta; Asmarani Kusumawati; Tri Wibawa; Abu Tholib Aman
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44696

Abstract

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping
Pemodelan Epidemiologi Kejadian Multidrug Resistance Bakteri Escherichia coli pada Peternakan Ayam Komersial di Kabupaten Blitar Freshinta Jellia Wibisono; Bambang Sumiarto; Tri Untari; Mustofa Helmi Effendi; Dian Ayu Permatasari; Adiana Mutamsari Witaningrum
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.52071

Abstract

Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar.  Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelitian ini menunjukkan Distribusi kasus kejadian multidrug resistance pada ayam komersial di Kabupaten Blitar menunjukkan prevalensi kejadian pada tingkat peternakan sebesar 95.9%. Pemodelan kejadian multidrug resistance bakteri Escherichia coli tingkat ternak menghasilkan model regresi logistik ganda Ln () = 0.21964 + 1.60374 RefTS + 1.44989 Broiler + 0.96022 PakRacik + 0.84182 ProgAb – 1.16667 SaniKan – 1.15046 Tritendap, dengan peluang kejadian sebesar 94 %. Pemodelan kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan menghasilkan model regresi linier, MDR (Y) = 0.57886 + 0.16105 JUMitra + 0.19342 ProgAb – 0.16178 Dukudrh. Model ini memiliki wilk saphiro mendekati 1 (W = 0,9573) sehingga model persamaan ini merupakan model yang baik untuk kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan.
ANALISIS KUALITAS DAGING AYAM BROILER ASAL PASAR SWALAYAN DAN PASAR TRADISIONAL DI KOTA MEDAN SUMATERA UTARA Dhirgo Adji; Angelina Susanty; Ma’ruf Tafsin
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.54354

Abstract

The mean protein content in broiler chickens from high to low were respectively protein in breast meat from supermarkets: 16.83 ± 0.42 %; breasts from the traditional market: 15.63 ± 1.09 %, thighs from the supermarket: 14.5 ± 0.57 % and thighs from the traditional market: 13.6 ± 0.38 gr / 100 %. Based on all of the datas collection,  the result of statistical analysis using a 2x2 factorial pattern showed that there were no significant differences of water content (P>0.05) whreas: the ash, carbohydrates, fats and proteins showed significant (P£0.05).Thighs from traditional markets 4.5 ± 0.60 % and chest from traditional markets from 5.3 ± 0.69 %. The Average of fat content of broiler meat in the thigh, from supermarket: 2.56 ± 0.63 %; chest origin supermarket 1.2 ± 0.5 %; thigh meat from traditional markets: 3.15 ± 0.21 % and breast meat from traditional markets: 1.8 ± 0.227 %. Broiller is one of the biggest contributor to animals protein from livestock and is a superior commodity in Indonesia. At present, the broiler chicken industry has developed rapidly and become the largest contributor to animal protein as well as a major source of consumer menus that are very easy to obtain, both in modern and traditional markets. After the achievement of the population of broiller chickens, government policy began to emphasize on improving the quality of meat by changing meat characteristics such as appearance, texture, moisture content, firmness, softness, odor, taste and the nutritional content is no exception. Thirty-two samples of broiller chicken meat consisting of 16 meat samples purchased from 4 supermarkets and 16 samples purchased from 4 traditional markets were used as research objects. A hundred grams of fresh meat per sample were purchased and immediately packed in aluminum foil, packaged in a cooler box then sent to the Food and Nutrition Laboratory, Inter-University Center, Gadjah Mada University for proximate analysis. The results of the examination of water concentration showed that the average of water content of thigh meat from supermarkets was 76.26 ± 0.86 %; supermarket breast meat 74.135 ± 0.92 %; thigh meat from the traditional market 75 ± 0.56 % and breast meat from the traditional market: 75.64 ± 1.044 %. Analysis of the average levels of the ash concentration respectively: thighs from the supermarket 0.96 ± 0.027 %, chest from the supermarket 1.095 ± 0.05 %, thighs from the traditional market 1.034 ± 0.106 % and breasts from the traditional market 1.155 ± 0.11%. The average of carbohydrate levels were consecutive: Thigh meat from the supermarket: 5.6 ± 1.33 %; chest of origin of the supermarket: 6.7 ± 1.078 %;
Studi Histopatologi Ren Tikus Putih (Rattus Norvegicus L.) Diabetes Setelah Pemberian Cuka dari Kulit Nanas (Ananas Comosus (L.) Mer.) Tazkia Annisa; Agung Janika Sitasiwi; Sri Isdadiyanto; Siti Nur Jannah
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.56891

Abstract

Diabetes mellitus is a metabolic disease that occurs due to impaired insulin secretion caused by progressive damage to beta cells. Pineapple skin vinegar contained acetic acid and antioxidants which have the potential to help repaired the structure of the nephron ren and other organs affected by diabetes. The purpose of this study was to examined the effectiveness of pineapple skin vinegar on improved the histological structure of diabetic rats ( Rattus norvegicus L.). This study based on changed in the structure of the nephron in samples of normal and alloxan-induced mice pre-treatmented and post-treatmented. Twenty-four rats were divided into 6 groups, named normal control, positive control (diabetes + 0.4 mL apple vinegar), negative control (diabetes + water), dose test groups 1, 2, and 3 (pineapple vinegar 0.2 mL; 0.4 mL; 0.8 mL). Statistical analysis test used ANOVA was followed by Duncan test. The conclusion of this research, the pineapple skin vinegar showed the ability to repair the histopathological structure of white rats damaged by diabetes. The optimum dose needed was 0.8 mL to improved the histological structure of the nephron, as indicated by the glomerular diameter and the distance of the Bowman's capsule space to near normal.
Deteksi Kebuntingan Ternak Sapi : Aplikasi Test Strip Dairy Cow Pregnancy Colloidal Gold Test Strip Sartika Juwita; Mihrani .; Agusriady .; Aris Handono
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.58084

Abstract

Deteksi kebuntingan dini pada ternak sapi sangat penting ditinjau dari segi ekonomi karena akan mempengaruhi pendapatan peternak. Deteksi kebuntingan dini sangat penting untuk memperpendek calving interval melalui peningkatan pengetahuan peternak untuk mengidentifikasi status reproduksi, sehingga dapat melakukan terapi dan mengawinkannya sesegera mungkin. Kegiatan penetapan ternak sapi bunting atau tidak bunting dilaksanakan dengan metode deteksi kebuntingan. Penelitian ini bertujuan untuk mengetahui akurasi test strip dalam diagnosis kebuntingan pada ternak sapi. Test strip digunakan untuk mendeteksi kebuntingan 46 ekor ternak sapi Bali betina yang berasal dari peternakan rakyat.  Hasil menunjukkan bahwa test strip yang dilakukan pada 30 hari pasca inseminasi buatan menunjukkan sensitivitas 75% dan spesifisitas 90%. Test strip dapat digunakan untuk deteksi kebuntingan dini pada ternak sapi.
Faktor Risiko Potensial terhadap Canine Leptospirosis di Ragunan Animal Hospital Jakarta, Indonesia Ambar Retnowati; Agustin Indrawati; Upik Kesumawati Hadi; Safika .; Pratitis S Wibowo; Susan M Noor
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.60354

Abstract

Leptospirosis is a zoonotic disease caused by bacteria Leptospira sp. which causes infection in animals and humans. Dogs infected with leptospirosis showed symptoms such as anorexia, fever, vomiting, weakness, diarrhea and often experience yellowing of the eye area and mucosa around the mouth (icteric) with fatal systemic complications and multi-organ dysfunction, especially in the kidneys and liver. Leptospirosis is an endemic disease in Jakarta. This study aims to identify risk factors that can contribute to canine mortality based on early clinical symptoms that are found when the dog is in an animal health service facility such as a veterinary clinic, veterinary hospital or independent practice veterinarian. Method were used in this study is clinical manifestations and laboratory examinations and medical records of dogs with suspected leptospirosis. Criteria inclusion were based on aspects of the clinical symptoms of dogs in and around Jakarta. Analysis data used the chi-square with confidence of interval (CI) 95%. Dogs used during the study had ages for puppies (less than 1 year) totaling 13 or 32.50%, for adult dogs over 1 year amounted to 27 or 67.50%, 80% male dogs and 20% female. with 80% maintenance system not housed by the owner. Risk factors for clinical symptoms such as myalgia, symptomatic vomiting of the pulmonary area or shortness of breath and abdominal pain, conjunctival suffusion, anorexia and diarrhea contributed to the high mortality rate leptospirosis during study in dogs 2020.
Gangguan Pertumbuhan Organ Limfoid Ayam Broiler yang Menderita Omfalitis Bambang Sutrisno; R Wasito; Sitarina Widyarini; Yuli Purwandari Kristianingrum; Sugiyono .
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.60465

Abstract

Penelitian ini bertujuan untuk melihat gangguan pertumbuhan jaringan limfoid primer dan sekunder yang menderita omphalitis dengan pemeriksaan histopatologi diwarnai dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan imunohistokimia streptavidin biotin terhadap interleukin-10 (IL-10) pada ayam muda. Ayam umur 24 hari (DOC) broiler digunakan dan dikumpulkan dari tempat penetasan yang sama di Jawa Tengah di Indonesia. Semua 24 DOC dibagi menjadi dua kelompok yang masing-masing terdiri dari 12 DOC (Grup A) dan 12 DOC omphalitic (Grup B). Semua DOC dirawat di kandang yang berbeda, diberi makan dan diminum di libitum. Pada hari ke 3, 6 dan 9, empat ekor ayam dari masing-masing kelompok ditimbang untuk kemudian dinekropsi. Timus, bursa fabricius dan limpa dikumpulkan dan ditimbang. Semua jaringan diproses secara histopatologi dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan biotin streptavidin imunohistokimia imunopatologi. Data indeks berat limpa, bursa Fabricius dan tymus dianalisis menggunakan program statistik IBM SPSS versi 22. Hasil penelitian menunjukkan bahwa indeks bobot limpa, bursa fabricius dan timus ayam omphalitic (kelompok B) lebih rendah dibandingkan dengan indeks bobot ayam sehat (kelompok A). Indeks berat timus berbeda nyata (P <0, 05). Lesi histopatologis pada organ limfoid diamati pada semua ayam di Grup B. Lesi ditandai dengan penipisan dan nekrosis limfosit. Ayam dari Grup A tidak mengalami perubahan pada organ limfoid. Biotin streptavidin immunostaining dengan ekspresi antibodi policlonal anti IL-10 pada bursa Fabricius pada ayam omphalitic (Grup B) memiliki IL-10 yang sangat sedikit jika dibandingkan dengan ayam sehat (Grup A). Kesimpulan, omfalitis menyebabkan penurunan indeks berat badan yang signifikan dan gangguan pertumbuhan organ limfoid yang ditandai dengan deplesi dan nekrosis limfosit.  

Page 58 of 83 | Total Record : 824

 56   57   58   59   60 

Filter by Year

1995 2025


Reset
Filter By Issues
All Issue Vol 43, No 3 (2025): Desember Vol 43, No 2 (2025): Agustus Vol 43, No 1 (2025): April Vol 42, No 3 (2024): Desember Vol 42, No 2 (2024): Agustus Vol 42, No 1 (2024): April Vol 41, No 3 (2023): Desember Vol 41, No 2 (2023): Agustus Vol 41, No 1 (2023): April Vol 40, No 3 (2022): Desember Vol 40, No 2 (2022): Agustus Vol 40, No 1 (2022): April Vol 39, No 3 (2021): Desember Vol 39, No 2 (2021): Agustus Vol 39, No 1 (2021): April Vol 38, No 3 (2020): Desember Vol 38, No 2 (2020): Agustus Vol 38, No 1 (2020): April Vol 37, No 2 (2019): Desember Vol 37, No 1 (2019): Juni Vol 36, No 2 (2018): Desember Vol 36, No 1 (2018): Juni Vol 35, No 2 (2017): Desember Vol 35, No 1 (2017): Juni Vol 34, No 2 (2016): Desember Vol 34, No 1 (2016): Juni Vol 33, No 2 (2015): Desember Vol 33, No 1 (2015): JUNI Vol 32, No 2 (2014): DESEMBER Vol 32, No 1 (2014): JUNI Vol 31, No 2 (2013): DESEMBER Vol 31, No 1 (2013): JULI Vol 30, No 2 (2012): DESEMBER Vol 30, No 1 (2012): JUNI Vol 29, No 2 (2011): DESEMBER Vol 29, No 1 (2011): JUNI Vol 28, No 2 (2010): DESEMBER Vol 28, No 1 (2010): JUNI Vol 27, No 2 (2009): DESEMBER Vol 27, No 1 (2009): JUNI Vol 26, No 2 (2008): DESEMBER Vol 26, No 1 (2008): JUNI Vol 25, No 2 (2007): DESEMBER Vol 25, No 1 (2007): JUNI Vol 24, No 2 (2006): DESEMBER Vol 24, No 1 (2006): JUNI Vol 23, No 2 (2005): DESEMBER Vol 23, No 1 (2005): JUNI Vol 22, No 2 (2004): DESEMBER Vol 22, No 1 (2004): Juli Vol 21, No 2 (2003): DESEMBER Vol 21, No 1 (2003): JULI Vol 20, No 2 (2002): Desember Vol 20, No 1 (2002): Juli Vol 19, No 2 (2001): DESEMBER Vol 18, No 1&2 (2000) Vol 18, No 2 (2000) Vol 18, No 1 (2000) Vol 17, No 1 (1999) Vol 16, No 2 (1999) Vol 16, No 1 (1998) Vol 15, No 1&2 (1996) Vol 14, No 2 (1995) More Issue