Garuda - Garba Rujukan Digital

p-Index From 2020 - 2025

1.578

P-Index

This Author published in this journals

All Journal PROSIDING SEMINAR NASIONAL CommIT (Communication & Information Technology) agriTECH EduChemia: Jurnal Kimia dan Pendidikan PEMBELAJAR: Jurnal Ilmu Pendidikan, Keguruan, dan Pembelajaran Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology Indonesian Journal of Information System Indonesian Journal of Chemistry PROSIDING SEMINAR NASIONAL PROGRAM PASCASARJANA Molekul: Jurnal Ilmiah Kimia Jurnal Biomedika International Journal of Business, Humanities, Education and Social Sciences (IJBHES) Berkala Penelitian Hayati COMSERVA: Jurnal Penelitian dan Pengabdian Masyarakat Jurnal Indonesia Sosial Teknologi Jurnal Cakrawala Bahari

Tri Joko Raharjo

Department Of Chemistry, Faculty Of Mathematics And Natural Sciences, Universitas Gadjah Mada, Sekip Utara, 55281 Yogyakarta, Indonesia

Author-ID : 748411

Aerospace Engineering Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Economics, Econometrics & Finance Education Engineering Environmental Science Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Medicine & Pharmacology Public Health Social Sciences

Published : 35 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3 4

Color Stability of Phycoerythrin Crude Extract (PECE) from Rhodomonas Salina Toward Physicochemical Factors Endar Marraskuranto; Tri Joko Raharjo; Rina Sri Kasiamdari; Tri Rini Nuringtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 14, No 1 (2019): May 2019
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15578/squalen.v14i1.379

Rhodomonas salina produces Cr-phycoerythrin545 as its designated phycoerythrin (PE) with an absorption maximum at 545 nm and a shoulder 564 nm. PE has potential to be applied as colorants, pharmaceutical agents, and fluorescent dye tags. The stability of the PE color is influenced by the physicochemical factors of the solution. This study aimed to analyze the color stability of PECE against chemical (ethanol and pH) and physical (light and temperature) factors. PECE was prepared from freeze-dried biomass of R. salina and was extracted in phosphate buffer solution (pH = 6.0) using a freeze-thaw method in -25 oC (2 hours) and 4 oC (24 hours). The resulting extract was concentrated and dried in a freeze-dryer. Analyses were conducted using UV-visible and fluorescence spectrophotometer. PECE showed color stability against light of white fluorescent lamp exposure up to 8 hours, temperature exposure up to 40 oC, ethanol solution up to concentration of 20 % (v/v), and pH range 3.9-8.42. Results from this study can be useful for extraction, purification, and future application of Cr-PE545.

COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3 Stalis Norma Ethica; Dilin Rahayu Nataningtyas; Puji Lestari; Istini Istini; Endang Semiarti; Jaka Widada; Tri Joko Raharjo
Indonesian Journal of Chemistry Vol 13, No 3 (2013)
Publisher : Universitas Gadjah Mada

As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony) loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

VALIDATION OF PCR-RFLP TESTING METHOD TO DETECT PORCINE CONTAMINATION IN CHICKEN NUGGET Tri Joko Raharjo; Winda Cahyaningtyas; Surajiman Surajiman; Istini Istini; Deni Pranowo
Indonesian Journal of Chemistry Vol 12, No 3 (2012)
Publisher : Universitas Gadjah Mada

PCR-RFLP technique to detect porcine contamination in chicken nugget has been developed and validated in this research. Various concentrations of pork were fortified during preparation of the nugget. DNA was then isolated from the nugget followed by PCR employed primers which targeted a 359 bp cytB gene fragment of mitochondrial DNA. For RFLP, the PCR product was digested by means of BamHI and BseDI enzymes. Cutting DNA fragments from nugget containing pork using BseDI enzyme produced DNA fragment with size 228 and 131 bp, while cutting with BamHI enzyme produce DNA fragments with sizes 244 and 115 bp. All of these fragments were not present in RFLP analysis of pork-free nugget. The method shows good specificity and precision and could detect porcine contamination in the nugget up to 5%. The method has been applied to test commercial nugget. Four brand of Halal-labeled commercial nugget as well as four brand of non labeled one gave negative porcine contamination.

ISOLATION ANTHOCYANIN FROM ROSELLE PETALS (Hibiscus sabdariffa L) AND THE EFFECT OF LIGHT ON THE STABILITY Siti Nuryanti; Sabirin Matsjeh; Chairil Anwar; Tri Joko Raharjo
Indonesian Journal of Chemistry Vol 12, No 2 (2012)
Publisher : Universitas Gadjah Mada

This study was conducted to isolate anthocyanins from roselle petals and testing the stability toward light. Isolation of anthocyanin was accomplished by extracting roselle petals using eluents with different polarity levels. Nonpolar compounds was eliminated using n-hexane, then semipolar compounds extracted with ethyl acetate and isolated anthocyanin by solvent mixtures of methanol-HCl 0.5%. Color test to determine the presence of anthocyanin was performed with NH3 vapor, Pb-acetate 1% and Pb-nitrate 5%. The structure of anthocyanin in the roselle flower was determined using UV-Vis spectrophotometer, FT-IR and 1H-NMR. Anthocyanin stability test of the influence of light carried out in a room without light conditions (dark room) and light 25 Watt at 31 °C. The results showed that the roselle petals contain anthocyanin cyanidin-3-glucoside. Light has been found to affect the stability of anthocyanin cyanidin-3-glucoside.

INVESTIGATION ON THE MORPHOLOGY AND PROPERTIES OF AGGREGATE STRUCTURES OF NATURAL PHOSPHOLIPIDS IN AQUEOUS SYSTEM USING CRYO-TEM Dwi Hudiyanti; Tri Joko Raharjo; Narsito Narsito; Sri Noegrohati
Indonesian Journal of Chemistry Vol 12, No 1 (2012)
Publisher : Universitas Gadjah Mada

Cryogenic transmission electron microscopy (Cryo-TEM) was used to investigate the aggregates morphology and properties of candle tree (Aleurites moluccana) endosperm, sesame (Sesamum indicum L. syn.) seeds, and coconut (Cocos nucifera) endosperm phospholipids in dilute aqueous system. The micrographs showed that candle tree phospholipids formed planar bilayer and cluster of vesicles with lipid droplets, while coconut and sesame phospholipids formed well-defined unilamellar vesicles. The vesicles size could be as small as 50 nm in diameter. Coconut phospholipids also showed a good bending ability. Formation of clusters of vesicles was also found in coconut phospholipids dispersion, but this cluster was easily broken by extrusion through a small pore membrane.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon) Tri Joko Raharjo; Rosyida Azis Rizki; Stalis Norma Ethica; Elly Rustanti; L. Hartanto Nugroho
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

PHOSPHOLIPIDS FROM PUMPKIN (Cucurbita moschata (Duch.) Poir) SEED KERNEL OIL AND THEIR FATTY ACID COMPOSITION Tri Joko Raharjo; Laily Nurliana; Sabirin Mastjeh
Indonesian Journal of Chemistry Vol 11, No 1 (2011)
Publisher : Universitas Gadjah Mada

The phospholipids (PL) of pumpkin (Cucurbita moschata (Duch) Poir) seed kernel and their fatty acid composition were investigated. The crude oil was obtained by maceration with isopropanol followed by steps of extraction yielded polar lipids. The quantitative determination of PLs content of the dried pumpkin seed kernel and their polar lipids were calculated based on the elemental phosphorus (P) contents which was determined by means of spectrophotometric methods. PL classes were separated from polar lipids via column chromatography. The fatty acid composition of individual PL was identified by gas chromatography-mass spectrometry (GC-MS). The total of PL in the pumpkin seed kernels was 1.27% which consisted of phosphatidylcholine (PC), phosphatidylserine (PS) and phosphatidyletanolamine (PE). The predominant fatty acids of PL were oleic and palmitic acid in PC and PE while PS's fatty acid were dominantly consisted of oleic acid and linoleic acid.

USFDA-GUIDELINE BASED VALIDATION OF TESTING METHOD FOR RIFAMPICIN IN INDONESIAN SERUM SPECIMEN Tri Joko Raharjo; Tri Wahyudi; Sismindari Sismindari
Indonesian Journal of Chemistry Vol 10, No 1 (2010)
Publisher : Universitas Gadjah Mada

Regarding a new regulation from Indonesia FDA (Badan POM-RI), all new non patent drugs should show bioequivalence with the originator drug prior to registration. Bioequivalence testing (BE-testing) has to be performed to the people that represented of population to which the drug to be administrated. BE testing need a valid bio-analytical method for certain drug target and group of population. This research report specific validation of bio-analysis of Rifampicin in Indonesian serum specimen in order to be used for BE testing. The extraction was performed using acetonitrile while the chromatographic separation was accomplished on a RP 18 column (250 × 4.6 mm i.d., 5 µm), with a mobile phase composed of KH2PO4 10 mM-Acetonitrile (40:60, v/v) and UV detection was set at 333 nm. The method shown specificity compared to blank serum specimen with retention time of rifampicin at 2.1 min. Lower limit of quantification (LLOQ) was 0.06 µg/mL with dynamic range up to 20 µg/mL (R>0.990). Precision of the method was very good with coefficient of variance (CV) 0.58; 7.40 and 5.56% for concentration at 0.06, 5, 15 µg/mL, respectively. Accuracies of the method were 3.22; 1.94; 1.90% for concentration 0.06, 5 and 15 µg/mL respectively. The average recoveries were 97.82, 95.50 and 97.31% for concentration of rifampicin 1, 5 and 5 µg/mL, respectively. The method was also shown reliable result on stability test on freezing-thawing, short-term and long-term stability as well as post preparation stability. Validation result shown that the method was ready to be used for Rifampicin BE testing with Indonesian subject.

CHITINASE AND CHITINOLYTIC MICROORGANISM : ISOLATION, CHARACTERIZATION AND POTENTIAL Nuniek Herdyastuti; Tri Joko Raharjo; Mudasir Mudasir; Sabirin Matsjeh
Indonesian Journal of Chemistry Vol 9, No 1 (2009)
Publisher : Universitas Gadjah Mada

Chitinase is enzyme that hydrolyzes chitin, a polimer of b-1,4-N-Acetilglucosamine which is the most abundant natural resource after cellulose. Chitinolytic microorganism can be found in environment like soil and water that contain chitin, or in extreme environment which is known as thermofilic microorganism. Chitinolytic microorganism is identified by recognizing the morphological and physiological properties based on Bergey's Manual of Systematic Bacteriology. The sequence data of the 16S rRNA genes is determinated in the GeneBank nucleotide sequence database. Chitinase activity can be qualitatively determined from the clearance zone around the colony formed in agar medium containing colloidal chitin. Chitinase can be utilized as biocontrol agent and derivate chitin as the result of chitinase degradation which can be used in the fieltd of health, food, industry and waste management

IN VIVO STUDY OF PHENOLIC COMPOUNDS ROLE ON ANTIHYPERCHOLESTEROL ACTIVITY OF VIRGIN COCONUT OIL Tri Joko Raharjo; Ariyani Setyo Widhiyati; Endah Mulya Asih; Sumiaty Sumiaty; Raden Tambunan; Ani Setyopratiwi
Indonesian Journal of Chemistry Vol 8, No 1 (2008)
Publisher : Universitas Gadjah Mada

The role of phenolic compounds on antihypercholeserol activity of Virgin Coconut Oil (VCO) has been investigated. The in vivo studies ware carried out by treatment of two groups of Wistar white mouse (Ratus norvegicus) using high phenolic VCO and low phenolic VCO respectively, followed by analysis of lipid profile in blood and liver serum of the mouse. In addition a group of hypercholesterol mouse was treated with low phenolic VCO and the blood serum lipid profile was compared with untreated hypercholesterol mouse. The results show that phenolic compound play an important role on antihypercholesterol of VCO. Group of mouse treated with high phenolic VCO have better lipid profile (blood serum: total cholesterol: 70 mg/dL, triglyceride: 76 mg/dL, HDL: 20 mg/dL, LDL: 35 mg/dL; liver serum: total cholesterol:7 mg/dL, triglyceride: 19 mg/dL) compared with the group treated with low phenolic VCO (blood serum: total cholesterol: 82 mg/dL, triglyceride: 100 mg/dL, HDL: 21 mg/dL, LDL: 41 mg/dL; liver serum: total cholesterol: 9 mg/dL, triglyceride: 34 mg/dL). Hypercholesterol mouse tests shown that low phenolic VCO treatment result in decreasing of blood serum cholesterol level by 52.10% which was not significantly different compared to untreated mouses (decreasing of blood serum cholesterol level by 48.61%).

Co-Authors Agus Zulkarnain, Agus Alfiraza, Ery Nourika Andika, Rio Ani Setyopratiwi Arif Mulyanto, Arif Ariyani Setyo Widhiyati Arwansah, Arwansah Atmadja, Wiedjaja Bambang Sutriyanto Chairil Anwar Chairil Anwar Condrobimo, Andreas Raharto Dendang, Adrianto Deni Pranowo Deni Pranowo Dilin Rahayu Nataningtyas Diptyo Hisnuaji, Diptyo Dwi Hudiyanti Eka Widjaja, Henry Antonius Elly Rustanti Endah Mulya Asih Endang Semiarti Endar Marraskuranto Esti Enjelina Fandhi Adi Wardoyo Garnis Putri Erlista Gilang Aji Pratama Harisman Jaya, Harisman Hasnur, Juliandri Hidayat, Panca Nur Iqmal Tahir Irma Nuryanti Istini Istini Istini Istini Jaka Widada Jatmiko, Fauzi Kurniawan, Fika L, Bagus Budhi Bowo L. Hartanto Nugroho Laily Nurliana Mahargyani, Wikan Mai Anugrahwati Markus Asta Patma Nugraha Maulidiyawan, Robby Meyliana Mudasir Mudasir Mudasir Narsito Narsito Narsito Narsito Naseer Ahmed Nugroho, Edi Setyawan Nuniek Herdyastuti Nurul Hidayat Aprilita Oedjijono Oedjijono Ogbuadike Eucharia Patricia Lubis, Patricia Puji Lestari Puji Lestari Raden Tambunan Rarastoeti Pratiwi Respati Tri Swasono Rina Sri Kasiamdari Robert Verpoorte Rosyida Azis Rizki Rusmiati Suprihatin S, Aryo Adi Sabirin Mastjeh Sabirin Matsjeh Sablan, Bruno Santi Nur Handayani Saputra, M. Ferry Sari Edi Cahyaningrum Shalehuddin, Hasnan Habib Sismindari Sismindari Siti Nuryanti Siti Nuryanti Slamet Raharjo Sonny Ridwanto, Sonny Sri Noegrohati Sri Noegrohati Stalis Norma Ethica Suhirwan, Suhirwan Sumiaty Sumiaty Sunusi, M. Syafril Sunusi, Sahabuddin Surajiman Surajiman Surajiman Surajiman Surjandy Susan Primadevi Tri Rini Nuringtyas Tri Wahyudi Tutik Dwi Wahyuningsih Wen-Te Chang Winarno Winarno Winarto Haryadi Winda Cahyaningtyas Yohannes Kristanto, Yohannes

Title

Found 35 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 35 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 35 Documents
Search