Claim Missing Document
Check
Articles

EFEK ANTIANGIOGENESI EKSTRAK ETANOL GANGGANG HIJAU (Spirogyra sp.) BERDASARKAN EKSPRESI COX-2 PADA SEL T47D Widyaningsih, Wahyu; Salamah, Nina; Susanti, Hari; Fitriani, Dwi
Majalah Obat Tradisional Vol 19, No 3 (2014)
Publisher : Faculty of Pharmacy, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (974.752 KB) | DOI: 10.14499/mot-TradMedJ19iss3pp127-132

Abstract

Kanker adalah sekelompok penyakit yang timbul apabila sebuah sel atau sekelompok sel lepas dari kontrol yang mengatur pertumbuhan. Ganggang hijau (Spirogyra sp.) merupakan salah satu tanaman obat yang digunakan sebagai obat tradisional untuk pengobatan kanker. Ganggang hijau (Spirogyra sp.) mempunyai kandungan zat aktif berupa melatonin dimana melatonin merupakan senyawa yang sudah diteliti para peneliti dunia sebagai obat antikanker dan antioksidan. Penelitian ini bertujuan untuk mengetahui pengaruh ekstrak etanol ganggang hijau (Spirogyra sp.) terhadap ekspresi COX-2 pada sel T47D. Ganggang hijau diekstraksi dengan menggunakan alat Soxhlet dengan pelarut etanol 96%. Penelitian ini menggunakan 3 kelompok yaitu kontrol sel, pemberian ekstrak etanol ganggang hijau konsentrasi 247,668 μg/ml dan 123,834 μg/ml. Untuk memastikan adanya ekspresi COX-2 dilakukan uji imunositokimia secara tidak langsung. Pengamatan dilakukan menggunakan mikroskop cahaya untuk melihat dan menghitung persen ekspresi COX-2. Hasil yang didapatkan menunjukkan terdapat perbedaan yang bermakna penurunan ekspresi COX-2 pada tiap kelompok.. Jadi dapat disimpulkan bahwa ekstrak etanol ganggang hijau (Spirogyra sp.) mampu menurunkan ekspresi COX-2 pada sel T47D.
Halal assurance system training and its implementation with the Muhammadiyah halal pledge Mahfudh, Nurkhasanah; Ikawati, Retty; Salamah, Nina; Ahda, Mustofa
Community Empowerment Vol 6 No 5 (2021)
Publisher : Universitas Muhammadiyah Magelang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (361.861 KB) | DOI: 10.31603/ce.4518

Abstract

The implementation of Law Number 33 of 2014 concerning Halal Product Guarantee requires all products circulating in Indonesia to have a halal certificate. Micro businesses must also keep up with these developments. The 2020 Job Creation Law states that the obligation to be halal certified is based on statements from micro and small business actors. Muhammadiyah responded to this scheme by setting a halal pledge for micro and small businesses. To support the statement of the halal pledge which is based on understanding, training activities and assistance for the halal production process are carried out for micro and small businesses. The results of this activity revealed a significant increase in the understanding of MSMEs with an average pre-test score of 36 ± 6.9 and an average post-test score of 72 ± 14.1. In addition, participants were also able to compile the Muhammadiyah halal pledge application form.
Subchronic Toxicity of Green Algae (Spyrogyra sp.) Ethanolic Extract on Hematologic Parameters Nina Salamah; Wahyu Widyaningsih; Hari Susanti; Anggita Devi; Anita Wening Sejati; Zahra Alya Putri
International Journal of Public Health Science (IJPHS) Vol 5, No 4: December 2016
Publisher : Intelektual Pustaka Media Utama

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11591/ijphs.v5i4.5962

Abstract

Green Algae, an organism with active substance such as phytomelatonin, has potential to be developed as Indonesian traditional medicine. As the long term addition of Green Algae ethanol extract (Ekstrak etanol ganggang hijau, EEGH) influences the hematology system, in this paper, the safety test was done to ensure the safety of its use through subchronic toxicity test of EEGH on the hematology parameters of Wistar rats. The test group consisted of three groups treated with EEGH 100 mg/kg, 200 mg/kg, and 400 mg/kg, while the control group was given by 0.5% CMC-Na, with 8 rats each respectively. By using blood samples taken from orbital sinus on the 29th day, common hematologic parameters (erythrocytes, leukocytes, and hemoglobin level), the parameters of hemostasis (platelets, pT, aPTT, BT) and immune parameters (Differential Leukocytes Counts include neutrophils segment, lymphocytes, monocytes, and eosinophils) were finally observed and showed that the 28 days-addition of EEGH increase the hematological parameters of Wistar rats.
Determination of Total Phenolic Levels in Ethanol Extract of Moringa (Moringa oleifera L.) Leaves based on Differences in Growing Sites Any Guntarti; Nining Sugihartini; Siti Athiyah Umaiyah; Nina Salamah
Journal of Food and Pharmaceutical Sciences Vol 9, No 1 (2021): J.Food.Pharm.Sci
Publisher : Institute for Halal Industry and System (IHIS) Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jfps.1337

Abstract

Moringa oleifera L. have good nutritional content including phenolic compounds which can be used as antioxidants and can grow in lowlands and highlands. The purpose of this study was to determine the total phenolic content of the ethanol extract of M. oleifera leaves with variations in the area of ​​collection. The 50% ethanol extract was obtained from the simplicia of M. oleifera leaves by using the maceration method. Analysis of total phenolic content in the extract was carried out using a spectrophotometer instrument with the addition of reagent Folin-Ciocalteu and gallic acid as standard. The results of total phenolic content in Sleman, Wonosari, and Wonosobo areas were (127.87 ± 2.71) mg GAE / g extract, (99.40 ± 2.68) mg GAE / g extract, and (142 , 92 ± 1.81) mg GAE / g extract. The highest phenolic content in the ethanol extract of moringa leaves was found in Wonosobo areas.
UJI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL HERBA PEGAGAN (Centella asiatica (L.) Urb) DENGAN METODE FOSFOMOLIBDAT Nina Salamah; Liani Farahana
Pharmaciana Vol 4, No 1 (2014): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (73.793 KB) | DOI: 10.12928/pharmaciana.v4i1.394

Abstract

Antioxidant compound extends widely used to prevent degenerative disease. Centella asiatica(L.) Urb or known as pegagan is a plant which grown in Indonesia and it’s leaves contain somecompounds reported to have antioxidant activities. The research aimed to know antioxidant activity ofethanolic extract of pegagan herbs by mechanism of reducing power. The antioxidant activity analyzedusing visible spectrophotometric with phosphomolybdate method. Antioxidant activity of ethanolicextract of pegagan was expressed as mg quercetin equivalence/gram extract). The result showed thatusing this method the ethanolic extract of pegagan activity had antioxidant activity which is43.198 ± 2.048 mg mgQE/gram extract.
Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (6376.296 KB) | DOI: 10.12928/pharmaciana.v9i2.14070

Abstract

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.
AKTIVITAS ANTIOKSIDAN EKSTRAK METANOL DAUN KELENGKENG (Euphoria longan (L) Steud.) DENGAN METODE PENANGKAPAN RADIKAL 2,2’-DIFENIL-1-PIKRILHIDRAZIL Nina Salamah; Erlinda Widyasari
Pharmaciana Vol 5, No 1 (2015): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.021 KB) | DOI: 10.12928/pharmaciana.v5i1.2283

Abstract

The degenerative diseases is caused by endogenous antioxidant cannot neutraliced from increased concentration of free radicals, therefore it is necessary to consume antioxidant from the outside ofbody for neutralizing and destroying free radicals. The aim of this research is to evaluate the antioxidant activity of methanolic extract of longan leaves. The experiment of antioxidant activity from extract longan leaves uses the scavenging assay using 2,2’-diphenyl-1-pycrylhydrazyl (DPPH) method and quersetin as positive control. The analytical result is processed using linear regression methode in order to get ES50 value. The results of research showed that theincreasing concentration of methanolic extract, and quercetin causes the higher percentage of DPPH radical scavenging. The ES50 values of methanolic extract and quercetin obtained are 40.32 µg/ml and 2.48 µg/ml respectively.
STANDARISASI PARAMETER NON SPESIFIK DAN PERBANDINGAN KADAR KURKUMIN EKSTRAK ETANOL DAN EKSTRAK TERPURIFIKASI RIMPANG KUNYIT Barokati Azizah; Nina Salamah
Pharmaciana Vol 3, No 1 (2013): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (105.829 KB) | DOI: 10.12928/pharmaciana.v3i1.416

Abstract

Turmeric (Curcuma domestica Val.) is one of the plants that contain curcumincompounds with various activity. Use of curcumin from turmeric is widely used in theform of ethanolic extract, but there are ballast substances that cause low levels ofcurcumin. This can be pursued with the manufacture of a purified of ethanolic extract.Ethanolic extract of turmeric was made by maceration using ethanolic 96%. Ethanolicextract soaked with hexane until the hexane phase is clear and purified extract obtainedis insoluble hexane phase. Curcumin levels determined using Thin LayerChromatography (TLC) method with the stationary phase silica gel 60 F and mobilephase of chloroform: ethanolic: glacial acetic acid (94: 5:1) and be analyzedquantitatively using densitometry with a maximum wavelength of 426 nm . The watercontent of the extract determined using toluene distillation method, ash and acidinsoluble ash content determined using gravimetric method. The statistic analysis withLSD showed significant differences of curcumin content and analysis of non-specificparameter values on ethanolic extract and purified extract.
EFEK EKSTRAK ETANOL GANGGANG HIJAU (Ulva Lactuca L) TERHADAP BERAT BADAN DAN KADAR TRIGLISERIDA TIKUS JANTAN YANG DIBERI DIET LEMAK TINGGI Wahyu Widyaningsih; Nina Salamah
Pharmaciana Vol 5, No 2 (2015): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (508.534 KB) | DOI: 10.12928/pharmaciana.v5i2.2438

Abstract

Previous studies showed the potential of melatonin of green algae ( Ulva lactuca L ) to reduce the risk of coronary heart disease with the activity of antihiperlipidemia. Obesity and hiperlipidemia were the risk factor of degenerative diseases such as heart disease. This research aims was explore the effect of ethanol extract of green algae against weight, consumption of rat feed test white male rat were given high fat diet . Research was started with extraction green algae with ethanol 96 % to obtained concentrated extract. The extract was tested to wistar rats age of 2 months. Animals test divided into 6 group. Group I was control group, treated with high fat diet of lard 2 ml / 200g BW, of group II given high fat diet and simvastatin, group III, IV and V given high fat diet and green algae extract doses 50 mg/ Kg BW, 100 mg/Kg BW and 200 mg/ Kg BW. Group VI is the control group without diet fat high. Treatment was conducted over 28 days. Measuring normal of his weight every five day for 28 days and in measuring consumption feed with measure weight feed the rest of feed early 20 g. The difference of data weight rats per 5 days and consumption fodder for 28 days counted area under curve ( AUC ) from curves time versus weight. The measurement of triglycerides levels. The result showed the high fat diet with lard 2 ml / 200g BW for 28 days reduce weight and consumption feed mice in a significantly than control without high fat diet. The treatment with extract ethanol dose of 50 , 100 and 200 mg / Kg BW did not reduce weight, feed consumption, triglyceride levelsof  mice were given high fat diet.
Pengaruh metode penyarian terhadap kadar alkaloid total daun jembirit (Tabernaemontana sphaerocarpa. BL) dengan metode spektrofotometri visibel Nina Salamah; Miftahul Rozak; Muhti Al Abror
Pharmaciana Vol 7, No 1 (2017): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (329.614 KB) | DOI: 10.12928/pharmaciana.v7i1.6330

Abstract

One of the plants which contain the alkaloid is a plant jembirit (Tabernaemontana sphaerocarpa BL. ).Sap and leaves from this plants have been used to treat skin diseases and sprain. Alkaloid from jembirit plants showed potent cytotoxicity against various human cancer cell. The goal of this research is to find out the influence of the extraction method against the level of total alkaloid jembirit leaves.Jembirit leaves were extracted by maceration method and extraction with Soxhlet apparatus used  ethanol 70 % as a solvent . Standardization of extracts conducted by test of ash content, test of drying shrinkage, and extract yield. Qualitative analysis conducted by alkaloid test. Determination of total alkaloid was analyzed with visible spectrophotometry method using Bromocresol green as complexing agent. The results showed that jembirit leaves contained alkaloid compounds. The determination resulted the levels of total alkaloid of maceration was 0.727% ± 0.0032, levels of total alkaloid extraction with Soxhlet apparatus was 0.666% ± 0.0022. The stastitical analysis showed significance differences of total alkaloid levels between maceration method and extraction with Soxhlet apparatus viewed from siginificancy value (0.001<0.005).
Co-Authors A Riyanto Abdul Rohman Agustin LN Aminin Ajeng Dian Pertiwi, Ajeng Dian Anggita Devi Anita Wening Sejati Anjani, Ratna Annta Kern Nugrohowati Any Guntarti Any Guntarti Any Guntarti Any Guntarti Any Guntarti Ar Rahma, Nur Aulia Banundari Rachmawati Barokati Azizah Basuki, Nazih Citra Ariani Edityaningrum, Citra Citra Dhea Cantika Danang Prasetyaning Amukti Desti Kameliani Dwi Fitriani Erlinda Widyasari Fathurohman SW, Oman Fathurrohman SW, Oman FATMAWATI, ARUM Fella Qulsum Maulida Firdaus, Rizqi Amalia Gunawan Anugra Sumule, Joshua Hari Susanti Hayati, Farida Hikmah, Nazila Nur Ikawati, Retty INNAYAH IZATI Irfan, Nawwar Jaswir, Irwandi Jufri, Sayyidah Luthfiyah Justitia Cahyani Fadli Juwitaningtyas, Titisari Kasmawati, Henny Kurniaty, Santyas Kurniawan, Muhammad Fariez Laela Hayu Nurani Liani Farahana Ma'ruf, Muhammad Mae Sri Hartati Wahyuningsih Mahendra, Muhammad Reza Miftahul Rozak Mohamed, Farahidah Muhammad Sulkhan Muhti Al Abror Mukti Utomo, Adhitya Ilham Mustofa Ahda Nanik Sulistyani Nining Sugihartini Novitasari, Putri Rachma Nurkhasanah Mahfudh Pangaribuan, Ika S Pinus Jumariyatno Pora, Yohana Laura Silfia Pradini, Ni Komang Virginia Rina Handayani Rosyida Awalia Safitri Rozak, Miftahul Saraswati, Damai Ira SATRIYAS ILYAS Sembiring, Rinawati Sihaloho, Serli Sitarina Widyarini Siti Athiyah Umaiyah Siti Fatimah Sultan Sudibyo Martono Sudibyo Martono Sugiyanto - Sugiyanto . Sugiyanto . Sugiyanto Sugiyanto Sugiyanto Sugiyanto Sultan, Siti Fatimah Sunarti Sunarti Suwidjiyo Pramono Suwidjiyo Pramono SW, Oman Fathurohman Uddin, ABM Helal Verda Farida Wahyu Widyaningsih Wahyu Widyaningsih Wahyu Widyaningsih Wahyu Widyaningsih Wahyuningtyas, Nurma Widi Astuti, Silvia Ferry WULANDARI Yamin Yulianti, Rista Yuny Erwanto Yuny Erwanto Zahra Alya Putri