Claim Missing Document
Check
Articles

Found 35 Documents
Search

GAMBARAN KADAR HEMOGLOBIN PADA PEROKOK AKTIF DI TERMINAL KAYURINGIN KOTA BEKASI Moudy Ramadhanti; Ria Amelia; Danny Luhulima
Jurnal Mitra Kesehatan Vol. 2 No. 1 (2019): Jurnal Mitra Kesehatan
Publisher : STIKes Mitra Keluarga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47522/jmk.v2i1.30

Abstract

Pendahuluan: Perilaku merokok berdampak yang buruk terhadap kesehatan. Salah satu zat berbahaya dalam asap rokok yaitu karbon monoksida. Karbon monoksida yang sangat mudah berikatan dengan hemoglobin dibandingkan dengan oksigen maupun karbondioksida. Ikatan karbon monoksida dengan hemoglobin dapat beresiko terjadinya kondisi hipoksia. Jika kondisi ini dibiarkan maka dapat menyebabkan kematian sel. Penelitian ini dilakukan untuk melihat gambaran kadar hemoglobin pada perokok aktif di Terminal Kayuringin Kota Bekasi. Metode: Jenis penelitian yang dilakukan adalah penelitian deskriptif dengan menggunakan desain penelitian cross sectional. Jumlah responden sebanyak 31 perokok aktif yang diperoleh melalui wawancara dan kadar hemoglobin diperiksa dengan menggunakan alat hematology analyzer ABX Micros 60. Hasil: Hasil penelitian kadar hemoglobin pada 31 responden perokok aktif diperoleh nilai rata-rata sebesar 14,5 g/dL, dengan standar deviasi 1,0942 g/dL, nilai tertinggi 16,9 g/dL dan nilai terendah 12,3 g/dL. Kesimpulan: Berdasarkan hasil tersebut dapat disimpulkan bahwa kadar hemoglobin pada 31 responden perokok aktif masih dalam kadar normal. Kadar hemoglobin normal pada perokok aktif diduga sebagai respon tubuh untuk memenuhi oksigen dan menjaga homeostatis agar metabolisme tubuh berjalan normal.
Cross-Reaction Antibody Test between SARS-CoV-2 and Dengue Hemorrhagic Fever in Indonesia Danny Luhulima; Tri Soetowo; Ria Amelia
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol. 27 No. 2 (2021)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v27i2.1681

Abstract

Coronaviruses are a family of viruses that cause illness from the common cold to severe diseases such as Severe Acute Respiratory Syndrome (SARS-CoV). In December 2019, forty new cases of pneumonia of unknown etiology have been reported in Wuhan, China. The disease resembles Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and has been subsequently named the 2019-novel Coronavirus Disease (COVID-19). The antibody test is a blood test that provides quantitative and qualitative detection of IgG and IgM antibodies against the SARS-CoV-2. Reported a male, 43-year oldsuffering from DHF, but the results of an IgG and IgM rapid test were COVID-19 reactive. Also, reviewed rapid tests for COVID-19 and the results showed that only IgG was reactive. This explained that the patient already had SARS Cov-2 antibodies but was not suffering from the disease. The rapid test COVID-19 IgM result was deemed to be a false positive.
Increasing Public Awareness Related To Early Detection Of Diabetes Mellitus In Jatimekar Bekasi Village Maulin inggraini; Noor Andryan Ilsan; Siti Nurfajriah; Ria Amelia; Elfira Maya Sari
Jurnal Masyarakat Religius dan Berwawasan Vol 2, No 1 (2023): Masyarakat Religius dan Berwawasan
Publisher : Universitas Islam Negeri Mahmud Yunus Batusangkar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31958/mrw.v2i1.8703

Abstract

Noncommunicable Diseases (NCDs) are a serious threat not only for the elderly but also for the young. Based on a report from the International Diabetes Federation (IDF) by 2022 that 1.57 million of the 8.75 million people living with type 1 diabetes worldwide in 2022 are less than 20 years old. This shows the importance of increasing public awareness about Diabetes Mellitus (DM). This PKM is carried out by providing education about the prevention and dangers of DM, then followed by a Temporary Blood Sugar (TBS) examination in the Jatimekar Bekasi village using brochure media. The increas in participants’s knowledge was carried out by analyzing the pre-test and post-test descriptively. The results of the study showed an increase in public knowledge about DM. this can be seen from the increase in post-test result compared to pre-test scores. GDS examination results include risk characteristics of 86.96% (110-200 mg/dL) and DM 13.04 % (>200 mg/dL). There are 3 counseling participants who suffer from DM and have a history of unhealthy eating patterns and not doing physical activity.
EDUKASI DAN PELATIHAN PEMERIKSAAN INFEKSI SALURAN KEMIH (ISK) PADA SISWA SMK TEKNOLOGI LABORATORIUM MEDIS (TLM) DI KOTA BEKASI Reza Anindita; Siti Nurfajriah; Ria Amelia; Noor Andryan Ilsan; Maulin Inggraini; Elfira Maya Sari
Jurnal Abdi Insani Vol 10 No 4 (2023): Jurnal Abdi Insani
Publisher : Universitas Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/abdiinsani.v10i4.1180

Abstract

Urinary Tract Infection (UTI) is an infectious disease caused by bacterial colonization in the urinary tract. The bacteria most commonly found in UTI patients is E. coli. UTI is more common in women (79%) than men (21%) aged 17-35 years. The problem of UTIs causes an increase in morbidity (illness) rates, thereby increasing medical costs. Therefore, early prevention efforts are needed, one of which is through education and the introduction of UTI examinations through Community Service (PKM) activities for secondary school students. The aim of this PKM is to provide simple education and training regarding UTI examination for vocational school students majoring in TLM in Bekasi City. This PKM also provides students with experience in carrying out UTI examinations in the laboratory. This activity was carried out at the family partner STIKES with a total of 43 students majoring in TLM vocational schools. This activity stage includes planning, implementation and evaluation. Data analysis was carried out using descriptive and comparative tests for 2 samples using a paired t-test. The results of this activity showed that there were 37 (86.04%) female participants while there were 6 (13.95%) male participants. The average pre-test score was 3.48 while the post-test was 8.76 or an increase of 15.17%. The results of the paired t-test showed a significant difference between the pre-test and post-test with a significance value of (0.306<0.05). The conclusion of this PKM is that an evaluation using test instruments (pre test and post test) in the form of 10 multiple choice questions was able to significantly increase knowledge about UTI for 43 students of the TLM Department of Health Vocational Schools in Bekasi City.
FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL Puspitaningrum, Rini; Amelia, Ria; Adisyahputra, Adisyahputra
Bioma Vol. 13 No. 1 (2017): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.512 KB) | DOI: 10.21009/Bioma13(1).4

Abstract

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.
Prevalence of Human Immunodeficiency Virus (HIV) Antibody Detection in Men Who Have Sex with Men (MSM): Prevalensi Deteksi Antibodi Human Immunodeficiency Virus (HIV) Pada Kelompok Lelaki Seks Lelaki (LSL) Haq, Fhasya Algina Hawatul; Amelia, Ria; Sari, Elfira Maya; Luhulima, Danny Ernest Jonas
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 7 No. 2 (2024): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v7i2.1764

Abstract

Human Immunodeficiency Virus (HIV) infection is one of the infectious infections caused by HIV that attacks the lymphocytes T tipe CD4 and can cause a decrease in the immune system. Male Sex Men (MSM) have a higher risk of HIV infection due to MSM behavior, such as having direct anal sex without using condoms or lubricant products and are more likely to change sex partners frequently. This study aims to find out the results of rapid testing of HIV antibodies on MSM in Rawalumbu and Jaka Mulya urban village. This research uses cross sectional research design, its type of research is descriptive with selection and data collection purposively sampling that carried out in February – June 2024 in Rawalumbu and Jaka Mulya urban village. Thirty-five respondents were collected. The result from a rapid test of early HIV antibodies with rapid Reagen 1 (R1) in 35 respondents, 6 respondents (17%) were reactive and 29 respondents (83%) were non-reactive. HIV antibody reactive results is 6 respondents (17%) of total 35 respondents, the most reactive outcomes in the age category 26 – 36 years.
Formulation of solution to prevent lysis time erythrocyte and detecting blood type Amelia, Ria; Sari, Elfira Maya
MEDISAINS Vol 22, No 3 (2024)
Publisher : Universitas Muhammadiyah Purwokerto

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30595/medisains.v22i3.24587

Abstract

Background: In the examination of blood type using the tube method, a test cell containing 5% erythrocytes of the solution volume is required. The blood type test using the tube method is carried out in hospital blood banks and in the educational world during practical activities. The obstacle in making a 5% erythrocyte solution is that erythrocytes are lysed so that it is made every day. In addition, making a 5% erythrocyte solution takes a long time so it is not efficient. Purpose: This study aims to find a solution that can maintain erythrocytes for a long time and detecting blood type.Method: This experimental study involved the preparation of 120 tubes containing 5% erythrocyte suspensions from blood types A, B, AB, and O. The samples were diluted in 10 different test solutions, including CPD, ACD, EDTA 5%, Heparin 3%, NaCl 0.9% + glucose (0.025%, 0.05%, 0.1%, 0.2%, and 0.3%), and NaCl 0.9% Daily lysis observations were performed using vortex mixing, centrifugation, and color assessment. The solution with the most extended stability was further tested for ABO blood grouping using the tube method to analyze agglutination patterns.Results: The test solution that can maintain erythrocytes for a long time is the citrate phosphate dextrose (CPD) solution. This solution can prevent erythrocytes for a long time and does not damage erythrocyte antigens. It can also detect blood types well, making blood type examination time more efficient.Conclusion: CPD solution successfully prevents erythrocyte lysis for a longer time compared to other solutions and functions in detecting blood type antibodies.
Formulation and Physical Characterization of Black Soybean (Glycine Max L.) Variety of Detam II Tablets with Dry Granulation Method Amelia, Ria; Beandrade, Maya Uzia; Hasmar, Wahyu Nuraini
International Journal of Natural Science and Engineering Vol. 5 No. 1 (2021): April
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (227.182 KB) | DOI: 10.23887/ijnse.v5i1.33441

Abstract

Tingginya kandungan protein pada kedelai berbanding lurus dengan kadar senyawa flavonoid. Formulasi pembuatan tablet dari bubuk kedelai hitam Detam II sulit ditentukan karena kandungannya yang membuat sulit untuk mendapatkan kekerasan tablet yang optimal. Penelitian ini bertujuan untuk mendapatkan formulasi tablet kedelai hitam varietas detam II. Penelitian dilaksanakan pada bulan Februari sampai Oktober 2020 di Laboratorium Teknologi Farmasi STIKes Mitra Keluarga. Pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II dengan metode slugging. Tablet kedelai hitam Detam II (Glycine max L.) dibuat menjadi 5 formula dengan kandungan 250 mg bubuk kedelai hitam (Glycine max L.) varietas detam II pada setiap formula. Variabel yang membedakan adalah senyawa eksipien tablet pada masing-masing formula yaitu PVP K30, gelatin, dan amilum maydis sebagai bahan pengisi-pengikat. Kami menggunakan tipe eksperimen trial and error untuk membuat setiap formula. Evaluasi granul tablet kedelai hitam (Glycine max L.) varietas detam II dengan pengujian kadar air, kompresibilitas, waktu alir, sudut istirahat dan evaluasi tablet dengan pengujian organoleptik, berat, kekerasan, kerapuhan dan waktu hancur. Hasil penelitian menunjukkan bahwa formula 3, 4 dan 5 merupakan formulasi yang direkomendasikan untuk pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II meskipun semua formula ( F1-F5) berada di bawah persyaratan nilai kerapuhan karena beberapa faktor. . Eksipien gelatin dan PVP K30 untuk pembuatan tablet kedelai hitam (Glycine max L.) varietas detam II merupakan pilihan terbaik sebagai pengisi-pengikat tablet.
Leucocyte Value as a Signs of Microvascular Inflammation in Type 2 Diabetes Mellitus Patients Amelia, Ria; Aulia, Fadila; Luhulima, Danny
International Journal of Natural Science and Engineering Vol. 7 No. 2 (2023): Juli
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23887/ijnse.v7i2.62440

Abstract

Problems in the pathogenesis of Type 2 Diabetes Mellitus (T2DM) to complications are often overlooked, and routine blood tests are rarely performed in individuals with T2DM. Inflammation is an important early sign for detecting complications. One of the factors that can be used as an indicator of inflammation is the value of leukocytes. The purpose of this study was to assess leukocyte counts in patients with T2DM as a sign of inflammation in T2DM patients. This study used a cross-sectional approach method, with data analyzed descriptively and correlative using SPSS software. The subjects of the study involved residents assisted by the Kota Baru and Kalibaru Health Centers who suffered from DMT2 in the period from January to February 2019. The results of the Pearson test showed a value of p = 0.49, which indicated that there was no significant relationship between leucocytosis and blood glucose levels. The conclusion of this study is that the high number of leukocytes in T2DM patients is thought not to be caused by high blood glucose levels, but may be influenced by other factors related to the development of complications of T2DM disease. This research has important implications in understanding the pathogenesis and prevention of complications of T2DM.
Frekuensi Konsumsi Pangan Sumber Zat Besi Serta Pangan Pendukung dan Penghambat Penyerapannya pada Remaja Putri Nurhidayati, Vieta Annisa; Khomsan, Ali; Riyadi, Hadi; Prasetya, Guntari; Rizkiriani, Annisa; Amelia, Ria
Pontianak Nutrition Journal (PNJ) Vol 8, No 1 (2025): MARET 2025
Publisher : Poltekkes Kemenkes Pontianak

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30602/pnj.v8i1.1792

Abstract

Anemia defisiensi besi pada remaja putri berdampak pada kualitas hidup dan kesehatan reproduksi. Penelitian ini menganalisis frekuensi konsumsi pangan sumber, pendukung, dan penghambat zat besi dan kaitannya dengan kadar hemoglobin pada 120 siswi kelas 11 di Cianjur. Data dikumpulkan melalui food frequency questionnaire dan finger prick blood test, lalu dianalisis dengan uji t dan korelasi Spearman. Hasil menunjukkan 23,5% responden mengalami anemia. Ayam dan telur menjadi sumber zat besi hewani utama, serta kangkung dan bayam sebagai sumber nabati. Konsumsi pangan pendukung penyerapan zat besi masih rendah, sementara teh dan kopi yang menghambat penyerapan zat besi cukup sering dikonsumsi. Tidak ditemukan korelasi signifikan antara pola konsumsi dan kadar hemoglobin, kecuali pada jambu biji. Perbedaan antara kelompok dengan anemia dan kelompok dengan kadar hemoglobin normal tidak berbeda secara signifikan, tetapi kelompok kadar hemoglobin normal cenderung memiliki pola makan lebih baik. Diperlukan strategi peningkatan konsumsi zat besi heme dan edukasi pola makan yang mendukung penyerapan zat besi.
Co-Authors Adisyahputra Adisyahputra, Adisyahputra Ali Khomsan Aman, Renindra Ananda Amrurobbi, Azka Abdi Andhika Puspito Nugroho Ardiansyah, Irfani Ryan Arief Budiman Astiti, Adam Aulia, Fadila Azizah, Nadya Rizky Baedah, Jaeny Nur Beandrade, Maya Uzia Chandra Vina Dwi Astuti Cindiati, Maya Danny Luhulima Danny Luhulima Devi Anggraini, Irika Eko Agus Suyono Eko Agus Suyono Elfira Maya Sari Eni Subiastutik Erfianti, Tia Fachniadin, Ande Fernando, Frendi Fitri Natalia Fitri Octaviana Hadi Riyadi Haq, Fhasya Algina Hawatul Hasmar, Wahyu Nuraini Hidayat, Mohamad Syarif Hilda, Nurul Ilsan, Noor Andryan Inggraini, Maulin Intan Kurniawati P Intan Kurniawati Pramitaningrum Islamiyah Nurul Fitri Karilanata, Khalid Erlangga Karillanata, Khalid Erlangga Kurnianto, Dedy Kurniawan, Azhar Farisyabdi Larasati, Ersi Lia, Ceci Luhulima, Danny Luhulima, Danny Luhulima, Danny Ernest Jonas Luthfiana, Dwi Hardianti Maggandari, Revata Maghfiroh, Khusnul Qonita Manalu, Erida Mardyansah, Deviko Marno, Septhian Maulana, Sofyan Maulin Inggraini Maulin Inggriani Maulin Inggriani Mawardani, Maya Tamara Maya Uzia Beandrade Meijer, Eric Mohamad Saekhu Moudy Ramadhanti Mu'ajizin, Mohamad Kholis Nabila, Annisa Alivia Nasir, Mohd Neni Arshita Neni Arshita Noor Adrya Ilsan Nugroho, Setyo Widi Nurafifah, Istini Nurhidayati, Vieta Annisa Nurul Hida, Aulia Setyo Pramudya, Hermawan Prasetya, Guntari Prayogi, Saiful Putri, Renata Adaranyssa Egistha Qonita Maghfiroh, Khusnul Rahsanindya, Hartika Esti Ramadhanti, Moudy Reza Anindita Ricky Rusydi Satriawan Rini Puspitaningrum Rizkiriani, Annisa Ryan Sadewo, Brilian Salsabila, Alfi Santoso, Fabianto Siti Ferniah, Rejeki siti mudrikah Siti Nur Fajriah Siti Nurfajriah Siti Nurfajriah Siti Raudah Sofia Maharani Sugijati Sugijati Sukroyanti, Baiq Azmi Suyono, Dr. Eko Agus Suyono, Eko Agus Agus Syaiful Ichwan Tri Soetowo Urohmah, Annisa Utama, Aditiya Tri Widi Nugroho, Setyo Wimbrayardi Wimbrayardi Wulandari, Ismia Yeby Ma’asan Mayrudin Yundari, Yundari