cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota mataram,
Nusa tenggara barat
INDONESIA
Jurnal Biologi Tropis
Published by Universitas Mataram
ISSN : 14119587     EISSN : 25497863     DOI : -
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology
Jurnal Biologi Tropis (ISSN Cetak 1411-9587 dan ISSN Online 2549-7863) diterbitkan mulai tahun 2000 dengan frekuensi 2 kali setahun oleh Program Studi Pendidikan Biologi PMIPA FKIP Universitas Mataram, berisi hasil penelitian dan ulasan Ilmiah dalam bidang Biologi Sains.
Arjuna Subject : -
Articles 2,520 Documents
 172   173   174   175   176 
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
The effect of Concentration and Application Method of Potato Starch Edible Coating on the Quality of Tomatoes Ramadani, Rifani; Syah, Ryan Firman; Kristalisasi, Elizabeth Nanik
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8501

Abstract

Tomatoes are a perishable commodity meaning they are prone to spoilage and physiological damage after harvest can affect their shelf life, solution to address this issue is by using coating. This study aims to determine how the interaction between concentration and application method of potato starch edible coating affects the results and to find the best concentration and application method of the potato starch edible coating. The research was conducted at the central laboratory of the Instiper campus in Maguwoharjo, Sleman District, Yogyakarta. A Completely Randomized Design (CRD) with two factors was used in this study. The first factor is the concentration of the edible coating solution, which consists of 5 levels (control, 2.5%, 5%, 7.5%, and 10%). The second factor is the application method of the potato starch edible coating, which consists of 3 levels (dipping, spraying, and brushing), each with 3 replications. The data obtained were then analyzed using Analysis of Variance (ANOVA) at a 5% significance level. If significant differences were found, further tests were performed using Duncan’s Multiple Range Test (DMRT) at a 5% significance level. The results showed that there is an interaction between the concentration and application method of the potato starch edible coating on the vitamin C content and texture of the tomatoes. Tomatoes coated with 5% potato starch edible coating showed the best results in terms of vitamin C content and texture, and the application method of the edible coating produced similar results when compared to dipping in terms of tomato color.
Literatur Review: Analysis of Essential Oil Secondary Metabolite Content in Several Plants Noli, Zozy Aneloi; Delfi, Shyla Aulia; Zulkarnain, Alivia; Syabila, Hutri Dinda; Rusiati, Anisa Rahman; Santoso, Putra
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8513

Abstract

Indonesia’s rich plant biodiversity offers a wide array of secondary metabolites, including essential oils, known for their antioxidant, antifungal, and antibacterial properties. This review article examines the secondary metabolite composition of essential oils from various plant species by synthesizing findings from existing literature. The review article highlights the presence of diverse compounds, including terpenes, phenols, and alkaloids, with variations observed between species—for instance, limonin in citrus, linalool in ylang-ylang, and eugenol in cloves. Commonly utilized methodologies, such as steam distillation and GC-MS analysis, discuss their effectiveness in characterizing essential oil components. The findings underscore the extensive potential of crucial oils for applications in health, food, and cosmetic industries, providing a foundation for future research and practical innovations.
Effect of Sensor and Based NPK on the Growth of Pakcoy (Brassica rapa L.) Cultivation Hydroponic Sania, Hani; Fevria, Resti; Vauzia, Vauzia; Razak, Abdul; Yulkifli, Yulkifli; Mutiar, Sri
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8514

Abstract

In hydroponic cultivation, the effectiveness of nutrient distribution is crucial in ensuring optimal plant growth. This research aims to compare the efficiency of nutrient solution delivery using an Internet of Things (IoT)-based NPK sensor with the conventional manual method on the growth of pakcoy (Brassica rapa L.). The study was conducted using a Completely Randomized Design (CRD) with two treatment groups: one utilizing IoT-based NPK sensors and the other without sensors. Each treatment was repeated twice, with nine plant samples per repetition. The observed growth parameters included plant height, number of leaves, leaf area, fresh weight, and dry weight at six weeks after planting. The findings revealed that the implementation of IoT-based NPK sensors significantly enhanced the growth of pakcoy plants compared to the manual method. This was evidenced by a notable increase in plant height, leaf area, and fresh weight (p < 0.05). In conclusion, the application of IoT technology improves the efficiency and effectiveness of nutrient distribution in hydroponic systems, positively impacting plant growth. The scientific significance of this research suggests that integrating IoT-based technology into hydroponic farming can serve as an innovative approach to enhancing plant productivity in a precise and sustainable manner.
Arthropoda Diversity in High-Value Conservation Areas of Rokan Hulu's Palm Oil Ecosystems Dewastra Bayu Wicaksana, Satya; Ardyan Pramudya Kurniawan; Prautama, Cahaya; Julia Rizki Jumas; Hutabarat, Frengky; Tambunan, Ardian Syahputra
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8519

Abstract

The transformation of tropical forests into oil palm plantations in Indonesia has significantly impacted biodiversity, including arthropod species, which serve as indicators of ecosystem health. This study investigates the diversity of arthropods in High Conservation Value (HCV) areas within the oil palm ecosystem of Rokan Hulu, Riau Province. The research was conducted in three HCV areas—Sialang Forest, Makam Keramat Forest, and Pendalian River—using the Visual Encounter Survey (VES) method. Observations were made in July–August 2024, documenting species diversity and environmental parameters. A total of 187 arthropod individuals from 38 species and 12 families were identified, with Libellulidae (dragonflies) and Nymphalidae (butterflies) as the most dominant families. Diversity and evenness indices were calculated using the Shannon-Wiener and Evenness formulas, yielding values of 3.05 (high diversity) and 0.558 (moderate evenness), respectively. Environmental parameters, such as light intensity4802,00±6204,84 Lux; wind speed 0,33±0,52 m/s; humidity 72,53±16,02%; temperature 31,63±4,20°C; and soil pH 6,42±0,38 were measured, supporting arthropod distribution.
Optimization of Growth and Production of Two Kale Varieties Through the Addition of Led Light Asyar, Ahmad Wildan; Budiman, Budiman; Sugeru, Herik; Samudra, Bagas Elang
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8527

Abstract

The high demand for water spinach demands increased production through more efficient cultivation techniques. One important factor that affects plant growth and production is lighting. This study aims to optimize the growth and production of two varieties of water spinach by adding LED lights with a certain light spectrum and duration. The study used a Nested Complete Randomized Block Design (RBD) consisting of two factors. The first factor is the light spectrum (L) with 3 levels, namely the red light spectrum of the 18/6 photoperiod (L1), the blue light spectrum of the 18/6 photoperiod (L2), and the red-blue light spectrum of the 18/6 photoperiod (L3). The second factor is the variety of water spinach (V) consisting of two levels, namely the curly water spinach variety (V1) and the lacinato water spinach variety (V2). Each treatment was repeated 4 times so that there were 24 experimental units. Data analysis used ANOVA with a 5% confidence level and further testing using the Duncan test. The results showed that the growth and production of the two varieties of water spinach were more optimal with the addition of the red-blue light spectrum.
Tree and Sapling Level Vegetation Analysis in the Social Forestry Area of Nagari Sumpur Kudus, Sijunjung Regency Marqfirokh, Ramadhana; Chairul
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8534

Abstract

This research was conducted in the Social Forestry Area of Nagari Sumpur Kudus, from May to October 2023. The reseacrh on this study airns to determine the composition and structure of tree and sapling vegetation in the Social Forestry Area of Nagari Sumpur Kudus, Sijunjung Regency. The method used in this study was a 120-meter transect line with 12 plots. In the plot, sub-plots were made with a size of 10 m x 10 m for the tree level and 5 m x 5 m for the sapling level. The results showed that there were 14 families, 14 genus, 14 species, and 19 individuals at the tree level. The co-dominant families, namely the Cornaceae, Euphorbiaceae, Phyllanthaceae and Ulmaceae. The compotition of sapling level was founds 17 families, 29 genus, 36 species, and 40 individuals. The co-dominant families are in the Phyllanthaceae and Euphorbiaceae. The highest importance index at the tree level was found in the Alangium sp. and the lowest was found in the Dipterocarpus confertus. the highest importance index for sapling level was found in the Cephalomappa malolpticarpa and the lowest was found in the Bischofia javanica and Nephelium cuspidatum. The diversity index (H') for tree-level plants is classified as medium and (H') for sapling-level plants is high.
The Relathionship Between CD31 Immunohistochemical Expression and Meningioma Grading Differences Febriana, Nanggi Qoriatul; Rosyidi, Rohadi Muhammad; Januarman, Januarman; Rahim, Adelia Riezka; Prihatina, Lale Maulin
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8539

Abstract

The proper management of meningioma patients requires a definitive diagnosis of the meningioma grade by examining the expression of CD31 in tumor blood vessels using immunohistochemical staining. This study aims to determine the relationship between CD31 immunohistochemical expression and the grading differences of meningiomas. Nine paraffin block samples from the surgical tissue of meningioma patients were used, with three samples each from grade I, grade II, and grade III meningiomas. Immunohistochemical staining for CD31 was then performed on each meningioma slide, and the samples were observed under a binocular light microscope with 200x magnification. The results showed CD31 expression in grade I as 90%, 40%, and 80%; in grade II as 80%, 80%, and 60%; and in grade III as 40%, 20%, and negative (0%). The statistical test results of this study indicate a strong negative correlation between CD31 immunohistochemical expression and meningioma grading differences. The higher the meningioma grade, the lower the CD31 expression found, and vice versa. This research is important to assist neurosurgeons in the proper management of meningioma patients, potentially preventing poor prognosis and complications. It is hoped that future studies will analyze the relationship between CD31 immunohistochemical expression with subtypes of each meningioma grade and their respective locations.
Anti-Bacterial Power of The Pecut Kuda Plant (Stachytarpheta jamaicensis L.) Against Leaf Blight Bacteria (Xanthomonas oryzae) Hidayati, Ernin; Diniati, Herild; Suripto, Suripto
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8540

Abstract

Treating leaf blight in rice, which is caused by the bacterium Xanthomonas oryzae, using anti-bacterial agents from synthetic chemical compounds often causes environmental problems, so it is necessary to study the use of natural anti-bacterial agents. The pecut kuda plant (Stachytarpheta jamaicensis) has the potential to contain anti-bacterial properties because the leaves are often used by the public as a medicine to heal fresh wounds. This research aims to determine the anti-bacterial power of the S. jamaicensis plant against X. oryzae bacteria. S. jamaicensis leaves were extracted in stages using a series of successive solvents, namely hexane, DCM, and ethanol. Each fraction of S. jamaicensis leaf extract was tested for its inhibitory power against the growth of X. oryzae on MHA medium using the well method. The inhibitory variable observed was the diameter of the clear zone formed during 5 x 24 hours of incubation. The clear zone diameter data was analyzed to determine the inhibitory power. The results showed that each fraction of S. jamaicensis leaf extract had inhibitory power against X. oryzae. The S. jamaicensis plant can be developed as a source of natural anti-bacterial which are bacteriostatic, especially against X. oryzae.
Assessment of Lead (Pb) Bioaccumulation in Seluang Fish (Rasbora sp.) and Water Quality Analysis in Miai Riverysis of Lead (Pb) levels in Seluang Fish (Rasbora Sp) in the Miai River in Banjarmasin City Azzahra, Yenni; Santoso, Heri Budi; Muhamat, Muhamat
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8553

Abstract

The waters of the Miai River are located in a densely populated residential area with a variety of household activities and landfills (TPS), one of which is hazardous waste containing heavy metals. Heavy metal lead (Pb) is dangerous because it is toxic. The study's objectives were to quantify the lead concentration in seluang fish and water and ascertain the correlation between fish weight and lead levels in water. The Miai River's waters served as the site of the study. Purposive sampling was used to collect water and seluang fish samples. The Pb concentration was determined using an Atomic Absorption Spectrophotometer (AAS) after samples were collected from two stations three times. The results of Pb content in river water at station 1 averaged around 0.00589 mg/L and station 2 averaged around 0.00690 mg/L and the results of Pb levels in seluang fish at station 1 averaged around 0.00333 mg/kg and station 2 averaged around 0.00600 mg/kg. This means that river water and seluang fish are contaminated with Pb but still below the quality standards set, so they can still be utilized according to their designation and are still safe for consumption. The relationship between Pb in fish and fish weight shows a correlation coefficient of r = -0.598, meaning that the correlation is unidirectional and Pb in water with Pb in fish correlates r = 0.439, indicating a relationship with a moderate level.

Page 174 of 252 | Total Record : 2520

 172   173   174   175   176 

Filter by Year

2013 2026


Reset
Filter By Issues
All Issue Vol. 26 No. 1 (2026): Januari-Maret Vol. 25 No. 4 (2025): Oktober-Desember Vol. 25 No. 4b (2025): Special Issue Vol. 25 No. 4a (2025): Special Issue Vol. 25 No. 3 (2025): Juli-September Vol. 25 No. 2 (2025): April-Juni Vol. 25 No. 1 (2025): Januari - Maret Vol. 24 No. 4 (2024): Oktober - Desember Vol. 24 No. 3 (2024): July - September Vol. 24 No. 2b (2024): Special Issue Vol. 24 No. 2 (2024): April - Juni Vol. 24 No. 1 (2024): Januari - Maret Vol. 24 No. 1b (2024): Special Issue Vol. 23 No. 4 (2023): October - December Vol. 23 No. 3 (2023): July - September Vol. 23 No. 2 (2023): Special Issue Vol. 23 No. 2 (2023): April-June Vol. 23 No. 1 (2023): Special Issue Vol. 23 No. 1 (2023): January - March Vol. 22 No. 4 (2022): October - December Vol. 22 No. 3 (2022): July - September Vol. 22 No. 2 (2022): April - June Vol. 22 No. 1 (2022): January - March Vol. 21 No. 3 (2021): September - Desember Vol. 21 No. 2 (2021): Mei - Agustus Vol. 21 No. 1 (2021): Januari - April Vol. 20 No. 3 (2020): September - Desember Vol. 20 No. 2 (2020): Mei - Agustus Vol. 20 No. 1 (2020): Januari - April Vol. 19 No. 2 (2019): Juli - Desember Vol. 19 No. 1 (2019): Januari - Juni Vol. 18 No. 2 (2018): Juli - Desember Vol. 18 No. 1 (2018): Januari - Juni Jurnal Biologi Tropis vol.17 No.2 Desember 2017 Jurnal Biologi Tropis vol.17 No.1 Juni 2017 Jurnal Biologi Tropis. Vol.16 No.2 Desember 2016 Jurnal Biologi Tropis. Vol.16 No. 1 Juni 2016 Jurnal Biologi Tropis. Vol.15 no.2 Desember 2015 Jurnal Biologi Tropis. Vol.15 No. 1 Juni 2015 Jurnal Biologi Tropis. Vol.14 No. 2 Desember 2014 Jurnal Biologi Tropis. Vol.14 No. 1 Juni 2014 Jurnal Biologi Tropis. Vol.13 No. 2 Desember 2013 Jurnal Biologi Tropis. Vol.13 No.1 Juni 2013 More Issue