Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

0.947

P-Index

This Author published in this journals

All Journal Buletin Veteriner Udayana Buletin Udayana Mengabdi Jurnal Veteriner Indonesia Medicus Veterinus Majalah Kedokteran Bandung WARTAZOA Indonesian Bulletin of Animal and Veterinary Sciences Jurnal Kedokteran Hewan

I Gusti Agung Ayu Suartini

Fakultas Kedokteran Hewan, Universitas Udayana

Author-ID : 237263

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemistry Education Immunology & microbiology Medicine & Pharmacology Public Health Veterinary

Published : 29 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3

Kinetika Immunoglobulin Kuning Telur Antiparvovirus Anjing Pada Anjing (KINETICS OF ANTICANINE PARVOVIRUS YOLK IMMUNOGLOBULIN IN DOGS) I Gusti Ayu Agung Suartini; Indrawati Sendow; Ni Luh Putu Agustini; Agik Suprayogi; I Wayan Teguh Wibawan; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (122.941 KB)

Kinetic study on Anti CPV IgY has been performed on six dogs aged 5-10 months. The IgY was injectedintravenously at dose of 21.4mg /10kg body weight. IgY levels in the blood were determined by ELISA. Aresearch was conducted to find out the kinetics of Anti CPV IgY in dogs blood. The kinetics of IgY wascalculated by using regression analysis to determine the association on the levels of IgY in serum againsttime at injection. The results showed that kinetic parameters were calculated based on first order kinetics.The constant elimination rate of IgY was at the range between 0.007 to 0.015 / h. IgY concentration in thedogs blood was from 0.746 to 0.992 mg / mL. The half-life of IgY was from 1.65 to 4.01 / d. Volumedistribution of IgY was between 21.47 to 28,55 / mL. Total IgY in the dog bodies (AUC) was from 42,60 to142,00 mg / mL.h. The duration of the IgY in the dog’s body was 3.08 to 8.51 days. Clearance time of IgY was0.15 to 0.50 mL / h. In conclusion the kinetics of anti CPV IgY in dog’s body follow one compartment andfirst order model, which are only distributed in the blood with the half-life at 2.5 days, and IgY has lesspossibility to accumulate in the body compared to the IgG.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Infeksi Alami Canine Parvovirus pada Anjing Kintamani di Desa Sukawana, Kintamani, Bangli, Bali (NATURAL INFECTION OF CANINE PARVOVIRUS IN KINTAMANI DOGS OF SUKAWANA VILLAGE, KINTAMANI, BANGLI, BALI) I Gusti Ayu Agung Suartini; Indrawati Sendow; I Nyoman Suarsana; Ni Luh Eka Setiasih; Maratun Janah
Jurnal Veteriner Vol 20 No 2 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Kintamani dog as one of germ plasm owned by Bali province has been widely accepted as dog of Indonesian origin which need to be preserved. Report have shown that puppies of Kintamani dogs sold in Denpasar animal market often die due to Canine parvovirus (CPV) infection. The mortality of CPV infection in puppies can reach as high as 91% espescially in unvaccinated dogs. As the mortality of CPV in dogs is very high, it is important to find out the seroprevalence of CPV infection in Kintamani dogs in Sukawana village. Up to now, the seroprevalence of CPV infection in Sukawana, the natural habitate of Kintamani dog has never been reported. In this study the sample collection and area selection was conducted by haemaggutination inhibition (HI) test. Sera sample were concluded positive if the HI titers of sera were > 64 HI units. Seroprevalence of CPV infection was calculated by dividing the number of positive sera with the total sera samples. The seroprevalence of CPV among dogs was determined using non parametric analysis (Chi-Square). From 70 sera samples collected 67.1% (47/70) were antibody positive against CPV. The highest seroprevalence was found in Banjar Sukawana 22.8% (16/70). A higher seroprevalence was found in female dogs 45.7% (32/70) compare to male dogs 21.4% (15/70). Kintamani dogs aged between 724 month have the highest seroprevalence 27.1% (19/70). Based on the distribution of antibody titers, the seroprevalence antibody >64 HI was 65.7%. The result showed that the high titer (> 64 HI) of antibody against CPV, it was shown that CPV infection has occurs naturally in kintamani dog at Sukawana village.

Pakan Tambahan dan Anabolik Growth Promoter Meningkatkan Kadar Hormon Pertumbuhan Sapi Bali Ni Made Riska Adnyani; Ni Ketut Suwiti; I Gusti Ayu Agung Suartini; I Nengah Kerta Besung
Jurnal Veteriner Vol 21 No 4 (2020)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

This study aims to determine the level of growth hormone given feed supplement and anabolic growth promoter. This research was an experimental research using Complete Random Design (CRD) with three factors. There were feed supplement, anabolic growth promoter, and sampling time. There were 20 youngmale Bali cattle and they were taken care intensively, divided into 4 group, there were control, feed supplement, anabolic growth promoter, and the combination of feed supplement and anabolic growth promoter for five months, and measured the level of growth hormone each month. The level of growth hormone was detected by using competitive Enzyme Linked Immunosorbent Assay method. The result of the research showed that feed supplement and anabolic growth promoter increased the level of bali cattle growth hormone where feed supplement with anabolic growth promoter (P1G1) was not significantlydifferent than given feed supplement without anabolic growth promoter (P1G0). Providing feed supplement optimally by farmers is highly recommended.

Aktivitas Hipolipidemik dan Indeks Aterogenik yang Rendah Ekstrak Air Daun Tapak Dara pada Tikus Hiperkolesterolemia (HYPOLIPIDEMIC ACTIVITY AND LOW ATHEROGENIC INDEX OF AQUEOUS LEAF EXTRACTS OF CATHARANTHUS ROSEUS IN HYPERCHOLESTEROLEMIC RATS) I Nyoman Suarsana; Iwan Harjono Utama; I Made Kardena; I Gusti Ayu Agung Suartini; Ni Luh Watiniasih
Jurnal Veteriner Vol 16 No 4 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (119.36 KB)

Catharanthus roseus is one plant recognized as medical potential which can decrease cholesterol. Thepresent study was carried out to evaluate the effect of aqueous leaf extracts of C. roseus on plasma lipidprofil levels in rats cholesterol rich diet and atherogenic index. This study was carried out on 15 SpraqueDawley male rats randomly distributed into five groups (n=3). Rats hypercholesterolemic wereadministrated cholesterol rich diet containing 1% (w/w). Normal control group with normal diet whitoutextracts (K1), positive control hypercholesterolemic group (K2) with cholesterol rich diet whitout extracts,and others three groups (K3-K5) were feed high cholesterol and 1 mL of aqueous leaf extracts of C. roseuswith a dose of 20% (w/v), 40% (w/v) and 80% (w/v) respectively, administered twice daily 1 mL orally.Treatment was given for 28 days. After treatment, the plasma lipids profile such cholesterol total, highdensity lipoprotein (HDL), low density lipoprotein (LDL), triglyceride (TGA) level were measured. Theresults showed that during the period of treatment with cholesterol rich diet have produced under condition hypercholesterolemic of rats with average cholesterol levels of 124.33 ± 4.04 mg/dL (K2 group). Treatmentwith extract dose of 80% showed the best results among the other doses in reducing levels of total cholesterol,triglycerides, LDL and raise HDL levels. Extract treatment dose of 80% up to four weeks resulted incholesterol total (79.33±3.51 mg/dL), TGA (72.33±6.65 mg/dL), HDL (55.00±3.60 mg/dL), and LDL(9.87±5.34mg/dL). In addition, value ratio of cholesterol:HDL was 1.4: 1 and atherogenic index value was0.44. These results suggest that extracts of leaf C. roseus optimum doses 80% (w/v) has hipolipidemicactivity in hypercholesterolemic rats and it has low atherogenic index value.

Bisphenol A Meningkatkan Malondialdehid dan Indeks Apoptosis Hati Tikus (Rattus norvegicus) Jantan Risha Catra Pradhany; I Nyoman Suarsana; I Gusti Ayu Agung Suartini; Ferbian Milas Siswanto
Jurnal Veteriner Vol 23 No 1 (2022)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Bisphenol-A (BPA) merupakan toksikan yang diketahui dampaknya terhadap reproductive toxicities.Namun, beberapa tahun belakangan ini, diketahui pula bahwa BPA menyebabkan stres oksidatif. Stres oksidatif merupakan salah satu faktor penyebab kerusakan organ. Penelitian ini bertujuan untuk membuktikan efek pemberian BPA oral terhadap kadar malondialdehid dan indeks apoptosis pada hati tikus. Penelitian ini menggunakan posttest only control group design. Subjek adalah 14 ekor tikus putih jantan galur Sprague dawley, umur 8-10 minggu, bobot badan berkisar 180 g, dan dalam keadaan sehat. Kelompok kontrol (P0), tujuh ekor tikus, diberikan plasebo berupa 1 mL aquadest selama 21 hari; sedangkan kelompok perlakuan (P1), tujuh ekor tikus, diberikan 400 mg/kgBB tikus BPA selama 21 hari. Hasil menunjukkan bahwa kelompok P1 memiliki kadar MDA hepatik yang lebih tinggi (3,33±0,27 nmol/ mg.prot) dan berbeda nyata (p<0,001) dibandingkan kelompok P0 (2,67±0,14 nmol/mg.prot). Selain itu, kelompok P1 memiliki indeks apoptosis yang lebih tinggi (11,21±2,26%) dan berbeda nyata (p<0,001) dibandingkan kelompok P0 (2,19±0,97%). Berdasarkan hasil tersebut, dapat disimpulkan bahwa pemberian BPA oral meningkatkan malondialdehid dan indeks apoptosis pada hati tikus putih (Rattus norvegicus) jantan.

Pengaruh Pemberian Ekstrak Kulit Pisang Kepok terhadap Histologi Ginjal, Kadar Ureum dan Kreatinin Tikus Putih setelah Melakukan Latihan Intensif Putu Oky Astawibawa; I Nyoman Suarsana; I Gusti Ayu Agung Suartini
Buletin Veteriner Udayana Vol. 14 No. 5 October 2022
Publisher : The Faculty of Veterinary Medicine, Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/bulvet.2022.v14.i05.p18

Aktivitas fisik berlebih memicu terbentuknya reactive oxygen species (ROS) yang dapat merusak ginjal dan organ lain. Penelitian ini bertujuan mengetahui pengaruh ekstrak kulit pisang kepok terhadap kadar ureum, kreatinin dan histologi ginjal tikus putih setelah pemberian latihan intensif. Penelitian ini menggunakan 27 ekor tikus putih jantan dengan berat badan 200-225g. Tikus dibagi menjadi tiga kelompok perlakuan yaitu (T0) kontrol, (T1) latihan intensif, (T2) latihan intensif dan diberi ekstrak kulit pisang kepok yang menggunakan dosis 1 cc/kg bb selama 28 hari. Sampel ureum di uji dengan metode Urea Col dan sampel kreatinin di uji dengan metode jaffe sedangkan sampel ginjal di periksa menggunakan preparat histologi dengan metode perwarnaan hematoksilin eosin (HE). Pada perlakuan T0 diperoleh kadar ureum dan kreatinin berturut-turut 89,456 ± 2,938 dan 0,867 ± 0,07 mg/dl; perlakuan T1 dengan kadar ureum dan kreatinin 101,144 ± 1.805 dan 0,944 ± 0,10 mg/dl, dan pada perlakuan T2 dengan kadar ureum dan kreatinin masing-masing 99,889 ± 4.075 dan 0,900 ± 0,00 mg/dl. Pengamatan histologi ginjal pada T1 ditemukan degenerasi dan nekrosis. Pada T2 terlihat penurunan degenerasi dan nekrosis disertai peningkatan regenerasi epitel sel tubulus proksimal dan distal. Kadar ureum pada kelompok perlakuan T1 dan T2 berbeda nyata terhadap T0, namun jika dilihat dari rata-rata standar deviasi menunjukan T2 mendekati kadar T0. Kadar kreatinin T2 tidak berbedanyata dengan T0 dan T1, sedangkan T0 berbedanyata dengan T1. Selain itu, ekstrak kulit pisang kepok mampu mencegah kerusakan jaringan ginjal namun belum berbeda nyata.

Perbedaan Morfometri Anjing Kintamani Bali Jantan dan Betina pada Fase Perkembangan Sabella Ivana Ruslie; I Gusti Ayu Agung Suartini; I Putu Sampurna
Buletin Veteriner Udayana Vol. 14 No. 6 December 2022
Publisher : The Faculty of Veterinary Medicine, Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/bulvet.2022.v14.i06.p01

Kintamani dogs are native dogs of Indonesia which have been registered with the Fédération Cynologique Internationale (FCI) as medium-sized dogs. This study aims to determine the morphometric differences of male and female Kintamani Bali Dog (AKB) in the development phase that is maintained in Bangli Regency and Denpasar Municipality. A total of 32 Kintamani Bali Dogs (AKB), consisting of 8 male AKB from Bangli, 8 female AKB from Bangli, 8 male AKB from Denpasar, and 8 female AKB from Denpasar, were used in this study to determine the forefoot and hind limb morphometry in developmental phase (6-18 months). The variables measured were hind limb height (TB), upper hind limb length (HF), lower hind limb length (TP), hind limb length (QH), hind limb height (HR), upper hind limb length (RC), lower front foot length (FF), front toe length (QF). The data obtained were analyzed by variant analysis using SPSS version 25. The results showed that the HR, RC, QF and HF were significantly different (P<0.05) between male AKB maintained in Bangli Regency and Denpasar Municipality; while the height of the TB was significantly different (P>0.05) between female AKB maintained in Bangli Regency and the Municipality of Denpasar. This study shows that the feed and the way of maintenance is very influential on the growth of male and female AKB with different topography, cage modification can be done to equalize the conditions in the place of origin so as to minimize temperature differences that can result in differences in metabolic functions that affect the growth rate.

MOLECULAR MORPHOLOGY OF SNAKE VENOM PROTEIN Trimeresurus insularis AFTER FREEZE DRYING DETECTED BY SCANNING ELECTRON MICROSCOPE Adrianto, Steven; Sari, Tri Komala; Suarsana, I Nyoman; Suartini, I Gusti Ayu Agung
Jurnal Kedokteran Hewan Vol 19, No 1 (2025): March
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v19i1.41219

The high protein content in snake venom make venom samples prone damaged. Freeze drying is a solution to stabilize the protein in snake venom and the addition of excipients such as sugar and surfactant, can prevent negative impacts during freeze drying process. The purpose of this study was to examine the morphology of Trimeresurus insularis (T. insularis) snake venom protein molecules after freeze-drying with the addition of sucrose, Tween 80, and PBS (pH 7.2). In this study, venom from nine T. insularis snakes was used. Before freeze drying, the treated samples were supplemented with sucrose, Tween 80, and PBS (pH 7.2), while, the control sample was only supplemented with PBS (pH 7.2). After freeze drying, the morphology of both samples was observed using a scanning electron microscope at magnification of 100x and 3000x. The result showed that the control sample was damaged and resembled broken glass, whereas the treatment sample, although it also appeared as shattered glass, was more intact and exhibited finer and smaller flakes.

Co-Authors Adrianto, Steven Agik Suprayogi Aida Lousie Tenden Rompis Amalia, Ainun Rizki Amrulloh, Muhammad Faqih Anak Agung Ananda Septiarini Anita Dwi Handayani Areningrat, Putu Ayutia Brigita Galilea Adu Defi Lega Nurwidana Dewi, Kadek Dyah Utami Dewi, Putu Bulan Sasmita DWI SURYANTO Ferbian Milas Siswanto Ghina Monita Pramudhita Gusti Ayu Yuniati Kencana Hidayah, Dinda Nur I Gusti Agung I Gusti Made Krisna Erawan I Gusti Ngurah Kade Mahardika I Gusti Ngurah Sudisma I Ketut Suada I Ketut Suatha I Made Kardena I Made Sukada I MADE SUMA ANTARA I Nengah Kerta Besung i Nengah Wandia I NYOMAN MANTIK ASTAWA I Nyoman Suarsana I Nyoman Suarta I Nyoman Suartha I Putu Sampurna I Sendow I Wayan Suardana I Wayan Suardana I wayan Teguh Wibawan I.H. Utama I.W. Batan Ida Ayu Sri Candra Dewi Ida Bagus Kade Suardana Ida Bagus Ngurah Swacita Indrawati Sendow Indrawati Sendow IRIANI SETYAWATI Iwan Harjono Utama Kadek Karang Agustina M.D. Rudyanto MAGGY T. SUHARTONO Maratun Janah MARIA BINTANG Messy Saputri Boru Sembiring Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Luh Eka Setiasih Ni Luh Putu Agustini Ni Luh Watiniasih Ni Made Riska Adnyani Nirhayu, Nirhayu Oktryna Hodesi Sibarani Putu Ayu Sisyawati Putriningsih Putu Oky Astawibawa Risha Catra Pradhany Sabella Ivana Ruslie Setyawati, Iriana Sisyawati Putriningsih Supar - T. Sari Nindia Tjokorda Sari Nindhia TRI KOMALA SARI Wahyu Tri Utomo Yosaphat L.S Kote

Title

Found 29 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 29 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 29 Documents
Search