p-Index From 2021 - 2026
5.999
P-Index
This Author published in this journals
All Journal International Journal of Public Health Science (IJPHS) Journal of Food and Pharmaceutical Science Pharmaciana: Jurnal Kefarmasian Media Farmasi : Jurnal Ilmu Farmasi (Journal Of Pharmaceutical Science) Indonesian Journal of Pharmaceutical Science and Technology Jurnal Ilmu Farmasi dan Farmasi Klinik (Journal of Pharmaceutical Science and Clinical Pharmacy) Majalah Obat Tradisional INDONESIAN JOURNAL OF PHARMACY Science and Technology Indonesia Ilmu Gizi Indonesia Indonesian Journal of Chemistry JPSCR : Journal of Pharmaceutical Science and Clinical Research Jurnal Pemberdayaan: Publikasi Hasil Pengabdian Kepada Masyarakat Jurnal Ilmu Kefarmasian Indonesia Pharmaceutical Journal of Indonesia Jurnal Mandala Pharmacon Indonesia Indonesian Journal of Halal Research Jurnal Ilmiah Farmako Bahari Journal of halal product and research (JHPR) Lumbung Farmasi : Jurnal Ilmu Kefarmasian Community Empowerment Hubungan Tingkat Pengetahuan Petugas Pengelola Obat dengan Tingkat Ketersediaan Obat Di Puskesmas Kota Malang Jurnal Ilmiah Ibnu Sina (JIIS): Ilmu Farmasi dan Kesehatan JURNAL INOVASI DAN PENGABDIAN MASYARAKAT INDONESIA JKKI : Jurnal Kedokteran dan Kesehatan Indonesia Pharmaceutical Sciences and Research (PSR) Jurnal Farmasi Sains dan Praktis Jurnal Kajian Islam Modern Journal of Halal Science and Research Journal of Pharmaceutical and Sciences. Riwayat: Educational Journal of History and Humanities Journal of Food and Pharmaceutical Sciences Medical Sains : Jurnal Ilmiah Kefarmasian Journal of Pharmacy and Halal Studies (JPHS)
Claim Missing Document
Check
Articles

Pengaruh suhu penguapan ekstrak terhadap aktivitas antoksidan dan antiglikasi ekstrak tempe kedelai dan tempe gembus Sunarti Sunarti; Nina Salamah; Muhammad Sulkhan; Banundari Rachmawati; Rosyida Awalia Safitri; Annta Kern Nugrohowati; Agustin LN Aminin
Ilmu Gizi Indonesia Vol 6, No 1 (2022): Agustus
Publisher : Universitas Respati Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35842/ilgi.v6i1.255

Abstract

Latar Belakang: Tempe kedelai dan tempe gembus merupakan makanan fermentasi khas Indonesia yang mempunyai potensi sebagai antioksidan dan antiglikasi. Senyawa bioaktif tersebut dapat diekstrak sehingga berpotensi untuk dikembangkan menjadi produk nutraceutical. Etanol merupakan pelarut yang sering digunakan untuk ekstraksi senyawa bioaktif. Namun demikian, suhu pada proses penguapan pelarut dapat memengaruhi kapasitas bioaktif ekstrak. Tujuan: Untuk mengetahui pengaruh suhu penguapan etanol terhadap aktivitas antioksidan dan antiglikasi ekstrak tempe kedelai dan tempe gembus. Metode: Aktivitas antioksidan diukur dengan DPPH, sedangkan antiglikasi dengan spektrofotometer fluoresens. Analisis data dengan uji Anova dilanjutkan uji Post Hoc. Hasil: Penelitian ini menunjukkan pada penguapan ekstrak tempe kedelai suhu rendah -40°C (freeze dry) nilai IC50 sebesar 2,30±0,05 mg/ml, sedangkan dengan water bath suhu 50°C nilai IC50 sebesar 2,83±0,04 mg/ml. Aktivitas antioksidan pada estrak tempe gembus yang diuapkan dengan suhu rendah -40°C, nilai IC50 1,70±0,02 mg/ml, sementara yang diuapkan dengan water bath 3,17±0,02 mg/ml. Antiglikasi ekstrak tempe kedelai yang diuapan dengan metode freeze dry 64,65±6,60% dan yang diuapkan dengan water bath 62,63±3,99%, sementara antiglikasi tempe gembus yang diuapkan dengan metode freeze dry 46,60±4,10% sedangkan yang diuapkan dengan water bath 50,19±13,80%. Kesimpulan: Pengeringan menggunakan metode freeze dry memberikan hasil potensi antioksidan yang lebih tinggi dibandingkan dengan metode evaporasi menggunakan water bath. Aktivitas antioksidan pada tempe gembus lebih tinggi dibandingkan tempe kedelai, namun potensi antiglikasi tempe kedelai lebih tinggi dibandingkan dengan tempe gembus.
The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60413

Abstract

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.
QUALITY ANALYSIS AND IDENTIFICATION OF FUNCTIONAL GROUPS OF SWEET ORANGE (Citrus sinensis) PEEL ESSENTIAL OIL USING FTIR Citra Dhea Cantika; Laela Hayu Nurani; Nina Salamah
Medical Sains : Jurnal Ilmiah Kefarmasian Vol 8 No 4 (2023)
Publisher : Sekolah Tinggi Farmasi Muhammadiyah Cirebon

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37874/ms.v8i4.898

Abstract

Organic waste in the form of citrus fruit peels has not been handled seriously, causing environmental pollution, such as the emergence of unpleasant odors.  Therefore, waste management becomes a more valuable product or item.  Citrus peel oil counterfeiting often occurs because there is no Indonesian National Standard (SNI) for citrus peel oil as a quality standard, making it difficult to identify the falsity of finished citrus peel oil products in the market. Research was conducted to test the quality of sweet orange peel oil so that it could be used as a standard to identify the content of sweet orange peel oil using the FTIR method. Oil quality testing included an organoleptic test, specific gravity, refractive index, and acid number. The oil quality test results showed clear yellow oil with a distinctive sweet orange peel aroma, specific gravity of 0.845, refractive index of 9.263, and acid number of 1.1. FTIR analysis revealed spectra that appeared in the region of 1490 with strong intensity (C-H aromatic), 1645 with medium intensity (C=C), and 2860 with medium intensity (C-H aliphatic). FTIR spectra of sweet orange peel oil showed similarity with limonene with a hit quality value of 958, the content of sweet orange peel oil is dominated by limonene compounds. Keywords: sweet orange peel, Essential oil, FTIR, Limonene, Oil quality
REVIEW: HERBAL POTENTIAL IN THE USE OF SPF 30 AND 50 SUNSCREENS Siti Fatimah Sultan; Nina Salamah
Medical Sains : Jurnal Ilmiah Kefarmasian Vol 9 No 2 (2024)
Publisher : Sekolah Tinggi Farmasi Muhammadiyah Cirebon

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37874/ms.v9i2.1139

Abstract

Sunscreen is a substance that can reflect or absorb light, protecting the skin from damage caused by exposure to UV radiation. Soursop juice extract (Annona muricata L.), lime peel extract (Citrus aurantifolia), shallot skin extract (Allium cepa L.), celery leaf extract (Apium graveolens L.), and ethanol extract of kersen leaves (Muntingia calabura) are some plants that can be used as natural sunscreens. According to the SPF value and the protective power category, the soursop juice extract has an SPF value of 5.188, 12.242, and 17.247. Lime peel extract has SPF values of 28.6, 42.2, and 81.8 (max-ultra). Onion peel extract has SPF values of 11.4, 20.12, 31.8, and 34.83 (max-ultra). Celery leaf extract had SPF values of 1.7873, 4.5553, 7.3183, and 8.1573 (max-ultra). Kersen leaf ethanol extract had concentrations of 1.528, 3.890, 3.971, 4.585, and 5.252 (max-ultra). Phenolic components, polyphenols, flavonoids, tannins, and vitamin C are known as bioactive compounds in the five plant extracts that function as sunscreens. The polarity of the solvent influenced the SPF rating and protective power category. It is concluded that the SPF value and protective power of the plant extracts have SPF values and protective power categories with extracts in ultra categories. The bioactive compounds contained in the five plant extracts that act as sunscreens are phenolic compounds, polyphenols, flavonoids, tannins, and vitamin C ...
ANTIOXIDANT ACTIVITY, TOTAL PHENOL, AND FLAVONOID CONTENT EXTRACTS AND FRACTIONS MANGO SEEDS (Mangifera indica L.) Anjani, Ratna; Kasmawati, Henny; Yamin; Salamah, Nina
Medical Sains : Jurnal Ilmiah Kefarmasian Vol 9 No 3 (2024)
Publisher : Sekolah Tinggi Farmasi Muhammadiyah Cirebon

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37874/ms.v9i3.1196

Abstract

Antioxidants can either stop or slow down the excessive oxidation of a compound. This study aimed to determine the secondary metabolite compounds, antioxidant activity, total flavonoid and phenolic levels, and the correlation between the levels of flavonoid and phenolic compounds in inhibiting free radicals. The DPPH (1,1-diphenyl-2-picrylhydrazyl) method was used to evaluate antioxidant activity. Determination of total flavonoid levels using a UV-Vis spectrophotometer and the aluminum chloride method. The total phenolic content was determined using the Folin-Ciocalteu method. Based on the results of phytochemical screening, mango seed extract (Mangifera indica L.) contains secondary metabolites such as alkaloids, flavonoids, terpenoids, phenolics, and tannins. The relationship between the antioxidant activity of the DPPH method and total flavonoid levels was 91.31%, respectively. The relationship between the antioxidant activity of the DPPH method and the total phenolic content was 99.64%. Keywords: Mangifera indica L, secondary metabolites, antioxidant activity, DPPH, total flavonoids, total phenolics.
Pendampingan dan Kehalalan Produk Pangan Dilakukan Kepada Peserta Pemilik UMKM di Kelurahan Wirobrajan Yogyakarta Salamah, Nina; Pradini, Ni Komang Virginia; Pora, Yohana Laura Silfia; Wulandari
JURNAL INOVASI DAN PENGABDIAN MASYARAKAT INDONESIA Vol 3 No 4 (2024): Oktober
Publisher : Fakultas Kesehatan Masyarakat, Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26714/jipmi.v3i4.403

Abstract

Latar belakang: Usaha Mikro, Kecil, dan Menengah (UMKM) merupakan pilar utama dalam struktur perekonomian Indonesia. Namun, banyak pemilik UMKM menghadapi tantangan dalam memastikan produk pangan mereka memenuhi standar kehalalan yang ditetapkan. Proses sertifikasi halal tidak hanya membutuhkan biaya besar, tetapi juga pengetahuan dan pemahaman yang mendalam. Tujuan: untuk memastikan bahwa produk pangan yang dihasilkan oleh UMKM di Kelurahan Wirobrajan, Yogyakarta, memenuhi standar kehalalan yang ditetapkan. Metode: Pendekatan partisipatif digunakan, meliputi sosialisasi untuk memastikan pemahaman dan penerapan yang efektif tentang kehalalan produk pangan. Hasil: Kegiatan menunjukkan adanya peningkatan pemahaman pemilik UMKM tentang keamanan pangan dan kehalalan produk setelah mengikuti sosialisasi. Berdasarkan analisis statistik, terdapat perbedaan yang signifikan antara skor pre-test dan post-test. Hal ini mengindikasikan bahwa program pendampingan ini efektif dalam meningkatkan pengetahuan dan keterampilan pemilik UMKM. Selain itu, observasi lapangan juga menunjukkan adanya perubahan dalam praktik produksi pangan, di mana pemilik UMKM telah mulai menerapkan prinsip-prinsip kehalalan dalam setiap tahapan produksi. Mereka juga menunjukkan antusiasme yang tinggi untuk mengajukan sertifikasi halal bagi produk-produk mereka. Kesimpulan: Program pendampingan berhasil meningkatkan pemahaman pemilik UMKM mengenai kehalalan produk pangan, terbukti dari peningkatan skor rata-rata pemahaman dari 25% menjadi 75%. Pendampingan juga membantu UMKM memahami proses sertifikasi halal yang sebelumnya dianggap rumit dan mahal, dengan memberikan bimbingan praktis dalam menyusun dokumen dan persyaratan sertifikasi. Kata kunci: kehalalan, produk pangan, UMKM, Wirobrajan ________________________________________________________________________ Abstract Background: Micro, Small and Medium Enterprises (MSMEs) are the main pillars in the structure of the Indonesian economy. However, many MSME owners face challenges in ensuring their food products meet established halal standards. The halal certification process not only requires large costs, but also in-depth knowledge and understanding. Objective: To ensure that the food products produced by MSMEs in Wirobrajan Village, Yogyakarta, meet the established halal standards. Method: A participatory approach is used, including outreach to ensure effective understanding and implementation of halal food products. Result: Activities show an increase in MSME owners' understanding of food safety and halal products after participating in the socialization. Based on statistical analysis, there is a significant difference between the pre-test and post-test scores. This indicates that this mentoring program is effective in increasing the knowledge and skills of MSME owners. Apart from that, field observations also show changes in food production practices, where MSME owners have begun to apply halal principles in every stage of production. They also show high enthusiasm for applying for halal certification for their products. Conclusion: The mentoring program was successful in increasing the understanding of MSME owners regarding halal food products, as evidenced by the increase in the average understanding score from 25% to 75%. Assistance also helps MSMEs understand the halal certification process which was previously considered complicated and expensive, by providing practical guidance in compiling documents and certification requirements. Keywords: halal, food products, MSMEs, Wirobrajan
Purity Analysis of Sesame Oil Extracted from Sesamum indicum L. Using the ATR-FTIR Method Mahendra, Muhammad Reza; Salamah, Nina; Guntarti, Any
Indonesian Journal of Pharmaceutical Science and Technology Vol 11, No 3 (2024)
Publisher : Indonesian Journal of Pharmaceutical Science and Technology

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24198/ijpst.v11i3.50102

Abstract

Sesame seeds (Sesamum indicum L.) are a plant that produces the most important and oldest oil known to man. Apart from being rich in nutrients, sesame consists of important functional components such as sesamin, sesamolin, sesamol, sesaminol, sesamolin phenol, and other lignan-like active ingredients and can trigger the motive to produce sesame oil by adulteration in order to achieve market desires. The aim of this research is to identify the purity of sesame oil and analyze it using the ATR-FTIR method to detect and prevent counterfeiting. Testing the characteristics of sesame oil can be adjusted to the quality requirements that have been set, one of which is the Indonesian National Standard (SNI) so that the quality of sesame oil circulating on the market is guaranteed. This research is non-experimental research. Sesame seed oil resulting from pressing is based on the test requirements of SNI 01-4468-1998 including the physico-chemical properties test. The results of the sesame seed oil profile are that the sesame seed oil extraction yield is 29.265%, the sesame oil is bright yellow in color, has a distinctive smell, specific gravity (20oC) 0.9237± 0.0057, refractive index 1.4702 ± 0.0005, peroxide value 2 ± 0.0577 meqO2/Kg, iodine value 107.1 ± 0.5773, and acid number 0.224 ± 0.0577. Based on the research results, it can be concluded that the pressed sesame seed oil has met the requirements of the SNI 01-4468-1998 test, and from the functional groups that appear in the ATR-FTIR it can be concluded that the pressed sesame oil contains methyl ester group compounds.
ANALYSIS OF TOTAL FLAVONOID CONTENT AND ANTIOXIDANT ACTIVITY OF GREEN TEA (Camellia sinensis) WITH VARIATIONS IN TYPE AND BREWING Salamah, Nina; Widi Astuti, Silvia Ferry; Ar Rahma, Nur Aulia; Guntarti, Any
Jurnal Farmasi Sains dan Praktis Vol 10 No 3 (September-December 2024)
Publisher : Universitas Muhammadiyah Magelang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31603/pharmacy.v10i3.10537

Abstract

Free radicals can react to cause damage when they enter the human body. The use of antioxidants can neutralize free radicals in the body. This study aims to determine the total flavonoid levels and antioxidant activity in premium and original green tea with variations in brewing temperature. Green tea produced by Kulon Progo is brewed with aquadest at 75 ℃ and 100 ℃, and then the filtrate obtained is ground by freeze-drying. Identification of flavonoid compounds using the flavanoid-ammonia vapor color complex. The total flavonoid levels analysis using UV-vis spectrophotometry and antioxidant activity was tested by the DPPH (1,1-diphenyl-2-picrylhydrazil) method. Based on the test results, the highest to lowest total flavonoid levels were premium green tea at 100 ℃ original at 100 ℃, original at 75 ℃, and premium at 75 ℃ (155.095 ± 3.158; 153.333 ± 2.788; 151.7181 ± 4.944; and 148.634 ± 2,095 mgQE/gram extract). The highest to lowest potential antioxidant activity, respectively, is quercetin (flavonoid standard), premium green tea at 100 °C, premium at 75 °C, original at 100 °C, and original at 75 °C, with IC50 values of 3.0692 ± 1.064; 32.359 ± 7.346; 31.502 ± 6.746; 27.527 ± 7.868; and 27.167 ± 1.817 μg/mL. Analysis of the total flavonoids of green tea showed that the highest levels were in premium green tea at a temperature of 100 °C. An antioxidant activity test with the DPPH reagent produced the highest antioxidant potential in premium green tea at 100 °C. So premium green tea at a brewing temperature of 100 °C is more recommended to consumers.
PENERAPAN NILAI ISLAMI DALAM PELAYANAN FARMASI KLINIS: KAJIAN SISTEMATIS ETIKA, KEHALALAN DAN KEPUASAN PASIEN Rozak, Miftahul; Saraswati, Damai Ira; Fathurohman SW, Oman; Salamah, Nina
JURNAL KAJIAN ISLAM MODERN Vol 12 No 01 (2025): MARET 2025
Publisher : Institut Agama Islam Sahid (INAIS) Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.56406/jkim.v12i01.641

Abstract

Islamic pharmaceutical and healthcare services represent an innovative approach that integrates Islamic ethical values, such as justice, halal compliance, and patient satisfaction, into clinical practice. However, the application of these values faces challenges, including public knowledge gaps, insufficient training for healthcare professionals, and the lack of unified practice standards. This study employs a systematic review method to analyze relevant literature from the past decade. Literature searches were conducted using PubMed and Google Scholar with keywords such as "Islamic values in clinical pharmacy," "halal pharmaceuticals," and "maqasid shariah in healthcare." Articles meeting inclusion criteria were evaluated following PRISMA guidelines and analyzed qualitatively to identify key findings and research gaps. After the selection process, six articles met the inclusion criteria.. The findings reveal that integrating Islamic values, such as halal pharmaceuticals, Islamic ethics, and sharia-based facilities, significantly contributes to improving pharmaceutical service quality, patient satisfaction, and loyalty among Muslim patients. However, implementation remains constrained by a lack of healthcare professional training, minimal regulations, and incomplete societal perceptions. This review highlights the importance of developing an integrated framework, enhancing public and professional education, and fostering cross-professional collaboration to support the integration of Islamic values in healthcare services. This approach holds great potential to enhance service quality, patient satisfaction, and loyalty while serving as an innovative model for universal healthcare services.
A review of the halal status of ceramide in cosmetics: a strategic approach to halal policy and consumer awareness in Indonesia Basuki, Nazih; Yulianti, Rista; Fathurrohman SW, Oman; Salamah, Nina
Journal of Halal Product and Research (JHPR) Vol. 8 No. 1 (2025): Advancing the Halal Industry: Innovation, Sustainability, and Global Impact
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jhpr.vol.8-issue.1.90-100

Abstract

In cosmetics, ceramide plays a significant role in maintaining healthy skin. However, ensuring its halal status remains challenging because ceramide can be sourced from animals, plants, microbial fermentation, or chemical synthesis, each presenting its own halal-critical points. With the growing demand for halal cosmetics in Indonesia and mandatory halal certification for raw materials and finished products, special attention is required to maintain consumer trust. This study employed a literature review by analyzing registration data of ceramide-based cosmetic products from the Indonesian Food and Drug Authority (BPOM) and halal certification data from the Halal Product Assurance Organizing Agency (BPJPH). The review aimed to identify compliance gaps, examine halal policies, and understand the critical halal points in ceramide production. The analysis shows 74.52% of ceramide-based cosmetic products registered with BPOM do not have halal certification. Regulatory factors, consumer awareness, and halal raw material supply chain constraints influence this shortfall. Ceramide derived from animal sources poses the greatest challenge, whereas microbial fermentation and chemical synthesis offer greater potential for halal compliance if properly supervised. Collaboration among BPJPH, BPOM, and the Ministry of Trade is crucial to ensure compliance. Moreover, mandatory halal requirements on raw materials before the final product stage are essential to guarantee comprehensive halal assurance. Institutional synergy, public education, and improved access to halal raw materials are strategic measures to support Indonesia’s halal cosmetics industry. This study provides strategic guidance for regulators and industry players in addressing challenges related to halal regulations for ceramide-based cosmetics.   Keywords: Ceramide, Halal Cosmetics, Halal Mandatory, Halal Certification, Halal Critical Point
Co-Authors A Riyanto Abdul Rohman Achmad Wahyudi adhitya ilham mukti Agustin LN Aminin Ajeng Dian Pertiwi, Ajeng Dian Anggita Devi Anisa Firdaus Anita Wening Sejati Anjani, Ratna Annta Kern Nugrohowati Any Guntarti Any Guntarti Any Guntarti Any Guntarti Any Guntarti Ar Rahma, Nur Aulia Arini Salsabila Aulia Syafadilla Azali Banundari Rachmawati Barokati Azizah Basuki, Nazih Citra Ariani Edityaningrum, Citra Citra Dhea Cantika Danang Prasetyaning Amukti Desti Kameliani Dian Prasasti Dwi Fitriani Erlinda Widyasari Fathurohman SW, Oman Fathurrohman SW, Oman FATMAWATI, ARUM Fatriansari, Asih Fella Qulsum Maulida Firdaus, Rizqi Amalia Gunawan Anugra Sumule, Joshua Hardi Astuti Witasari Hari Susanti Hayati, Farida Hikmah, Nazila Nur Ichwan Ridwan Rais Ikawati, Retty INNAYAH IZATI Irfan, Nawwar Jaswir, Irwandi Jufri, Sayyidah Luthfiyah Justitia Cahyani Fadli karunia nining handaningrum Kasmawati, Henny Kintoko Kintoko Kintoko, Kintoko Kurniaty, Santyas Kurniawan, Muhammad Fariez Laela Hayu Nurani Liani Farahana Liza Syafitri Ma'ruf, Muhammad Mae Sri Hartati Wahyuningsih Mahendra, Muhammad Reza Maulizah, Rizlah Miftahul Rozak Moch Saiful Bachri Mohamed, Farahidah Muhammad Andy Rajab Muhammad Sulkhan Muhti Al Abror Mukti Utomo, Adhitya Ilham Mustofa Ahda Nanik Sulistyani Ni Komang Virginia Pradini Nining Sugihartini Novita Diana Ayu Candra Nurkhasanah Mahfudh Nurkhasanah Nurkhasanah Pangaribuan, Ika S Pinus Jumariyatno Pora, Yohana Laura Silfia Pradini, Ni Komang Virginia Prasti Andini Putri, Chintiana Nindya Rajab, Muhammad Andy Ria Indah Pratami Rina Handayani Rini Rahmawati Rosyida Awalia Safitri Rozak, Miftahul Saraswati, Damai Ira SATRIYAS ILYAS Sembiring, Rinawati Sihaloho, Serli Silmi Kaffah Sitarina Widyarini Siti Athiyah Umaiyah Siti Fatimah Sultan Sitti Masyithah Awaluddin Sri Mulyaningisih Sri Mulyaningsih Sudibyo Martono Sudibyo Martono Sugiyanto - Sugiyanto . Sugiyanto . Sugiyanto Sugiyanto Sugiyanto Sugiyanto Sunarti Sunarti Suryani, Arman Suwidjiyo Pramono Suwidjiyo Pramono SW, Oman Fathurohman Syafitri, Liza Uddin, ABM Helal Verda Farida Wahyu Widyaningsih Wahyu Widyaningsih Wahyu Widyaningsih Wahyu Widyaningsih Wahyuningtyas, Nurma Widi Astuti, Silvia Ferry WULANDARI Yamin Yulianti, Rista Yuny Erwanto Yuny Erwanto Zahra Alya Putri