Article Per Year (5 Year)
p-Index From 2021 - 2026
2.162
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Media Teknologi Hasil Perikanan Jurnal MIPA PHARMACON JURNAL ILMIAH PLATAX Jurnal Bios Logos JURNAL BIOMEDIK Jurnal Ilmu Alam dan Lingkungan The Studies of Social Sciences Jurnal Perempuan dan Anak Indonesia ZOOTEC Makara Journal of Science Jurnal Ilmiah Sains Heca Journal of Applied Sciences Grimsa Journal of Science Engineering and Technology Kalwedo Sains (KASA)
BEIVY JONATHAN KOLONDAM
Department of Biology, Faculty of Mathematics and Natural Sciences, University of Sam Ratulangi, Kampus UNSRAT Bahu, Manado 95115
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Physics Social Sciences Veterinary Other

Published : 35 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 7 Documents
Search
Journal : Jurnal Bios Logos

 1 
Uji Antibakteri Nanopartikel Kitosan terhadap Pertumbuhan Bakteri Staphylococcus aureus dan Escherichia coli. Magani, Alce K; Tallei, Trina E; Kolondam, Beivy J
JURNAL BIOS LOGOS Vol 10, No 1 (2020): JURNAL BIOS LOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.10.1.2020.27978

Abstract

Uji Antibakteri Nanopartikel Kitosan terhadap Pertumbuhan Bakteri Staphylococcus aureus dan Escherichia coli.(Antibacterial Test of Chitosan Nanoparticles against Staphylococcus aureus and Escherichia coli) Alce K. Magani*, Trina E. Tallei, Beivy J. KolondamProgram Studi Biologi, FMIPA Universitas Sam Ratulangi, Manado 95115*Email korespondensi: alcemagani@gmail.com (Article History: Received 30-12-2019; Revised 15-01-2020; Accepted 23-01-2020) Abstrak Antibakteri merupakan zat yang dapat menghambat pertumbuhan bakteri dan dapat membunuh bakteri penyebab infeksi. Staphylococcus aureus dan Escherichia coli merupakan bakteri Gram positif dan Gram negatif yang dapat menimbulkan infeksi atau penyakit dalam tubuh. Penelitian ini bertujuan untuk menguji aktivitas bakteri patogen dengan memakai nanopartikel kitosan sebagai antibakteri yang dibuat dalam empat konsentrasi (0,5%, 1%, 1,5% dan 2%) serta penggunaan kontrol asam asetat 1%, ciprofloxacin dan air steril sebagai pembanding. Metode penelitian yang digunakan yaitu metode gelasi ionik untuk pembuatan nanopartikel kitosan dan difusi agar untuk pengujian antibakteri. Data dianalisis dengan One Way Anova yang dilanjutkan dengan metode BNT (Beda Nyata Terkecil). Hasil penelitian diperoleh penghambatan pertumbuhan bakteri S. aureus dan E. coli tertinggi pada konsentrasi 0,5%, dengan diameter zona hambat hari pertama sampai hari ketiga 12,31 mm, 9,98 mm, dan 20,46 mm pada S. aureus dan 15,88 mm, 18,71 mm, dan 20,43 mm pada E. coli, kategori kuat, dan bersifat bakteriostatik dan penghambatan terendah pada konsentrasi 2% dengan diameter zona hambat pada S. aureus yaitu 5,56 mm, 5,50 mm, dan 5,40 mm, dan pada E. coli yaitu 5,93 mm, 9,64 mm, dan 12,58 mm, kategori sedang, dan bersifat bakteriostatik. Kata kunci: Kitosan, nanopartikel kitosan, aktivitas antibakteri.  Abstract Antibacteria is a substance that can inhibit the growth of bacteria and able to kill bacteria that cause infections. Staphylococcus aureus and Escherichia coli are Gram positive and Gram negative bacteria that able to cause infections or diseases. This study aimed to examine the activity of pathogenic bacteria by using chitosan nanoparticles as antibacterial. The treatments were made in four concentrations (0.5%, 1%, 1.5% and 2%) and, for comparison, there were also acetic acid control, ciprofloxacin and sterile water. The research method used is the ionic gelation method for the manufacture of chitosan nanoparticles and agar diffusion for antibacterial testing. Data were analyzed with One Way Anova followed by LSD (Least Significant Difference) method. The results showed the highest inhibition of growth of S. aureus and E. coli bacteria at a concentration of 0.5%, with a diameter of inhibition zones of the first day to the third day of 12.31 mm, 9.98 mm, and 20.46 mm in S. aureus and 15,88 mm, 18,71 mm, and 20,43 mm in E. coli, the strong category, and are bacteriostatic and the lowest inhibition was at 2% concentration with inhibition zone diameters in S. aureus namely 5.568 mm, 5.50 mm, and 5, 40 mm, and in E. coli, 5.93 mm, 9.63 mm and 12.58 mm, the medium category and bacteriostatic.Key words: Chitosan, nanoparticles chitosan, antibacterial activity.
Barcode DNA berdasarkan Gen rbcL dan matK Anggrek Payus Limondok (Phaius tancarvilleae) (DNA Barcode of Payus Limondok Orchid (Phaius tancarvilleae) Based on the rbcL and matK genes) Kolondam, Beivy J; Lengkong, Edy; J. Polii, Mandang; Pinaria, Arthur; Runtunuwu, Semuel
JURNAL BIOS LOGOS Vol 2, No 2 (2012): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.2.2.2012.1041

Abstract

Metode identifikasi spesies telah disepakati menggunakan barcode DNA standar yaitu gen rbcL dan gen matK. Tujuan penelitian ini untuk menentukan tingkat kemiripan sekuens barcode DNA tanaman Anggrek Payus Limondok (Phaius tancarvilleae) dengan spesies kerabatnya yang sudah terdata dalam BOLD Systems, merekomendasi penggunaan barcode untuk mengidentifikasi atau mengkonfirmasi spesies ini, dan mengamati variasi intraspesifik. Teknik Polymerase Chain Reaction (PCR) digunakan untuk mengamplifikasi sekuens gen rbcL dan matK melalui primer universal. Barcode rbcL menunjukkan kemiripan 100% (identik) dengan dua spesies berbeda dalam famili yang sama (Orchidaceae), sehingga tidak bisa diandalkan untuk identifikasi spesies P. tancarvilleae secara akurat. Sekuens matK sampel menghasilkan kemiripan 100% dengan spesies sama yang sebelumnya telah terdata dalam BOLD Systems. Kemiripan ini mengindikasikan rendahnya variasi genetik intraspesies tetapi sekuens matK dapat diandalkan untuk identifikasi atau konfirmasi spesies anggrek P. tancarvilleae.Kata Kunci: barcode, rbcL, matK, Phaius tancarvilleae AbstractSpecies identification methods convention have been recommended to use standard DNA barcode for plants; the rbcL and matK genes. The aims of this research were to determine similarities in barcode DNA sequences of Payus Limondok Orchid (Phaius tancarvilleae) with its close relatives that listed in BOLD Systems, to recommend the use of DNA barcodes for identification or confirmation of this species, and to observe intraspecific variations. Polymerase Chain Reaction technique was employed to amplify rbcL and matK genes using universal primers. The rbcL barcode of Payus Limondok resulted identical hit with other two different species in the same family (Orchidaceae), therefore, unreliable for accurate P. tancarvilleae species identification. The matK sequence of this plant was 100% similar with the same plant species listed in BOLD Systems. This similarity indicated low genetic variation within the species, but the matK sequence was found to be reliable for P. tancarvilleae orchid species identification or confirmation.Keywords: barcode, rbcL, matK, Phaius tancarvilleae
Variasi Gen matK dan Filogenetik Tumbuhan Kantong Semar (Nepenthes sp.) dari Gunung Mahawu dan Gunung Soputan di Sulawesi Utara (The Variation of matK Gene and the Phylogeny of Nepenthes sp. Obtained from Mount Mahawu and Mount Soputan in North Sulawesi) Tambuwun, Jenifer; Kolondam, Beivy J; Tallei, Trina E
JURNAL BIOS LOGOS Vol 7, No 1 (2017): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.7.1.2017.15816

Abstract

Abstrak Kantong semar (Nepenthes sp.) merupakan salah satu tumbuhan langka yang dilindungi. Eksploitasi yang berlebihan, serta alih fungsi hutan menjadi ancaman bagi kehidupan Nepenthes sp. Penelitian ini bertujuan untuk menentukan variasi gen matK dari tumbuhan Nepenthes sp. di Gunung Mahawu (JTM) dan Gunung Soputan (JTS) di Sulawesi Utara dan membandingkannya dengan kerabat terdekat di GenBank, serta membuat pohon filogenetiknya. Hasil penelitian menunjukkan bahwa hanya terdapat satu perbedaan nukleotida sekuens gen matK antara Nepenthes sp. dari Gunung Mahawu dan Gunung Soputan. Selain itu, variasi juga ditunjukan pada Nepenthes sp. yang diperoleh dari basis data GenBank dengan adanya perbedaan 1-7 basa nukleotida dengan sampel penelitian ini. Hasil analisis menggunakan ABGD (Automatic Barcode Gap Discovery) menunjukkan bahwa variasi intraspesies untuk Nepenthes sp. berada dalam rentang 0,000 – 0,004. Apabila mempertimbangkan barcode gap tersebut sebagai pembatas spesies, maka diasumsikan bahwa JTM, JTS, N. fusca, N. pilosa, N. maxima, N. faizaliana, dan N. clipeata merupakan spesies yang sama. Hal ini ditunjang oleh rekonstruksi pohon filogenetik menggunakan gen matK.Kata Kunci: ABGD, barcode gap, gen matK, Nepenthes sp., pohon filogenetik, variasi sekuens. Abstract Tropical pitcher plant (Nepenthes sp.) is listed as one of the endangered and protected plants. Excessive exploitation and forest conversion threaten the life of this Nepenthes sp. This research was aimed to determine variation in matK gene of Nepenthes sp. obtained from Mount Mahawu (JTM) and Mount Soputan (JTS) North Sulawesi, and compare the matK sequences with their allied taxa in public domain data base. Analysis of matK gene showed that there was only one nucleotide difference of matK gene sequence between Mahawu and Soputan samples. There were 1-7 different nucleotides between those samples and their allied taxa. Analysis of barcode gap using ABGD (Automatic Barcode Gap Discovery) showed that the range of intraspecies variation of Nepenthes sp. was 0,000 – 0,004. Considering this barcode gap generated from ABGD as species delimination, it could be assumed that JTM, JTS, N. fusca, N. pilosa, N. maxima, N. faizaliana, dan N. clipeata were the same species. These results were also supported by the reconstruction of phylogenetic tree using matK gene.Keywords: ABGD, barcode gap, matK gene, Nepenthes sp., phylogeneteic tree, sequence variation. 
Barcode DNA Anthurium Gelombang Cinta (Anthurium plowmanii) berdasarkan gen rbcL dan matK (The DNA Barcode of Anthurium Wave of Love (Anthurium plowmanii) based on rbcL and matK Genes) Kolondam, Beivy J; Lengkong, Edy; Polii-Mandang, J; Semuel, Runtunuwu; Pinaria, Arthur
JURNAL BIOS LOGOS Vol 3, No 1 (2013): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.3.1.2013.3385

Abstract

AbstrakMetode standar untuk identifikasi spesies tumbuhan melalui barcode DNA telah direkomendasikan untuk menggunakan dua gen plastida yaitu rbcL dan matK. Tujuan penelitian ini yaitu untuk menentukan tingkat kemiripan sekuens barcode DNA tanaman Anthurium Gelombang Cinta (Anthurium plowmanii) dibandingkan spesies kerabatnya yang sudah terdata dalam BOLD Systems dan untuk merekomendasi penggunaan barcode DNA yang bisa diandalkan dalam mengidentifikasi spesies ini. Teknik Polymerase Chain Reaction (PCR) digunakan dalam perbanyakan sekuens fragmen gen rbcL dan gen matK oleh primer universal yang tersedia. Hasil penelitian menyimpulkan bahwa sampel tanaman A. plowmanii menghasilkan sekuens barcode rbcL yang mirip 100% (identik) dengan spesies A. cubense. Ini berarti barcode DNA rbcL tidak dapat digunakan untuk identifikasi tingkat spesies. Sekuens barcode matK sampel menunjukkan kemiripan 99,1% dengan A. ravenii yang berbeda dalam morfologi daun. Sekuens matK sampel bersifat unik diantara anggota-anggota genus Anthurium sehingga direkomendasikam penggunaannya untuk identifikasi sampai tingkat spesies.Kata Kunci: barcode, rbcL, matK, Anthurium plowmaniiAbstractStandard method for plant species identification through DNA barcode has been recommended to use two plastids genes; the rbcL and matK. The aims of this research were to determine similarities in DNA barcode sequences of Anthurium Wave of Love (Anthurium plowmanii) with its close relatives that listed in BOLD Systems and to recommend the reliable DNA barcode for identification of this species. Polymerase Chain Reaction was employed to amplify rbcL and matK genes fragments using available universal primers. The result showed that A. plowmanii sample was 100% similar to A. cubense. For that reason, the rbcL gene is not a reliable for species identification. Sequence of matK barcode showed 99.1% in similarity with A. ravenii which has different leaf shape. The matK sequence of sample was unique among all listed Anthurium members, therefore, this barcode are recommended for plant identification to the species level.Keywords: barcode, rbcL, matK, Anthurium plowmanii
DNA Barcoding Tanaman Daluga (Cyrtosperma spp) dari Kepulauan Sangihe Berdasarkan Gen matK (DNA Barcoding Daluga Plant (Cyrtosperma spp) of Sangihe Island Based on matK Gene) Julianti, Eka; Pinaria, Arthur; Lengkong, Edy F; Kolondam, Beivy J
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10547

Abstract

Abstrak  Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5’CGTACAGTACTTTTGTGTTTACGAG 3’) dan matK-1R-f (5’ACC CAGTCCATCTGGAAATCTTGGTTC3’). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp. Abstract  Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not  distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.
Identifikasi Tumbuhan Paku Air (Azolla sp.) Secara Morfologi dan Molekuler dengan Menggunakan Gen rbcL (Identification of Water Ferns (Azolla sp.) Based on Morphologycal Traits and Molecular Marker Using rbcL Gene) Mantang, Wianita; Mantiri, Feky R.; Kolondam, Beivy J.
JURNAL BIOS LOGOS Vol 8, No 2 (2018): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.8.2.2018.21445

Abstract

Abstrak Azolla merupakan salah satu tumbuhan paku air yang memiliki banyak manfaat, namun belum banyak dikenal dan sering dianggap sebagai tumbuhan gulma. Pengidentifikasian akan keberadaan jenis-jenis tumbuhan paku air (Azolla sp.) penting untuk dilakukan guna mendukung upaya pengembangan, pembudidayaan dan eksplorasi tumbuhan Azolla sp. Penelitian ini bertujuan untuk mengidentifikasi spesies tumbuhan paku air (Azolla sp.) secara morfologi dan molekuler dengan menggunakan gen rbcL. Hasil penelitian menunjukkan bahwa berdasarkan karakter morfologi sampel tumbuhan Azolla sp. asal Tondano Sulawesi Utara menunjukkan kemiripan dengan spesies A. pinnata dan Azolla asal Magelang Jawa Tengah menunjukkan kemiripan dengan spesies A. microphylla. Identifikasi menggunakan sekuens gen rbcL menunjukkan bahwa sekuens sampel tumbuhan Azolla asal Tondano (WM1) memiliki tingkat kemiripan 100% dengan A. pinnata dan Azolla asal Magelang (WM2) memiliki tingkat kemiripan 100% dengan A. microphylla yang terdapat dalam GenBank. Analisis jarak genetik menunjukkan kedua sampel WM1 dan WM2 memiliki hubungan kekerabatan yang cukup dekat dengan nilai jarak genetik 0,060.Kata kunci: Azolla sp., identifikasi morfologi, identifikasi molekuler, gen rbcL Abstract Azolla is one of the water ferns that has many benefits, but it is not yet widely known and is often regarded as a weed plant. Identification of water ferns (Azolla sp.) is important to be carried out to support the development, cultivation, and exploration of Azolla sp. This study aimed to identify species of aquatic plants (Azolla sp.) morphologically and molecularly using the gene rbcL. The results demonstrated that based on the morphological characters, the Azolla sp. from Tondano, North Sulawesi, showed similarity with species A. pinnata and Azolla from Magelang, Central Java, showed similarity to species A. microphylla. Identification using rbcL gene sequences showed that the sample sequence of plants Azolla from Tondano (WM1) had a 100% similarity level with A. pinnata and Azolla from Magelang (WM2) had a 100% similarity level with A. microphylla available in GenBank. Genetic distance analysis showed that both WM1 and WM2 samples had a close relationship with the genetic distance value of 0.060.Key words: Azolla sp., morphological identification, molecular identification, rbcL gene
Potensi Environmental DNA (e-DNA) Untuk Pemantauan dan Konservasi Keanekaragaman Hayati Marfuah, Siti; Kolondam, Beivy Jonathan; Tallei, Trina Ekawati
JURNAL BIOS LOGOS Vol 11, No 1 (2021): JURNAL BIOS LOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.11.1.2021.31780

Abstract

(Article History: Received January 6, 2021; Revised February 12, 2021; Accepted February 28, 2021) ABSTRAK Hilangnya spesies dan adanya spesies invasif dalam suatu habitat dapat menjadi ancaman bagi spesies asli dalam satu ekosistem. Untuk itu diperlukan teknik terkini yang mampu mendeteksi keberadaan suatu organisme. Salah satu teknik yang dapat mendeteksi organisme target di lingkungan secara cepat dan akurat yaitu environmental DNA (e-DNA).Tujuan dari ulasan artikel ini yaitu untuk mengeksplorasi kemampuan e-DNA secara ekogenomik untuk pemantauan dan konservasi keanekaragaman hayati. Ulasan artikel ini menggunakan data sekunder yang diperoleh dari berbagai database yang berbasis dalam jaringan. Hasil analisis memperlihatkan bahwa dengan menggunakan pendekatan e-DNA pemantauan dan konsevasi keanekaragaman hayati dapat dideteksi sesuai dengan taksonomi organisme dan penanda molekuler. Penanda molekuler Cytochrome c Oxidase subunit 1 (COI) mampu mendeteksi berbagai spesies baik langka dan invasif. Dengan demikian dapat disimpulkan bahwa pendekatan e-DNA dapat dijadikan sebagai metode untuk pemantauan dan konsevasi keanekaragaman hayati pada berbagai ekosistem.Kata - kata kunci: environmental DNA; keanekaragaman hayati dan konservasi; penanda molekuler  ABSTRACTThe loss of species and the presence of invasive species in a habitat can be a threat to native species in an ecosystem. So we need the latest techniques that are able to detect the presence of an organism. One technique that can detect target organisms in the environment quickly and accurately is environmental DNA (e-DNA). The purpose of this review article is to explore the ecogenomic ability of e-DNA for monitoring and conservation of biodiversity. This article reviews using secondary data obtained from various network-based databases. The results of the analysis show that by using the e-DNA approach, monitoring and conservation of biological diversity can be detected according to the taxonomy of organisms and molecular markers. Cytochrome c Oxidase subunit 1 (COI) molecular markers are capable of detecting a variety of both rare and invasive species. Thus it can be concluded that the e-DNA approach can be used as a method for monitoring and conservation of biological diversity in various ecosystems.Keywords: environmental DNA; biodiversity and conservation; molecular markers
Co-Authors Abas, Abdul Hawil Adelfia Papu Agustina Monalisa Tangapo Akihary, Claudia Valleria Arthur G. Pinaria Balansa, Endrile Golmen Bernadus, Zefanya Bernadus, Zefanya G Dantje Tarore Deidy Katili Edwin de Queljoe Edy F Lengkong, Edy F Edy Lengkong Eka Julianti Fatimawali . Feky R. Mantiri Fitri Elizabrth Br Hasibuan Indra Polii, Indra J Polii-Mandang J. Polii, Mandang Johanis Pelealu Johanis Pelealu Koneri , Roni Laksono Trisnantoro Lalu Wahyudi Lisa Ruga Loho, Jesica C. M. Magani, Alce K Makagansa, Marbela Mamahit, Juliet Merry Eva Mangindaan, Glanny Mantang, Wianita Marnix L. D. Langoy Marnix L.D. Langoy Marnix Langoy Meiranty C. Pangerapan, Meiranty C. Mende, Pingkan S. Mende, Pingkan Stela Nelsyani Pasappa Olivia H Abram Pahlevi, Dylan R. Pience Veralyn Maabuat Presticilla D Irawan Presticilla D Irawan Presticilla D Irawan, Presticilla D Roni Koneri Runtunuwu Semuel Runtunuwu, Semuel Salaki, Christina Leta Sari, Nadia Warda Sekar Saroyo Saroyo Susan Marlein Mambu Susan Marlein Mambu Tambuwun, Jenifer Timbuleng, Kevin Trina E Tallei Trina E Tallei Trina Ekawati Tallei TRINA EKAWATI TALLEI TRINA EKAWATI TALLEI