Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

1.259

P-Index

This Author published in this journals

All Journal Buletin Udayana Mengabdi Jurnal Veteriner Indonesia Medicus Veterinus Majalah Kedokteran Bandung WARTAZOA Indonesian Bulletin of Animal and Veterinary Sciences Jurnal Kedokteran Hewan Buletin Veteriner Udayana

I Gusti Agung Ayu Suartini

Fakultas Kedokteran Hewan, Universitas Udayana

Author-ID : 237263

Biochemistry, Genetics & Molecular Biology Education Immunology & microbiology Medicine & Pharmacology Public Health Veterinary

Published : 26 Documents Claim Missing Document

Claim Missing Document

Articles

Title

1 2

Pengaruh Pemberian Laktoferin Sapi Terhadap Berat Badan Dan Leukosit Anak Babi Ghina Monita Pramudhita; I Gusti Ngurah Kade Mahardika; I Gusti Ayu Agung Suartini
Jurnal Veteriner Vol 22 No 3 (2021)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan yang ditambahkan laktoferin sapi terhadap berat badan dan leukosit anak babi Landrace. Penelitian dilakukan pada peternakan komersial di Desa Yeh Gangga, Kecamatan Sudimara, Kabupaten Tabanan. Sebanyak 12 anak babi Landrace dari tiga induk yang berbeda digunakan sebagai sampel, dengan pembagian dua kelompok, yaitu kelompok kontrol dan perlakuan. Kelompok kontrol tidak diberikan perlakuan. Kelompok perlakuan diberikan laktoferin sapi selama 7 hari dengan pemberian satu kali dalam satu hari. Penimbangan berat badan anak babi Landrace dilakukan setiap lima hari, kemudian data dianalisis dengan Student’s T-test. Hasil analisis data periode penimbagan berat badan anak babi umur 10 – 35 hari berpengaruh nyata (P<0,05). Pengabilan darah dilakukan pada post perlakuan kemudian diuji dengan uji hematologi. Data yang diperoleh dianalisis menggunakan Student’s T-test. Hasil penelitian menunjukkan bahwa rerata diferensial leukosit tidak berbeda nyata (P>0,05) antara kelompok kontrol dan kelompok perlakuan. Masing-masing komponen leukosit pada kelompok kontrol maupun kelompok perlakuan berada pada rentang nilai normal. Rerata total leukosit anak babi pasca pemberian laktoferin tidak berbeda nyata (P>0,05) antara kelompok kontrol dan kelompok perlakuan.

Pola Pertumbuhan dan Titik Infleksi Sebagai Dasar Memilih Bibit Anjing Kintamani (GROWTH PATTERN AND POINT OF INFLECTION AS THE BASIS OF THE KINTAMANI DOG SELECTION) I KETUT SUATHA; I Gusti Ayu Agung Suartini; I Putu Sampurna
Jurnal Veteriner Vol 20 No 2 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Kintamani dog growth pattern was observed by measuring the length, circumference and body weight. This study aims to obtain a pattern of growth and determine at what age the growth of kintamani dogs reaches the inflection point (begins to grow slowly) and reaches adult size (begins to stop growing). Data on growth patterns and inflection points of kintamani dogs are useful as a reference for determining the right time for the kintamani dog to be first mated, knowing the existence of abnormalities in growth and nutritional status. The research samples were 90 female kintamani dogs and 90 males aged 0 to 800 days. Measurement of body length and circumference uses a meter, while body weight is measured by digital scales. The growth curve used by the estimator is a sigmoid curve with two parameters: the size of body length, chest circumference and body weight at birth and as an adult. The conclusion of this study is that the pattern of growth in body weight, body length, chest circumference, height of the back limbs and height of the front legs of male and female kintamani dogs has a sigmoid growth pattern. The body size of a female dog has an inflection point or begins to grow slowly and reaches an adult size at a younger age than a male. Female dogs also reach the maximum size earlier than male dogs. The speed of reaching the inflection point on the growth of kintamani dogs were: Chest circumference, front limb height, body length, height of the back leg and body weight. While the speed of achieving adult size were : height of the back leg, body length, height of the front limb, chest circumference and weight.

AMINO ACID SEQUENCE MOTIVE OF OSELTAMIVIR BINDING POCKET IN NEURAMINIDASE PROTEIN OF AVIAN INFLUENZA (H5N1) VIRUS FROM HUMAN AND ANIMAL IN INDONESIA I Gusti Ngurah Kade Mahardika; I Made Sukada; Made Suma Antara; I Gusti Ayu Suartini
Jurnal Veteriner Vol 9 No 4 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (175.193 KB)

Former finding that avian influenza (AI) virus of H5N1 subtype from Indonesia shows reduced sensitivity against oseltamivir is critically reviewed trough molecular observation of the amino-acid sequence motive of neuraminidase protein (NA) of all H5N1 virus from human and animal in Indonesia available in GeneBank. Amino acid sequence of oseltamivir binding pocket of NA protein on all Indonesian viruses is typical for sensitive virus with a concerved motive of H274, E276, R292 dan N294. Resistance issue could not be explained based on available data.

Aktivitas Invitro Senyawa Antimikroba Streptococcus lactis (INVITRO ACTIVITY ANTIMICROBIAL SUBSTANCE PRODUCED BY STREPTOCOCCUS LACTIS) I Nyoman Suarsana; Maria Bintang; Iwan Harjono Utama; Ni Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 2 No 1 (2001)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (2816.658 KB)

Aktivitas Invitro Senyawa Antimikroba Streptococcus lactis (INVITRO ACTIVITY ANTIMICROBIAL SUBSTANCE PRODUCED BY STREPTOCOCCUS LACTIS)

Seroprevalensi Virus Avian Influenza H9N2 pada Ayam Kampung (Gallus domesticus) di Pasar Beringkit, Kabupaten Badung, Bali Brigita Galilea Adu; Messy Saputri Boru Sembiring; Oktryna Hodesi Sibarani; I Gusti Ngurah Kade Mahardika; Ida Bagus Kade Suardana; I Gusti Ayu Agung Suartini; Tjokorda Sari Nindhia
Jurnal Veteriner Vol 21 No 3 (2020)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (109.636 KB)

Virus Avian Influenza (Avian Influenza Virus/AIV) subtipe H9N2 (AIV-H9N2) telah menjadi perhatian bagi kesehatan unggas. Virus ini telah dilaporkan di beberapa provinsi di Indonesia. Pasar Beringkit merupakan pasar unggas yang menerima suplai unggas dari berbagai daerah di Bali. Pasar ini menjual berbagai jenis unggas seperti: ayam, itik dan ayam kampung. Penelitian ini bertujuan untuk mengetahui seroprevalensi virus Avian Influenza subtipe H9N2 pada unggas domestik di pasar Beringkit, Kabupaten Badung, Bali. Sebanyak 187 sampel darah dikumpulkan dari tiga kali pengambilan yang berbeda. Serum diambil dari ayam broiler, ayam kampung dan itik yang belum divaksin dan diuji menggunakan Hambatan Hemaglutinasi (Haemagglutination Inhibition/HI). Serum diencerkan lima kali dengan NaCl dan dipanaskan 55oC selama 30 menit sebelum dilakukan pengujian. Hasil pemeriksaan uji HI dianalisis dengan uji statistik Non-parametrik Chi-Square. Hasil penelitian ini menunjukkan bahwa dari 187 sampel serum,43 sampel positif mengandung antibodi AIV-H9N2. Seroprevalensi AIV-H9N2 pada ayam broiler sebesar 15,9% (dari total 63), ayam kampung 35,5% (dari total 62) dan itik sebesar 17,7% (dari total 62). Hasil analisis statistika menunjukkan bahwa sampel yang diambil dari antar spesies dengan tiga kali pengambilan berbeda menunjukkan hasil tidak berbeda nyata. Penelitian ini menunjukkan bahwa unggas domestik di Bali telah terinfeksi AIV-H9N2. Biosekuriti, pengawasan pasar dan vaksinasi efektif dalam mencegah infeksi perlu ditingkatkan. Dampak ekonomi yang disebabkan AIV-H9N2 pada unggas domestik perlu dikaji lebih lanjut.

Karakteristik Protein Plasma Sapi Bali (CHARACTERISTICS OF BALI CATTLE PLASMA PROTEINS) Wahyu Tri Utomo; I Nyoman Suarsana; I Gusti Ayu Agung Suartini
Jurnal Veteriner Vol 18 No 2 (2017)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

An study was carried out to determine the physiological data on plasma protein characteristics of Bal cattle. A total of 24 plasma samples of male and female bali cattle were characterized by using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE). The data were presented descriptively. The results showed that on the basis of their estimated molecular weights, at least 14 protein bands (1st to band 14th) were identified with the molecular weights of 963,50 kDa, 530 kDa, kDa 346,82, 124,84 kDa, 89,85 kDa, 68,67 kDa, 54,71 kDa, 37,77 kDa, 20,78 kDa, 16,95 kDa, 16,18 kDa, 15,46 kDa, 12,56 kDa and 10,46 kDa, respectively from the highest to the lowest. Furthermore, plasma protein bands of 14 bali cattle were grouped into five fractions, namely albumin, globulin a1, a2, b, and g. Albumin fraction shown by the band 6th to 14th with a molecular weight of 68,67 to 10,46 kDa respectively. Globulin fraction a1 and a2 shown by the band 5th and 4th with a molecular weight of 89,85 kDa and 124,84 kDa respectively. b- globulin fraction shown by the band 3rd with a molecular weight of 346,82 kDa. g-globulin fraction was shown by the band 1st and 2nd with a molecular weight of 963,50 kDa and 530 kDa respectively. The percentage of area band Bali cattle plasma protein fraction consists of 92% albumin, globulin fraction a2 of 3%, g-globulin of 2%, globulin a1 and b of 1%. It can be concluded that the plasma protein band Bali cattle male and female calves (aged 0-1.5 years), puberty (ages 2-2.5 years) and adults (aged 3-5 years) amounted to 14 protein bands with varying thickness comprises of the five fractions are albumin, globulin a1, a2, b, and g. ABSTRAK Penelitian ini bertujuan untuk mengetahui karakteristik protein plasma sapi bali. Sebanyak 24 sampel plasma sapi bali jantan dan betina dikarakterisasi menggunakan metode sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE). Data hasil penelitian dianalisis secara deskriptif. Hasil penelitian menunjukkan bahwa berdasarkan perhitungan bobot molekul pita protein ke-1 sampai pita ke-14 secara berurutan memiliki bobot molekul yaitu 963,50 kDa, 530 kDa, 346,82 kDa, 124,84 kDa, 89,85 kDa, 68,67 kDa, 54,71 kDa, 37,77 kDa, 20,78 kDa, 16,95 kDa, 16,18 kDa, 15,46 kDa, 12,56 kDa, dan 10,46 kDa. Selanjutnya, 14 pita protein plasma sapi bali dikelompokan menjadi lima fraksi yaitu albumin, globulin a1, a2, b, dan g. Fraksi albumin ditunjukan oleh pita ke-6 sampai pita ke-14 dengan bobot molekul 68,67-10,46 kDa. Fraksi globulin a1 dan a2 ditunjukan oleh pita ke-5 dan ke-4 dengan bobot molekul 89,85 kDa dan 124,84 kDa. Fraksi globulin b ditunjukan oleh pita ke-3 dengan bobot molekul 346,82 kDa. Fraksi globulin g ditunjukan oleh pita ke-1 dan ke-2 dengan bobot molekul 963,50 kDa dan 530 kDa. Persentase luas pita protein plasma sapi bali terdiri dari fraksi albumin 92%, fraksi globulin a2 3%, globulin g 2%, globulin a1 dan b 1%. Dapat disimpulkan bahwa pita protein plasma sapi bali jantan dan betina pedet (umur 0-1,5 tahun), pubertas (umur 2-2,5 tahun), dan dewasa (umur 3-5 tahun) berjumlah 14 pita protein dengan ketebalan bervariasi terdiri dari lima fraksi yaitu albumin, globulin a1, a2, a, dan g.

Aktivitas IgY dan IgG Antitetanus setelah Perlakuan pada Berbagai pH, Suhu dan Enzim Proteolitik I Gusti Ayu Agung Suartini; I Wayan Teguh Wibawan; Maggy T. Suhartono; Supar -; I Nyoman Suarta
Jurnal Veteriner Vol 8 No 4 (2007)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (259.61 KB)

A study was carried out to find out an alternative method of producing antitetanus antibody (IgY) in chicken and to evaluate its activity at different levels of pH, temperatures and proteolytic enzymes. Antitetanus IgY was produced by immunization of chickens with tetanus toxoid, three times weekly at gradual doses of 100, 200, and 300 Lf, respectively. Serum samples were collected 4 weeks following the last immunization. IgY was purified by ammonium sulfat precipitation and gel filtration chromatography (Sephadex G. 120).The purified IgY was then treated at different levels of temperatures and pH as well as proteolytic enzymes. Commercial antitetanus IgG was used as control. The activities of treated IgY and IgG were tested by enzyme linked immunosorbent assay (ELISA). IgY and IgG activities were significantly reduced at 80ºC and completely destroyed at 90ºC. Treatment with pepsin significantly reduced IgY and IgG whereas trypsin slightly reduced IgY activities and has no effect on IgG activities. IgY and IgG activities were reduced significantly at pH < 3 and and only sightly reduced at pH>10. It is evident that heating at >90oC, pH at <3 and treatment with pepsin significantly reduced IgY activities and it appears that IgG was more resistent to the efect of temperatures, pH and proteolytic enzymes

Kinetika Immunoglobulin Kuning Telur Antiparvovirus Anjing Pada Anjing (KINETICS OF ANTICANINE PARVOVIRUS YOLK IMMUNOGLOBULIN IN DOGS) I Gusti Ayu Agung Suartini; Indrawati Sendow; Ni Luh Putu Agustini; Agik Suprayogi; I Wayan Teguh Wibawan; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (122.941 KB)

Kinetic study on Anti CPV IgY has been performed on six dogs aged 5-10 months. The IgY was injectedintravenously at dose of 21.4mg /10kg body weight. IgY levels in the blood were determined by ELISA. Aresearch was conducted to find out the kinetics of Anti CPV IgY in dogs blood. The kinetics of IgY wascalculated by using regression analysis to determine the association on the levels of IgY in serum againsttime at injection. The results showed that kinetic parameters were calculated based on first order kinetics.The constant elimination rate of IgY was at the range between 0.007 to 0.015 / h. IgY concentration in thedogs blood was from 0.746 to 0.992 mg / mL. The half-life of IgY was from 1.65 to 4.01 / d. Volumedistribution of IgY was between 21.47 to 28,55 / mL. Total IgY in the dog bodies (AUC) was from 42,60 to142,00 mg / mL.h. The duration of the IgY in the dog’s body was 3.08 to 8.51 days. Clearance time of IgY was0.15 to 0.50 mL / h. In conclusion the kinetics of anti CPV IgY in dog’s body follow one compartment andfirst order model, which are only distributed in the blood with the half-life at 2.5 days, and IgY has lesspossibility to accumulate in the body compared to the IgG.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Infeksi Alami Canine Parvovirus pada Anjing Kintamani di Desa Sukawana, Kintamani, Bangli, Bali (NATURAL INFECTION OF CANINE PARVOVIRUS IN KINTAMANI DOGS OF SUKAWANA VILLAGE, KINTAMANI, BANGLI, BALI) I Gusti Ayu Agung Suartini; Indrawati Sendow; I Nyoman Suarsana; Ni Luh Eka Setiasih; Maratun Janah
Jurnal Veteriner Vol 20 No 2 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Kintamani dog as one of germ plasm owned by Bali province has been widely accepted as dog of Indonesian origin which need to be preserved. Report have shown that puppies of Kintamani dogs sold in Denpasar animal market often die due to Canine parvovirus (CPV) infection. The mortality of CPV infection in puppies can reach as high as 91% espescially in unvaccinated dogs. As the mortality of CPV in dogs is very high, it is important to find out the seroprevalence of CPV infection in Kintamani dogs in Sukawana village. Up to now, the seroprevalence of CPV infection in Sukawana, the natural habitate of Kintamani dog has never been reported. In this study the sample collection and area selection was conducted by haemaggutination inhibition (HI) test. Sera sample were concluded positive if the HI titers of sera were > 64 HI units. Seroprevalence of CPV infection was calculated by dividing the number of positive sera with the total sera samples. The seroprevalence of CPV among dogs was determined using non parametric analysis (Chi-Square). From 70 sera samples collected 67.1% (47/70) were antibody positive against CPV. The highest seroprevalence was found in Banjar Sukawana 22.8% (16/70). A higher seroprevalence was found in female dogs 45.7% (32/70) compare to male dogs 21.4% (15/70). Kintamani dogs aged between 724 month have the highest seroprevalence 27.1% (19/70). Based on the distribution of antibody titers, the seroprevalence antibody >64 HI was 65.7%. The result showed that the high titer (> 64 HI) of antibody against CPV, it was shown that CPV infection has occurs naturally in kintamani dog at Sukawana village.

Co-Authors Adrianto, Steven Agik Suprayogi Aida Lousie Tenden Rompis Amalia, Ainun Rizki Amrulloh, Muhammad Faqih Anak Agung Ananda Septiarini Anita Dwi Handayani Areningrat, Putu Ayutia Brigita Galilea Adu Defi Lega Nurwidana Dewi, Kadek Dyah Utami Dewi, Putu Bulan Sasmita DWI SURYANTO Ferbian Milas Siswanto Ghina Monita Pramudhita Gusti Ayu Yuniati Kencana Hidayah, Dinda Nur I Gusti Agung I Gusti Made Krisna Erawan I Gusti Ngurah Kade Mahardika I Gusti Ngurah Sudisma I Ketut Suada I Ketut Suatha I Made Kardena I Made Sukada I MADE SUMA ANTARA I Nengah Kerta Besung i Nengah Wandia I NYOMAN MANTIK ASTAWA I Nyoman Suarsana I Nyoman Suarta I Nyoman Suartha I Putu Sampurna I Sendow I Wayan Suardana I Wayan Suardana I Wayan Suardana I wayan Teguh Wibawan I.H. Utama I.W. Batan Ida Ayu Sri Candra Dewi Ida Bagus Kade Suardana Ida Bagus Ngurah Swacita Indrawati Sendow Indrawati Sendow IRIANI SETYAWATI Iwan Harjono Utama Kadek Karang Agustina M.D. Rudyanto MAGGY T. SUHARTONO Maratun Janah MARIA BINTANG Messy Saputri Boru Sembiring Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Luh Eka Setiasih Ni Luh Putu Agustini Ni Luh Watiniasih Ni Made Riska Adnyani Nirhayu, Nirhayu Oktryna Hodesi Sibarani Putu Ayu Sisyawati Putriningsih Putu Oky Astawibawa Risha Catra Pradhany Sabella Ivana Ruslie Setyawati, Iriana Sisyawati Putriningsih Supar - T. Sari Nindia Tjokorda Sari Nindhia TRI KOMALA SARI Wahyu Tri Utomo Yan Agus Dharma Nataswara Yosaphat L.S Kote

Title Search

Found 13 Documents Search Journal : Jurnal Veteriner

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 13 Documents
Search
Journal : Jurnal Veteriner