Claim Missing Document
Check
Articles

Found 33 Documents
Search

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL Puspitaningrum, Rini; Amelia, Ria; Adisyahputra, Adisyahputra
Bioma Vol. 13 No. 1 (2017): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.512 KB) | DOI: 10.21009/Bioma13(1).4

Abstract

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.
Prevalence of Human Immunodeficiency Virus (HIV) Antibody Detection in Men Who Have Sex with Men (MSM): Prevalensi Deteksi Antibodi Human Immunodeficiency Virus (HIV) Pada Kelompok Lelaki Seks Lelaki (LSL) Haq, Fhasya Algina Hawatul; Amelia, Ria; Sari, Elfira Maya; Luhulima, Danny Ernest Jonas
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 7 No. 2 (2024): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v7i2.1764

Abstract

Human Immunodeficiency Virus (HIV) infection is one of the infectious infections caused by HIV that attacks the lymphocytes T tipe CD4 and can cause a decrease in the immune system. Male Sex Men (MSM) have a higher risk of HIV infection due to MSM behavior, such as having direct anal sex without using condoms or lubricant products and are more likely to change sex partners frequently. This study aims to find out the results of rapid testing of HIV antibodies on MSM in Rawalumbu and Jaka Mulya urban village. This research uses cross sectional research design, its type of research is descriptive with selection and data collection purposively sampling that carried out in February – June 2024 in Rawalumbu and Jaka Mulya urban village. Thirty-five respondents were collected. The result from a rapid test of early HIV antibodies with rapid Reagen 1 (R1) in 35 respondents, 6 respondents (17%) were reactive and 29 respondents (83%) were non-reactive. HIV antibody reactive results is 6 respondents (17%) of total 35 respondents, the most reactive outcomes in the age category 26 – 36 years.
Formulation of solution to prevent lysis time erythrocyte and detecting blood type Amelia, Ria; Sari, Elfira Maya
MEDISAINS Vol 22, No 3 (2024)
Publisher : Universitas Muhammadiyah Purwokerto

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30595/medisains.v22i3.24587

Abstract

Background: In the examination of blood type using the tube method, a test cell containing 5% erythrocytes of the solution volume is required. The blood type test using the tube method is carried out in hospital blood banks and in the educational world during practical activities. The obstacle in making a 5% erythrocyte solution is that erythrocytes are lysed so that it is made every day. In addition, making a 5% erythrocyte solution takes a long time so it is not efficient. Purpose: This study aims to find a solution that can maintain erythrocytes for a long time and detecting blood type.Method: This experimental study involved the preparation of 120 tubes containing 5% erythrocyte suspensions from blood types A, B, AB, and O. The samples were diluted in 10 different test solutions, including CPD, ACD, EDTA 5%, Heparin 3%, NaCl 0.9% + glucose (0.025%, 0.05%, 0.1%, 0.2%, and 0.3%), and NaCl 0.9% Daily lysis observations were performed using vortex mixing, centrifugation, and color assessment. The solution with the most extended stability was further tested for ABO blood grouping using the tube method to analyze agglutination patterns.Results: The test solution that can maintain erythrocytes for a long time is the citrate phosphate dextrose (CPD) solution. This solution can prevent erythrocytes for a long time and does not damage erythrocyte antigens. It can also detect blood types well, making blood type examination time more efficient.Conclusion: CPD solution successfully prevents erythrocyte lysis for a longer time compared to other solutions and functions in detecting blood type antibodies.
Formulation and Physical Characterization of Black Soybean (Glycine Max L.) Variety of Detam II Tablets with Dry Granulation Method Amelia, Ria; Beandrade, Maya Uzia; Hasmar, Wahyu Nuraini
International Journal of Natural Science and Engineering Vol. 5 No. 1 (2021): April
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (227.182 KB) | DOI: 10.23887/ijnse.v5i1.33441

Abstract

Tingginya kandungan protein pada kedelai berbanding lurus dengan kadar senyawa flavonoid. Formulasi pembuatan tablet dari bubuk kedelai hitam Detam II sulit ditentukan karena kandungannya yang membuat sulit untuk mendapatkan kekerasan tablet yang optimal. Penelitian ini bertujuan untuk mendapatkan formulasi tablet kedelai hitam varietas detam II. Penelitian dilaksanakan pada bulan Februari sampai Oktober 2020 di Laboratorium Teknologi Farmasi STIKes Mitra Keluarga. Pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II dengan metode slugging. Tablet kedelai hitam Detam II (Glycine max L.) dibuat menjadi 5 formula dengan kandungan 250 mg bubuk kedelai hitam (Glycine max L.) varietas detam II pada setiap formula. Variabel yang membedakan adalah senyawa eksipien tablet pada masing-masing formula yaitu PVP K30, gelatin, dan amilum maydis sebagai bahan pengisi-pengikat. Kami menggunakan tipe eksperimen trial and error untuk membuat setiap formula. Evaluasi granul tablet kedelai hitam (Glycine max L.) varietas detam II dengan pengujian kadar air, kompresibilitas, waktu alir, sudut istirahat dan evaluasi tablet dengan pengujian organoleptik, berat, kekerasan, kerapuhan dan waktu hancur. Hasil penelitian menunjukkan bahwa formula 3, 4 dan 5 merupakan formulasi yang direkomendasikan untuk pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II meskipun semua formula ( F1-F5) berada di bawah persyaratan nilai kerapuhan karena beberapa faktor. . Eksipien gelatin dan PVP K30 untuk pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II merupakan pilihan terbaik sebagai pengisi-pengikat tablet.
Leucocyte Value as a Signs of Microvascular Inflammation in Type 2 Diabetes Mellitus Patients Amelia, Ria; Aulia, Fadila; Luhulima, Danny
International Journal of Natural Science and Engineering Vol. 7 No. 2 (2023): Juli
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23887/ijnse.v7i2.62440

Abstract

Problems in the pathogenesis of Type 2 Diabetes Mellitus (T2DM) to complications are often overlooked, and routine blood tests are rarely performed in individuals with T2DM. Inflammation is an important early sign for detecting complications. One of the factors that can be used as an indicator of inflammation is the value of leukocytes. The purpose of this study was to assess leukocyte counts in patients with T2DM as a sign of inflammation in T2DM patients. This study used a cross-sectional approach method, with data analyzed descriptively and correlative using SPSS software. The subjects of the study involved residents assisted by the Kota Baru and Kalibaru Health Centers who suffered from DMT2 in the period from January to February 2019. The results of the Pearson test showed a value of p = 0.49, which indicated that there was no significant relationship between leucocytosis and blood glucose levels. The conclusion of this study is that the high number of leukocytes in T2DM patients is thought not to be caused by high blood glucose levels, but may be influenced by other factors related to the development of complications of T2DM disease. This research has important implications in understanding the pathogenesis and prevention of complications of T2DM.
Frekuensi Konsumsi Pangan Sumber Zat Besi Serta Pangan Pendukung dan Penghambat Penyerapannya pada Remaja Putri Nurhidayati, Vieta Annisa; Khomsan, Ali; Riyadi, Hadi; Prasetya, Guntari; Rizkiriani, Annisa; Amelia, Ria
Pontianak Nutrition Journal (PNJ) Vol 8, No 1 (2025): MARET 2025
Publisher : Poltekkes Kemenkes Pontianak

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30602/pnj.v8i1.1792

Abstract

Anemia defisiensi besi pada remaja putri berdampak pada kualitas hidup dan kesehatan reproduksi. Penelitian ini menganalisis frekuensi konsumsi pangan sumber, pendukung, dan penghambat zat besi dan kaitannya dengan kadar hemoglobin pada 120 siswi kelas 11 di Cianjur. Data dikumpulkan melalui food frequency questionnaire dan finger prick blood test, lalu dianalisis dengan uji t dan korelasi Spearman. Hasil menunjukkan 23,5% responden mengalami anemia. Ayam dan telur menjadi sumber zat besi hewani utama, serta kangkung dan bayam sebagai sumber nabati. Konsumsi pangan pendukung penyerapan zat besi masih rendah, sementara teh dan kopi yang menghambat penyerapan zat besi cukup sering dikonsumsi. Tidak ditemukan korelasi signifikan antara pola konsumsi dan kadar hemoglobin, kecuali pada jambu biji. Perbedaan antara kelompok dengan anemia dan kelompok dengan kadar hemoglobin normal tidak berbeda secara signifikan, tetapi kelompok kadar hemoglobin normal cenderung memiliki pola makan lebih baik. Diperlukan strategi peningkatan konsumsi zat besi heme dan edukasi pola makan yang mendukung penyerapan zat besi.
Pengaruh Ekstrak Daun Pepaya (Carica papaya L.) dengan Berbagai Jenis Pelarut terhadap Pertumbuhan Escherichia coli (Literature Review) Raudah, Siti; Mawardani, Maya Tamara; Amelia, Ria
Jurnal Teknologi Laboratorium Medik Borneo Vol. 4 No. 1 (2024): Jurnal Teknologi Laboratorium Medik Borneo
Publisher : Institut Teknologi Kesehatan dan Sains Wiyata Husada Samarinda

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35728/jutelmo.v4i1.1519

Abstract

Background: Papaya leaf (Carica papaya L.) can be used as an antimicrobial. Phytochemical analysis proves papaya leaves contain antimicrobial compounds, including flavonoids, tannins, alkaloids, steroids, and saponins. In this study, the bacteria used were Escherichia coli, and the extraction process used several types of solvents, namely ethanol, methanol, water, and ethyl acetate. Purpose: This study aimed to determine the growth of Escherichia coli. Method: Literature review. The search started from January 13, 2021, to June 15, 2021, through electronic-based searches, including the Garuda Portal, Google Scholar, Research Gate, and Science Direct. Result: The obtained results were that all types of solvents have inhibition zones on the growth of Escherichia coli, where solvents of ethanol, methanol, water, and ethyl acetate had the highest inhibition zone respectively, namely 18,6 mm, 20 mm, 12 mm, and 12 mm. Conclusion: Papaya leaf extract using various types of solvents has effectiveness in inhibiting the growth of Escherichia coli
The Effect of Various Photoperiodic Conditions and Zn2+ Concentrations on Growth Rate and Metabolite Content in Euglena sp: Effect of Photoperiod and Zn2+ on Euglena sp. Eko Agus Suyono; Budiman, Arief; Siti Ferniah, Rejeki; Astiti, Adam; Mardyansah, Deviko; Natalia, Fitri; Cindiati, Maya; Qonita Maghfiroh, Khusnul; Erfianti, Tia; Nurafifah, Istini; Amelia, Ria; Kurnianto, Dedy; Ryan Sadewo, Brilian; Maggandari, Revata
Journal of Tropical Life Science Vol. 14 No. 2 (2024)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/jtls.14.02.04

Abstract

The application of Euglena as a carbon capture organism has generated considerable interest among scientists. Through the photosynthesis process, many kinds of metabolites are produced by Euglena, such as lipids, proteins, and pigments. Due to the metabolites produced by Euglena, it is vital to optimize the carbon capture ability and cell growth rate by adding Zn2+ content and giving photoperiodic into Euglena culture. The purpose of this study is to identify the optimal photoperiod and Zn2+ concentration to increase the growth rate, biomass, and metabolite content of Euglena sp. This study is a laboratory experiment involving the cultivation of Euglena sp. in various photoperiod cycles (light:dark), namely 24:0, 12:12, 14:10, and 16:8. In addition, Euglena sp. was also cultivated using different concentrations of Zn2+ (0 ppm, 5 ppm, 10 ppm, and 15 ppm). The growth of Euglena sp. was monitored for 18 days before being harvested every three days to measure the research parameters, including primary and secondary metabolites. The results showed that the photoperiod treatment and various concentrations of Zn2+ had a significant impact (P<0.05) on the growth rate, biomass, lipid, carbohydrate, protein, chlorophyll, and carotenoid levels of Euglena sp.  
TRANSFORMASI EPISTEMOLOGI PENDIDIKAN AGAMA ISLAM Amelia, Ria; Nasir, Mohd
Tarbawi: Jurnal Pendidikan dan Pemikiran Islam Vol 8 No 2 (2025): Tarbawi
Publisher : STAI BINAMADANI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51476/tarbawi.v8i2.812

Abstract

Ilmu pengetahuan senantiasa mengalami perubahan untuk dapat mengikuti perkembangan zaman dalam kehidupan manusia. Epistemologi pendidikan agama Islam tidak hanya bertransformasi dalam aspek pembelajaran agama di sekolah, tetapi juga dalam kehidupan sehari-hari umat Islam. Transformasi epistemologi menyangkut perubahan sumber ilmu pengetahuan, perubahan metode perolehan ilmu pengetahuan, perubahan proses pembelajaran dan perubahan validasi pengetahuan seperti perubahan cara mengevaluasi ilmu pengetahuan yang telah kita peroleh. Transformasi epistemologi pendidikan agama Islam menyangkut perubahan sumber ilmu pengetahuan, metode perolehan ilmu pengetahuan dan proses evaluasi pendidikan agama Islam. Perubahan sumber ilmu pengetahuan dari sumber tertulis menjadi media digital, sumber yang bersifat kontekstual dan terintegrasi dengan ilmu pengetahuan lainnya. Perubahan metode perolehan ilmu pengetahuan tidak hanya dari pembelajaran ceramah oleh guru tetapi melalui berpikir kritis, pembelajaran berbasis proyek dan pembelajaran kolaboratif. Evaluasi ilmu pengetahuan tidak lagi hanya melalui tes tertulis tetapi melalui pendekatan reflektif, penilaian autentik dan portofolio
Determination of Blood Lead Levels in Drivers at Marunda Terminal, North Jakarta, Using ICP-MS Utama, Aditiya Tri; Sari, Elfira Maya; Amelia, Ria
Indonesian Journal of Science and Pharmacy Vol. 3 No. 1 (2025): Indonesian Journal of Science and Pharmacy
Publisher : Pustaka Media Publishing

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.63763/ijsp.v3i1.104

Abstract

One of the elements that has the biggest impact of air pollution is lead. Lead can be contaminated through the air, one of which is produced by burning vehicles and releasing lead oxide in the form of dust or particles that can be inhaled into the human respiratory tract. The duration of lead exposure affects air pollution which can harm human health. The aim of this research was to determine blood lead levels in truck drivers in a section of Marunda terminal North Jakarta using the ICP-MS method. ICP-MS has multi-element analysis capabilities and high sensitivity compared to other techniques. This type of research is quantitative descriptive with a cross-sectional research design and data collection using purposive sampling, data collection was carried out in June 2023. Lead examination was carried out at the DKI Jakarta Regional Health Laboratory. The type of specimen used is human blood. Blood samples were collected using an EDTA tube and then measured using an ICP-MS device. The results showed that 17 respondents had lead levels < 2.28 µg/L. Blood lead levels in truck drivers in a section of Marunda terminal North Jakarta were not detected. This shows that there is no lead content in the blood.
Co-Authors Adisyahputra Adisyahputra, Adisyahputra Ali Khomsan Andhika Puspito Nugroho Ardiansyah, Irfani Ryan Arief Budiman Assha Luthfianie Alifah Astiti, Adam Aulia, Fadila Azizah, Nadya Rizky Baedah, Jaeny Nur Beandrade, Maya Uzia Chandra Vina Dwi Astuti Cindiati, Maya Danny Ernest Jonas Luhulima Danny Luhulima Danny Luhulima Devi Anggraini, Irika Eko Agus Suyono Eko Agus Suyono Elfira Maya Sari Eni Subiastutik Erfianti, Tia Eric Meijer Erida Manalu Ernest Jonas Luhulima2, Danny Fachniadin, Ande Fernando, Frendi Fitri Natalia Fitri Octaviana Hadi Riyadi Haq, Fhasya Algina Hawatul Hasmar, Wahyu Nuraini Hidayat, Mohamad Syarif Hilda, Nurul Ilsan, Noor Andryan Inggraini, Maulin Intan Kurniawati P Intan Kurniawati Pramitaningrum Islamiyah Nurul Fitri Karillanata, Khalid Erlangga Keisya Nur Raudhah Kurnianto, Dedy Kurniawan, Azhar Farisyabdi Lia, Ceci Luhulima, Danny Luhulima, Danny Luhulima, Danny Ernest Jonas Luthfiana, Dwi Hardianti Luthfianie Alifah , Assha Maggandari, Revata Maghfiroh, Khusnul Qonita Mardyansah, Deviko Marno, Septhian Maulana, Sofyan Maulin Inggraini Maulin Inggriani Maulin Inggriani Mawardani, Maya Tamara Maya Uzia Beandrade Mohamad Saekhu Moudy Ramadhanti Mu'ajizin, Mohamad Kholis Nabila, Annisa Alivia Nasir, Mohd Neni Arshita Neni Arshita Noor Adrya Ilsan Nugroho, Setyo Widi Nurafifah, Istini Nurhidayati, Vieta Annisa Nurul Hida, Aulia Setyo Pramudya, Hermawan Pranoto, Yulianti Prasetya, Guntari Prayogi, Saiful Putri, Renata Adaranyssa Egistha Qonita Maghfiroh, Khusnul Rahsanindya, Hartika Esti Ramadhanti, Moudy Renindra Ananda Aman Reza Anindita Ricky Rusydi Satriawan Rini Puspitaningrum Rizkiriani, Annisa Ryan Sadewo, Brilian Salsabila, Alfi Santoso, Fabianto Siti Ferniah, Rejeki siti mudrikah Siti Nur Fajriah Siti Nurfajriah Siti Nurfajriah Siti Raudah Sofia Maharani Sugijati Sugijati Sukroyanti, Baiq Azmi Suyono, Dr. Eko Agus Suyono, Eko Agus Agus Syaiful Ichwan Tri Soetowo Urohmah, Annisa Utama, Aditiya Tri Widi Nugroho, Setyo Wimbrayardi Wimbrayardi Wulandari, Ismia Yundari, Yundari