Article Per Year (5 Year)
p-Index From 2021 - 2026
2.109
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Journal of Food and Life Sciences Journal of Innovation and Applied Technology Jurnal Ternak Tropika Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Medik Veteriner Vitek : Bidang Kedokteran Hewan Veterinary Biomedical and Clinical Journal Jurnal Nutrisi Ternak Tropis (JNT) Jurnal Pengabdian Masyarakat Asia Rambideun : Jurnal Pengabdian Kepada Masyarakat Prosiding Seminar Nasional Unimus
Yudit Oktanella, Yudit
Departement Of Veterinary Reproduction, Veterinary Medicine Faculty, Brawijaya University, Puncak Dieng, Dau, Malang, East Java 65151, Indonesia
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Economics, Econometrics & Finance Education Engineering Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Nursing Physics Public Health Social Sciences Veterinary Other

Published : 18 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 18 Documents
Search

 1   2 
Supplementation of Casein Tablets of Goat Milk Yogurt on Dioxin-exposed Broiler Chickens Feed Consumption Wicaksono, Agung; Oktanella, Yudit; Widodo, Edwin
Journal of Food and Life Sciences Vol 5, No 1 (2021)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jfls.2021.005.01.02

Abstract

Combustion process in industry resulted in harmful free radical compounds such as Dioxin / TCDD (2,3,7,8- tetrachlorodibenzo-p-dioxin). The aim of the this experiment was to determine the therapeutic effect of casein in goat milk yogurt on chickens exposed to dioxins. Parameters used in this experiment were feed consumption and body weight. This research was designed with 18 male COBB strain broiler chickens aged 21 days. They were divided into three groups: (1) the negative group without any treatment, (2) the positive group by giving feed with dioxin 50ng / kg feed in corn oil solvent, (3) ) the therapy group was given feed with dioxin 50ng / kg feed in corn oil solvent in the morning and 750 mg / kg BW / day of yougurt casein goat milk in the afternoon. Both feed and casein were given orally for 21 days with each group having six replications. The samples were measured every day including weight gain and chicken feed consumption. The data were analyzed quantitatively using the One Way Analysis of Variance (ANOVA) test with a confidence level of 95%. The provision of goat milk yogurt casein tablets as a therapy for broiler chickens that were given dioxin-containing feed had a significant increase on chicken body weight, but insignificant on feed consumption.
Variasi Genetik Kambing Senduro dan Peranakan Etawa (PE) Berdasarkan Sekuen Gen CYT-B (Cytochrome-B) Dengan Metode Polymerase Chain Reaction Rizka Gitta Almaida; Yudit Oktanella; Gatot Ciptadi
TERNAK TROPIKA Journal of Tropical Animal Production Vol 21, No 2 (2020): TERNAK TROPIKA Journal of Tropical Animal Production
Publisher : Jurusan Produksi Ternak, Fakultas Peternakan, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jtapro.2020.021.02.3

Abstract

Informasi genetik kambing Senduro dan PE (Peranakan Etawa) yang berada di BBIB Singosari merupakan kambing lokal asal Jawa Timur, Indonesia yang digunakan dalam program breeding, khususnya untuk produksi semen beku untuk inseminasi buatan masih sangat terbatas. Perlu dilakukan analisa molekuler untuk menseleksi pejantan yang akan digunakan untuk produksi semen beku salah satunya dengan ilmu biologi molekuler. Penelitian tentang keragaman genetik dilakukan dengan menggunakan DNA mitokondria (mtDNA). Cytochrome b (Cyt-b) merupakan salah satu mtDNA yang memiliki laju mutasi yang sedang dan memiliki posisi sekuens nukleutida yang dipertahankan. Penelitian ini bertujuan untuk mengetahui susunan nukleutida kambing Senduro dan PE berdasarkan genotip mtDNA. Sampel yang digunakan berupa whole blood dari enam ekor kambing Senduro, dan tiga ekor kambing PE yang berasal dari BBIB Singosari, Malang, Jawa Timur. Sampel whole blood diisolasi dengan Blood DNA Preparation Kit by Jena Bioscience. Primer yang digunakan yaitu primer Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 dan Reverse (Cytb_R) 5’GGATTTGCCGGG GTATAGTT’3. Hasil PCR disekuensing dengan metode Sanger. Analisa sekuen gen dilakukan menggunakan software MEGA-X. Penyejajaran pairwise distance menunjukkan terdapat perbedaan basa nukleutida pada kambing Senduro dan PE. Sampel SE1 mengalami missense mutation, dan sampel SE2, SE3, SE4, SE5, SE6, PE1, PE2, PE3 mengalami frameshift mutation. Hasil penelitian menunjukkan bahwa keragaman genetik kambing Senduro dan PE yang dibandingkan dengan database NCBI Capra hircus: D8420.1 tergolong tinggi.
Optimalisasi Metode Pembudidayaan Manggot Black Soldier Fly di Desa Tambakasri Kecamatan Tajinan Yudit Oktanella; Raden Satrio Mukti; Arvel Risky Widyana; Zita Viera Pradnya R.; Ahmad Lukman Hadiprawoto
Journal of Innovation and Applied Technology Vol 7, No 2 (2021)
Publisher : Lembaga Penelitian dan Pengabdian Kepada Masyarakat Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jiat.2021.006.02.9

Abstract

Ancaman peningkatan sampah organik berkontribusi terhadap perkembangan global warming dan penyebaran penyakit. Inovasi tentang pengelolaan sampah secara biokonversi merupakan metode alternatif sebagai upaya mengurangi pencemaran sampah organik dan disertai dengan manfaat lain yang dapat meningkatkan nilai ekonomi masyarakat. Larva Black Soldier Fly (maggot) dapat mengubah sampah organik menjadi protein dan lemak serta mengurangi massa sampah organik. Beberapa daerah mulai membudidayakan maggot dengan berbagai metode media fermentasi. Desa Tambakasri merupakan salah satu desa yang dapat membudidayakan maggot Black Soldier Fly dengan media fermentasi berupa ampas kelapa. Tujuan dari pengamatan ini adalah mengetahui lebih lanjut metode pembudidayaan maggot Black Soldier Fly di Desa Tambakasri. Berdasarkan pengamatan yang telah dilakukan ampas kelapa sebagai media fermentasi dapat mengurangi biaya operasional dengan penambahan serbuk kayu untuk mengurangi kelembaban. Hasil panen maggot dengan media tersebut dapat mencapai 30-60 kg maggot per petak dan dapat diolah menjadi produk turunan maggot.
KAJIAN ARTIKEL: POTENSI PLASMA NON TERMAL SEBAGAI KANDIDAT TERAPI MASTITIS SUBKLINIS Elfahra Casanza Amalda; Farah Alhamidah; Yudit Oktanella; Muhammad Khuzain
VITEK : Bidang Kedokteran Hewan Vol 10 (2020): VITEK - Bidang Kedokteran Hewan
Publisher : Fakultas Kedokteran Hewan Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30742/jv.v10i0.41

Abstract

Subclinical mastitis is the occurrence of inflammation in the parenchymal tissue of mammaryglands due to bacterial contamination that does not show clinical symptoms lead to impacted oneconomic losses. The highest incidence of subclinical mastitis is the presence of Staphylococcusaureus bacteria contamination. Subclinical mastitis in Indonesia is reported to reduce milk productionby up to 53.5%. Pathogenesis of Staphylococcus aureus occurs in the presence of biofilm formation asbacterial immune system to protecting itself from disinfectants and antibiotics. In the last few decades,the development of plasma technology has been widely used in the medical field as cancer therapy,reducing pain, accelerating wound healing and tissue sterilization. There is no study that using theconcept of utilizing Non Termal Plasma in the field of veterinary science, especially in mastitistherapy. Non Termal Plasma is able to decontaminate Staphylococcus aureus through inhibition anddestruction of biofilms. The mechanism of action of Non Termal Plasma in repairing mammary glandtissue is through the destruction of DNA in the Reactive Oxygen Species (ROS) process by increasingthe growth factor TGF-1 which accelerates the process normal cell regeneration. The objective ofthis study is to reviewing the efficacy of plasma non termal as subclinical mastitis theraphy. This studywas conducted through a narrative review approach by collecting international and nationalliterature with interval time of publication within 2010 – 2020.
Program Edukasi Perbaikan Pakan dan Pelayanan Inseminasi Buatan di Kelompok Ternak Sapi Perah Desa Medowo, Kecamatan Kandangan, Kota Kediri Viski Fitri Hendrawan; Desi Wulansari; Galuh Chandra Agustina; Yudit Oktanella; Aulia Firmawati
Jurnal Nutrisi Ternak Tropis Vol 3, No 2 (2020): JNT | Jurnal Nutrisi Ternak Tropis September 2020
Publisher : Jurnal Nutrisi Ternak Tropis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jnt.2020.003.02.7

Abstract

Tujuan kegiatan ini adalah untuk mengidentifikasi permasalahan peternak yang berkaitan dengan bidang pakan, reproduksi dan meningkatkan pengetahuan peternak dalam hal kesehatan ternak dan pentingnya management pelaksanaan Inseminasi Buatan (IB) yang baik sehingga tercapai efisiensi reproduksi. Kegiatan ini dilakukan mulai bulan Juni hingga Agustus 2020 yang terdiri atas kegiatan pemeriksaan kesehatan ternak, penyuluhan dan pelaksanaan IB serta kegiatan evaluasi. Hasil kegiatan menunjukkan bahwa sebanyak 20 (19%) dari 105 ekor sapi mengalami estrus, 20 (19%) ekor bunting, 4 (4,8%) kasus hipofungsi ovarium dan 9 (8,6%) kasus CLP yang didiagnosa dengan palpasi rektal sedangkan sisanya 51 ekor (48,6%) dalam kondisi tidak bunting (fase luteal dan dara). Sapi perah sebanyak 13 (65%) dari 20 ekor berhasil bunting setelah diinseminasi, sedangkan sisanya 7 ekor (35%) tidak bunting, hal ini disebabnya factor manajemen dan ketepatan pelaksanaan IB. Perbaikan reproduksi pada kasus hipofungsi dan CLP dapat diperbaiki dengan perbaikan pakan, pemberian vitamin A D E K dan perbaikan manajemen post partus, selain itu perlu juga dilakukan pengobatan hormonal. Kondisi sapi perah peternak anggota  KUD Kerta Jaya menunjukkan penampilan yang baik dilihat dari keberhasilan kebuntingan yang mencapai 65% setelah diberi perlakuan pakan, vitamin dan hormone serta secara umum tidak ada ternak yang mengalami gangguan reproduksi.
Upaya Peningkatan Produksi Susu Sapi Perah Dengan Pemberian Vitamin Ade dan Obat Cacing Galuh Chandra Agustina; Viski Fitri Hendrawan; Desi Wulansari; Yudit Oktanella
Jurnal Nutrisi Ternak Tropis Vol 3, No 1 (2020): JNT | Jurnal Nutrisi Ternak Tropis Maret 2020
Publisher : Jurnal Nutrisi Ternak Tropis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jnt.2020.003.01.1

Abstract

Saat ini produksi susu sapi dalam negeri baru bisa memasok tidak lebih dari 21% kebutuhan konsumsi susu, sisanya 79% berasal dari impor susu sapi. Keberhasilan beternak sapi perah untuk dapat meningkatkan produktivitas adalah kesehatan ternak. Gangguan kesehatan pada ternak dapat menyebabkan penurunan produktivitas sehingga menyebabkan kerugian ekonomi di bidang peternakan. Helminthiasis merupakan penyakit yang sangat sering terjadi pada ternak. Helminthiasis disebabkan oleh infeksi cacing dalam tubuh ternak. Lingkungan yang lembab dan sanitasi yang kurang baik, menjadi penyebab infeksi cacing. Telur-telur cacing akan mencemari pakan dan minum ternak, sehingga ikut tertelan ke dalam saluran pencernaan. Di dalam saluran pencernaan cacing menetas dan berkembang dengan mengambil nutrisi dari saluran pencernaan dengan cara merusak mukosa saluran pencernaan. Rusaknya mukosa saluran pencernaan mengakibatkan gangguan penyerapan nutrisi ternak. Pemberian obat cacing secara rutin perlu dilakukan untuk meningkatkan kesehatan dan produktivitas ternak. Obat cacing bekerja dengan cara membunuh atau mengurangi cacing dalam lumen usus dan atau jaringan tubuh.  Obat cacing yang digunakan adalah albendazole yang efektif untuk semua spesies cacing. Obat cacing diberikan secara per oral kepada pedet dan sapi dewasa yang tidak bunting sebanyak 97 ekor. Pemberian obat cacing dan vitamin memberikan dampak positif terhadap peningkatan produksi susu sapi sebanyak 12% dari 10 ekor sapi yang diambil secara sampling.
Analisis Pemberian Serbuk Jahe Merah, Kunyit, dan Temulawak Dengan Metode Insilico dan Invivo pada Ayam Broiler Herawati .; Renanda Nur Al Jabbar; Yudit Oktanella
Jurnal Sain Veteriner Vol 41, No 1 (2023): April
Publisher : Faculty of Veterinary Medicine, Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.76111

Abstract

This study aimed to eveluate effect of combination powder of red ginger (Zingiber officinale var. Rubrum), turmeric (Curcuma domestica), and temulawak (Curcuma xanthorrhiza) on the calculation of normal Liberkhun crypts by insilico and invivo methods. Molecular docking conducted in the pocket site of Interferon Lambda Receptor (IFN-λR) to modulate anti-inflammatory activity in chicken caecum. The study used 20 day old chickens (DOC) which were randomly grouped into 5 groups: negative control without treatment (P0) and powder addition group {0,5% (P1); 1%(P2); 1.5%(P3); 2%(P4)}. All chickens were reared for 35 days then chickens were euthanized using halal slaughter method and caecum organs were collected  for histopathological observations. all active substances red ginger (gingerol, shogaol); turmeric (curcumin,tetrahydrocurcumin); and temulawak (demethoxycurcumin, bisdemethoxycurcumin) can bind to IFN-λR. Curcumin (-6.0 kcal/mol) have highest affinity values. Invivo treatment showed significant effect (p<0.05) on normal calculation of Liberkhun crypts due to tissue damage. Tukey's test confirmed that negative group was significantly different from P2, P3, and P4 with an average (4.35 ± 1.09b; 5.6 ± 1.54c; and 5.7 ± 1.78c). This research suggests that the addition of combination powder by 1,5% can potentially used for anti-inflamatory agent that confirmed by insilico method.
Environmentally Friendly Livestock Waste Management in High-Population Areas in Karang Ploso Malang Regency East Java Muhammad Arwani; Abdul Hakim; Agus Budiarto; Gatot Ciptadi; Yudit Oktanella
Jurnal Pengabdian Masyarakat Vol 4 No 2 (2023): Jurnal Pengabdian Masyarakat
Publisher : Institut Teknologi dan Bisnis Asia Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.32815/jpm.v4i2.480

Abstract

Purpose: This abstract explores the need for integrated development in the agricultural and livestock sectors of Ngenep Village, Karangploso, Malang Regency, focusing on utilizing livestock waste effectively. Method: The study details the steps to develop a system for producing organic fertilizer and animal feed from agricultural and livestock waste. It highlights the successful implementation within the "Langgeng Mulya" dairy cattle farming community, emphasizing the utilization of waste for organic fertilizer in chili and tomato cultivation. Practical Applications: The research findings showcase the positive response of local farmers to the utilization of livestock waste, addressing the scarcity of organic fertilizer, particularly for tomato and chili growers. This sustainable approach fosters self-sufficiency and offers insights into waste-to-resource strategies. Conclusion: This study underscores the importance of integrating the agricultural and livestock sectors for sustainable waste management and resource utilization. It provides valuable lessons for enhancing the efficiency of rural development programs.
The Effect of Triponyl Sulphate on Fetuses Development and Placental Abnormalities in Inducing Preeclampsia of Rattus norvegicus animal model Purwatiningsih, Wawid; Aryani, Dhita Evi; Vidiastuti, Dian; Oktanella, Yudit; Firmawati, Aulia
Veterinary Biomedical and Clinical Journal Vol. 1 No. 1 (2019)
Publisher : Faculty of Veterinary Medicine Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (672.49 KB) | DOI: 10.21776/ub.VetBioClinJ.2019.001.01.6

Abstract

Preeclampsia is one of the obstetrical problems that can cause maternal and fetal morbidity and mortality. Preeclampsia causes the fetus born prematurely and low fetal weight. This is caused by high blood pressure which causes decrease of blood delivery to the placenta, so the supply of oxygen and food to the fetus decreases. As a result, fetal development inhibits and trigger born prematurely. More fatal, this disease cause the release of placental tissue from the uterus prematurely. The aim of this study was to determine the effect of administration of triponyl sulfate as induction of increased blood pressure in preeclampsia animal models, fetal development with alizarin red staining and placental abnormalities. The experimental animals were rats Rattus norvegicus mated with male rats monomating , 4 months old and 250-300 grams body weigh. Pregnant female rats were induced by triponyl sulfate 70 mg / kg BW (k +) and without induced by triponyl sulfate (k-). The results of the study showed that there were formation of the sternal bone in k- and malformation of the sternum bone at k +. Placental abnormalities occured in k +, it could be seen in the presence of ghos villi in blood vessel abnormalities in the preeclampsia placenta caused by there was no invation of trophoblast cells in the whole or partial spiral arteries and the mean of blood pressure increased.
Solasodine and Gosipol Effectivity as a Male Contraception Inhibit LH Expression and Spermatogenesis in Rat Wulansari, Desi; Oktanella, Yudit; Hendrawan, Viski Fitri; Agustina, Galuh Chandra
Veterinary Biomedical and Clinical Journal Vol. 1 No. 2 (2019)
Publisher : Faculty of Veterinary Medicine Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (364.671 KB) | DOI: 10.21776/ub.VetBioClinJ.2019.001.02.7

Abstract

Rabies related to increasing canine population in Bali. Uncontrolled wild animal populations caused disease transmission from animal to human. Various attempt at population control are carried out such as the use of natural contraception. Some compounds are known to have potential as antifertility are solasodine and gosipol. Solasodine is known have an antifertility affect. Gosipol, fenolic compound in Ceiba pentandra, inhibits spermatogenesis, reduce sperm concentration, motility and viability. This research aims to compare effectiveness of terong cepoka and Ceiba pentandra as antifertility. This research was conducted at Mei-November 2018. Eight-teen rats were used in this study and divided into three groups: control, P1 extract Solanum torvum 1g/kg BW and P2 extract Ceiba pentandra 0,1g/kg BW PO. Rats were treated with extract for 10 days and euthanazed at day 11. Testis were collected for histopathology using HE staining to observe spermatogenesis and using immunohistochemistry to observe LH expression. The result are analyzed using one way ANOVA P<0.05. the result show that extract solanum torvum 1g/kg BW and ceiba pentandra 0,1g/kgBW cannot reduce spermatogenesis and LH expression. This study used crude extract which still consist any other compound like antioxidant. Future study we need use isolated and pure solasodine and gosipol.
Co-Authors Abdul Hakim Abdul Samik Aditya, Siska Adrenalin, Sruti Listra Ageng Ilham Ramadhani Agung Wicaksono Agus Budiarto Agustina, Galuh Candra Agustina, Galuh Chandra Ahmad Lukman Hadiprawoto Amri, Indah Amalia Arvel Risky Widyana Aryani, Dhita Evi Assifa Mardiyah, Fraya Cahyani, Ayunda Ageng Dameanti, Fidi Nur Aini Eka Puji Desi Wulansari Desi Wulansari Dian Vidiastuti, Dian Dyah Ayu Oktavianie Edwin Widodo Elfahra Casanza Amalda Farah Alhamidah Febry Sysdityawan Ramadhan Firmawati, Aulia Fraya Assifa Mardiyah Galuh Chandra Agustina Gatot Ciptadi Hardian, Andreas Bandang Herawati . Herawati Herawati Indah Amalia Amri Intan Purwa Dewanti Kamulyan, Ujiati Kusumarini, Shelly Mariyam, Dewi Muhammad Arwani Muhammad Khuzain Ngakan Made Rai Widjaja Prasetyo, Gabriela Jeanne Giacynta Purwatiningsih, Wawid Qosimah, Dahliatul Raden Satrio Mukti Renanda Nur Al Jabbar Rizka Gitta Almaida Sruti Listra Adrenalin Tatik Hernawati Ujiati Kamulyan Viski Fitri Hendrawan Viski Fitri Hendrawan Wawid Purwatiningsih Widi Nugroho Yesica, Reza Zita Viera Pradnya R.