Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

2.949

P-Index

This Author published in this journals

All Journal Journal of Food and Pharmaceutical Science Jurnal Sain Veteriner Buletin Peternakan Jurnal Ilmu Ternak Jurnal Ilmu dan Teknologi Hasil Ternak AL KAUNIYAH Pharmaciana: Jurnal Kefarmasian Jurnal Ilmu dan Industri Peternakan Jurnal Sain Peternakan Indonesia Jurnal Ilmu Ternak Veteriner Majalah Kulit, Karet, dan Plastik agriTECH Jurnal Pengabdian Kepada Masyarakat (Indonesian Journal of Community Engagement) Livestock and Animal Research Jurnal Penelitian Pendidikan IPA (JPPIPA) Indonesian Journal of Chemistry Indonesian Food Science and TechnologyJournal Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Veterinary Sciences) Jurnal Hexagro ASIAN JOURNAL OF ISLAMIC MANAGEMENT (AJIM) Jurnal Sains dan Teknologi Peternakan Jurnal Triton Jurnal Teknologi Hasil Peternakan Journal of Halal Science and Research Journal of Food and Pharmaceutical Sciences

Yuny Erwanto

Animal Products Technology, Faculty Of Animal Science, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia

Author-ID : 260826

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Engineering Environmental Science Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Neuroscience Physics Social Sciences Veterinary Other

Published : 51 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3 4 5

The Potential of Hydrolysate from Rabbit Meat Protein as an Angiotensin Converting Enzyme Inhibitor Edy Permadi; Jamhari Jamhari; Edi Suryanto; Zaenal Bachruddin; Yuny Erwanto
Buletin Peternakan Vol 43, No 1 (2019): BULETIN PETERNAKAN VOL. 43 (1) FEBRUARY 2019
Publisher : Faculty of Animal Science, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21059/buletinpeternak.v43i1.31495

This research aimed to investigate the rabbit meat hydrolysate potential as an angiotensin-converting enzyme (ACE) inhibitor. Indonesian local rabbit meats were used in this study. The research was conducted in Department of Animal Product Technology, Faculty of Animal Science, Universitas Gadjah Mada, from August 2016 to February 2017. The local rabbit meats were hydrolyzed by pepsin, trypsin, and pancreatic. The obtained hydrolysates were then analyzed to identify the water-soluble protein content. The molecular weight of the hydrolysates were also confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The ACE inhibitory properties of the hydrolysates were analyzed in vitro. The results showed that pepsin, trypsin, and pancreatic hydrolysis showed a significant effect on the water-soluble protein content of rabbit meat (p<0.05). The water-soluble protein of rabbit meat hydrolysed by pepsin, trypsin, and pancreatic were 9.41, 7.66, and 9.75 mg/mL respectively. The molecular weight of the rabbit meat hydrolysate were increased from 10 to 43 kDa; 17 to 43 kDa; and 10 to 43 kDa, after hydrolysed by by pepsin, trypsin, and pancreatic respectively. Furthermore, the ACE inhibitory properties ) of the hydrolysed rabbit meat by pepsin, trypsin, and pancreatic were 439, 170, and 380 μg/mL, respectively. The rabbit meat hydrolysate showed a potential to be ACE inhibitor after hydrolyzed with pepsin, trypsin and pancreatic. Moreover, it also showed a promising potential to be used as bioactive components in different pharmaceutical applications. The highest ACE inhibitory capability was showed on trypsin hydrolysis with the total of 65.45% and 170 μg/mL ACE inhibition

Development of Prototype of Hard Capsule Shell Made from Goatskin Gelatin Using Simplex Lattice Design (SLD) as Optimization Method Muhammad Irfan Said; Yuny Erwanto; Achmad Fudholi; Effendi Abustam
Buletin Peternakan Vol 42, No 4 (2018): BULETIN PETERNAKAN VOL. 42 (4) NOVEMBER 2018
Publisher : Faculty of Animal Science, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21059/buletinpeternak.v42i4.32717

The objective of this study was to evaluate the application of the use optimization methods of Simplex Lattice Design (SLD) with special cubic models in the preparation formula of hard capsule based on goatskin gelatin. Three types of filler materials have been used in the manufacture of capsule shells, namely MgCO3, tapioca starch (TS) and sago starch (SS). The basic ingredient was uses goatskin gelatin and aquadest as a solvent. The material formulation was calculated according to Simplex Lattice Design (SLD) using the equations Y = β1 (A) + β2 (B) + β3(C) + β12 (A)(B) + β13 (A)(C) + β23 (B)(C) + β123 (A)(B) (C). Based on these equations obtained seven formulas (three proportions formula 100% each component, three proportional formulas 50%: 50% for the mixture of two components and one formula 33.33% for the mixture of three components). The results obtained data related to the proportion of filler use in a mixture of materials. The superimposed contour plot shows that the proportion of the use of three types of filler (MgCO3: TS: SS) in each mixture are (0.224 part: 0.055 part and 0.721 parts). Next, after further testing of the formula is then obtained properties of the capsule shell prototype, namely: thickness (0.35 mm), solubility (66.64%), and water vapor transmission rate (WVTR) (0.67 g.H2O.m-2 h-1). The data obtained that the type of SS filler is the most dominant factor influencing in increasing the thickness and solubility properties of the capsule shell, while the filler TS is the most dominant increase in the nature of WVTR. The results of the study concluded that the application of the SLD optimization method could be applied in the preparation of hard capsule formulations made from goatskin gelatin with better properties.

Effect of Bay Leaf Infusion on Microbiological, Chemical and Physical Quality of Chicken Meat Edi Suryanto; Yuny Erwanto; Sylvie Astuti
Buletin Peternakan Vol 44, No 3 (2020): BULETIN PETERNAKAN VOL. 44 (3) AUGUST 2020
Publisher : Faculty of Animal Science, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21059/buletinpeternak.v44i3.36507

Contamination that decreased chicken meat quality could be prevented using natural preservatives. Bay leaves (Syzygium polyanthum) contain volatile fatty acids, tannin, and flavonoid that possess bacteriological and fungicidal activity as well as preventing bacterial spore growth. The purpose of this study was to determine the effect of fresh bay leaf infusion on microbiological, chemical, and physical qualities of chicken meat. This study used bay leaves, water, chicken meat, eight strain of bacteria, chemicals and materials for the analysis of chicken meat. The experiment consisted of two steps, the first was the antibacterial properties of bay leaves and the second was the application of bay leaf infusion for chicken meat. Eight bacteria was used for the bacterial inhibition of bay leaf at the concentration of 0, 5, 10, 15 and 20%. The experiment on antibacterial properties of bay leaf (Syzygium polyanthum) used one way randomized design with five concentration treatments, while the application of bay leaf infusions on chicken meat using factorial completely randomized design 2x5 (2 types of soaking and 5 observation time). At the second step, chicken meat was divided into 2 groups, the first group was soaked in water only and the second group was soaked in 15% bay leaf infusion. They were then stored for 0 (control), 2, 4, 6, and 8 hours at the room temperature. Each treatment was repeated four times. The microbiological, chemical, physical qualities of chicken meat were observed. The results showed that bay leaf infusion had the ability to inhibit the growth of bacteria (P<0.05). The highest growth inhibition was found on Leuconostoc mesenteroides, whereas the lowest growth inhibition was on Pseudomonas putida. Bay leaf infusion influenced the number of bacteria in chicken meat. The concentration of 15% bay leaf infusion could decrease bacterial number amounting to 1 log CFU/mL compared to control. The number of bacteria of chicken meat stored significantly increased during the storage (P<0.05). However, the number of bacteria of chicken meat soaked in bay leaf infusion was significantly lower than the control. Bay leaf infusion has no significant effect on the chemical quality of chicken meat but it did on the physical quality of chicken meat. The conclusion of the study was bay leaf infusion could inhibit the bacterial growth and reduced the amount of bacteria in chicken meat, whereas storage time influenced the microbiological and physical qualities of chicken meat.

Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/ÂµL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The Â repeatability Â analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency Â value of Â 206 %. These figures confirm that the method employed Â in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

Penyuluhan dan Pendampingan Pengolahan Limbah Peternakan Sapi Potong di Kelompok Tani Ternak Sido Mulyo Dusun Pulosari, Desa Jumoyo, Kecamatan Salam, Kabupaten Magelang Nanung Agus Fitriyanto; Suharjono Triatmojo; Ambar Pertiwiningrum; Yuny Erwanto; Mohammad Zainal Abidin; Endang Baliarti; Yustina Yuni Suranindyah
Jurnal Pengabdian kepada Masyarakat (Indonesian Journal of Community Engagement) Vol 1, No 1 (2015): September
Publisher : Direktorat Pengabdian kepada Masyarakat Universitas Gadjah Mada

Society services activity on cattle waste management system have been implemented in Sido Mulyo Livestock Farmers Group at Pulosari, Jumoyo, Salam, Magelang. Animal byproducts that consist of feces and urine of cattle wastewas processed into organic fertilizer compost and liquid fertilizer. Sido Mulyo Livestock Farmer Group has one unit of 20 m3 biodigester to accommodate the feces from approximately 30 cattle owned by the group member. Biogas has been used as a fuel source for family group members located around the cage. Slurry resulted from anaerobic digestion of biodigester disposed to pastures located on the right side of the cage. Ownership system in the groupis every group member hasa responsibility for taking care of their own cattle. The number of livestock owned by each member of the SidoMulyoLivestock Farmers Group ranged between 1 to 4 cattle. Society services methods that have been implemented was in the form of mentoring for a member of the Sido Mulyogroup.The other activities that have been implemented was the training and development of cattle industry, especially the handling of livestock waste in the form of feces, urine, and the feed residue. The activities was continued by the manufacture of compost packaging design, followed by the last series of activities such as monitoring and program development. The enthusiasm of the group members in joining to the extension activities is very good. The timing of the extension are determined in the afternoon after members of the group have finished searching feed for their cattle. The sustainability forwaste processing into organic fertilizer compost and liquid organic fertilizer becomes a major concern, because it is highly dependent on consumer demand.

Komponen Bioaktif Dalam Daging dan Sifat Fungsionalnya: Sebuah Kajian Pustaka Khothibul Umam Al Awwaly; Suharjono Triatmojo; Yuny Erwanto; Wayan Tunas Artama
Jurnal Ilmu dan Teknologi Hasil Ternak (JITEK) Vol. 10 No. 1 (2015)
Publisher : Faculty of Animal Science Universitas Brawijaya

Consumer awareness in meat and meat products is generally recognized as a good source of food, with high biological value protein, B group vitamins, minerals and minor elements like several other bioactive compounds that are beneficial to the human body. But in many cases, a processing error is affecting the bioactive compounds of functional foods and consumer impression are relatively negative to some levels of substances in meat such as fat, cholesterol, saturated fatty acids, salt and other substances, which however also involves a diseases of western society such as cardiovascular diseases, respiratory, carcinogenesis, obesity, impaired immune system and accelerate the aging process. Hence there is a need for adequate information related to favorable nutritional value of meat that has not been widely disclosed. Bioactive components in the meat can be anserin, karnosin and bioactive peptides. The generation of bioactive components in the meat in the form of bioactive peptides can be done in three ways: (1) aging or storage of meat, (2) meat fermentation, and (3) the enzyme treatment. Functional properties of bioactive components in meat varies greatly as an antioxidant, antihypertensive, antimicrobial, anticancer and immunomodulatory.

Quality of Chicken Sausage Coated by Transglutaminase-Crosslinked Bovine Split Hide Gelatin and Soy Protein Isolate Edible Film During Chilled Storage Dwi Wulandari; Yuny Erwanto; Yudi Pranoto; Rusman Rusman; Sugiyanto Sugiyanto
Jurnal Ilmu dan Teknologi Hasil Ternak (JITEK) Vol. 15 No. 3 (2020)
Publisher : Faculty of Animal Science Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jitek.2020.015.03.2

This research aims to determine the physical properties and the bacterial counts of chicken sausages that were given an edible coating made from a combination of bovine split hide gelatin and soy protein isolate with the addition of the enzyme transglutaminase during chilled storage. The parameters observed included, pH, moisture, protein content, weight loss, tenderness, and the bacterial counts. Data were analyzed with a completely randomized design (CRD) factorial pattern 4 x 4 with three replications. The first factor was the level of edible coating 0%, 5%, 10%, and 15% Â w/vol. The s factor was the storage time at 10Â°C which was 0, 5, 10, and 15 d. The results showed the pH and moisture during storage decreased, while the protein content, weight loss, tenderness, and the bacterial count sausages increased. Increasing the level of edible coating to hold sausage weight loss, while the pH and bacterial count of chicken sausage decrease. Increase the level of edible coating adds to the water content, protein content, and sausage tenderness. The use of a combined edible coating of bovine split hide gelatin and soy protein isolate with the addition of the enzyme transglutaminase to 15% could maintain the quality of chicken sausage based on national standard during 15 dof chilled storage BSN-3820-2015.

Amino Acid Profile, Group of Functional and Molecular Weight Distribution of Goat Skin Gelatin That Produced Through Acid Process Muhammad Irfan Said; Suharjono Triatmojo; Yuny Erwanto; Achmad Fudholi
Jurnal Ilmu dan Teknologi Hasil Ternak (JITEK) Vol. 6 No. 1 (2011)
Publisher : Faculty of Animal Science Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (592.228 KB)

Gelatin is a product of hydrolysis of collagen protein from animals that are partially processed.Â Gelatin used in food and non food industries.Â Gelatin is produced when many import of raw skins and bones of pigs and cows.Â Goat skins potential as a raw material substitution that still doubt its halal. Process production of gelatin determine the properties of gelatin. The objectives of this research were to determine amino acid profile, group of functional and molecular weight distribution of gelatin made from goat skins which was produced through a process of acid. The skin of male Bligon goat, 1.5 to 2.5 year old was used as raw materials. Process production of gelatin was using acid type acetic acid (CH3COOH 0.5 M) (v/v) as curing material. The experimental design applied in this study and commercial gelatin was used as control. The results showed that gelatin produced from goat skin through the process of acid had properties identical with commercial gelatin. It can be concluded that the gelatin has the potential substitute product of commercial gelatin. Keywords: collagen, gelatin, goat skin, curing, acid process

Evaluation of Physical Characteristics of Edible film from Bligon Goat Skin Gelatin using Glycerol as Plasticizer Muhammad Irfan Said; Suharjono Triatmojo; Yuny Erwanto; Achmad Fudholi
Jurnal Ilmu dan Teknologi Hasil Ternak (JITEK) Vol. 8 No. 2 (2013)
Publisher : Faculty of Animal Science Universitas Brawijaya

The use of glycerol as a plasticizer in the film solution mixture was identified to the physical properties of edible film. The objectives of this study was to evaluate the physical characteristics of edible films using gelatin from Bligon goat skin as a raw material with glycerol as a plasticizer. The experiment was conducted in a laboratory experiment using completely randomized design (CRD) method. There were three concentrations of glycerol as a plasticizer, namely: 80%, 90% and 100% (calculated from the amount of gelatin is 9%). The variables of this study were thickness, tensile strength and elongation et break. The results of this study showed that the difference in the concentration of glycerol as a plasticizer in the gelatin of 9% gave no significant effect on the thickness and tensile strength of edible films, however very significant effect on the elongation et break. It was proven that glycerol concentration of 80% as a plasticizer had been better physically. Â Key words: edible film, gelatin, Bligon goat skin, glycerol, plasticizer

Characterization of Kacang Goat skin Pepsin Soluble Collagen (Psc) and Their Potency as an Antioxidant Rina Wahyuningsih; Rusman Rusman; Nurliyani Nurliyani; Abdul Rohman; Nanung Agus Fitriyanto; Yuny Erwanto
Jurnal Ilmu dan Teknologi Hasil Ternak (JITEK) Vol. 16 No. 2 (2021)
Publisher : Faculty of Animal Science Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jitek.2021.016.02.1

Collagen have been interesting material for many utilization such as food, pharmaceutical and cosmetic in various products and target administration, consequently collagen should be prepared as well as type of application. The objective of this research is to prepare collagen from goat skin and investigate the character and their potency as an antioxidant. Kacang goat skin aged 2 years was used for collagen production. Small slice skin was extracted by curing with 0.1% (w/v) pepsin in acetic acid 0.5 M, for 24, 48, dan 72 h at 4Â°C. The variables observed were molecular weight by Sodium dodecyl sulfate polyacrylamide gel electrophoresisÂ (SDS PAGE), microstructure using scanning electron microscope, thermal stability by differential scanning calorimetric, and the antioxidant potency through 2,2-diphenyl-1-picrylhydrazyl (DPPH) inhibition analysis. The result showed the molecular weight range from 25 kDa to 180 kDa, microstructure showed the collagen fibril crosslink, collagen start to denature at 62,28Â°C, highest dissolved with 1% NaCl concentration and has highest DPPH inhibition at 60 min after hydrolysis. In conclusion, kacang goat skin collagen prepared by pepsin in acetic acid.

Co-Authors ., Afriyanti A. S. Sukarno Abdul Rahman Ollong Abdul Rohman Abdul Rohman Abdul Rohman Abdullah, Sofwan Siddiq Achmad Fudholi Achmad Fudholi Achmad Fudholi Achmad Fudholi Adi Susanto Adi Susanto Aflah, Almira Tsania Afriyanti Afriyanti Afriyanti Afriyanti, Afriyanti Agus Hadi Prayitno Aloysia Tenny Damayanti Indriastuti Amaryllis, Anggia Risty Ambar Pertiwiningrum Ambar Pertiwiningrum Ardaning Nuriliani Arif Ismanto, Arif Ariya Dwi Nugrahanto Arum Intan Kusumanegara Asih Kurniawati Asmoro, Novian Wely Bima Mahendra Bima Mahendra Cahyowati, Meireni Chairil Anwar Chusnul Hanim Dahlanuddin Dahlanuddin, Dahlanuddin Dominikus Pandego Lestyanto Dwi Ariyani Dwi Wulandari Dwi Wulandari Dyah Triasih Edi Suryanto Edi Suryanto Edi Suryanto Edi Suryanto Edy Permadi Effendi Abustam Endang Baliarti Faruq, Rafif Umar Fatma Zuhrotun Nisa Fibri, Dwi Larasatie Nur Fiky Andy Prastyawan Flafiani Cios Conara Flaﬁani Cios Conara Ganea Qorry Aina Hasma Hasma Hendry Saragih Hendry Saragih Husaefa, Nadira Ikawati, Retty Jamhari (Jamhari) Jamhari Jamhari Jamhari Jamhari Jannah, Roudhotul Lu'luul Joni Murti Mulyo Aji Jumari Jumari Jumeri (Jumeri) Kapti Rahayu Khothibul Umam Al Awwaly Khotibul Umam Al Awwaly Kurniasih, Kholif Sholehah Indra Lailly Tsania Nur Hidayah Lailly Tsania Nur Hidayah Lidya Andini Lily Arsanti Lestari Ludfia Windyasmara, Ludfia Made Sriasih, Made Mariska, Tina Vidya Mohammad Zainal Abidin Mohammad Zainal Abidin Muh Ichsan Haris Muhamad Ali Muhamad Hasdar Muhammad Irfan Said Muhlisin Muhlisin Nanung Agus Fitriyanto Nina Salamah Novita Kurniawati Novita Kurniawati Nugraha, Widitya Tri Nurliyani Nurliyani Nurliyani Nurliyani Nurliyani Nurliyani Purnomo, Boyke Rudy R. Lukas Martindro Satrio Ari Wibowo Ragil Yuliatmo Resha Ayu Wildiana Rifqi Rifqi Rina Wahyuningsih Rizky Arizona Rulli Riana Dewi Rulli Riana Dewi Rusman (Rusman) Rusman Rusman Rusman Rusman Rusman Rusman Rusman Rusman Sadiman Sadiman Sari’ah Cintami Damayanti SATRIYAS ILYAS Satyaguna Rakhmatulloh Setiyono (Setiyono) Siswara, Hamzah Nata Soemitro Djojowidagdo Sri Hartatik Sudibyo Martono Sugiyanto Sugiyanto Sugiyono Sugiyono Suharjono Triatmojo Suharjono Triatmojo Suharjono Triatmojo Suharjono Triatmojo Suharjono Triatmojo Suryanto, Edi Sylvie Astuti T A Siswoyo T Lindrianti Thoyib Rohman Hakim Tridjoko Wisnu Murti Utama, Dicky Tri Vera, Nur Wariata, Wayan Wayan Tunas Artama Wayan Tunas Artama Wihandoyo (Wihandoyo) Winny Swastike Wisnu Pambudi Yudi Pranoto Yudi Pranoto Yudi Pranoto Yustina Yuni Surandiyah Zaenal Bachruddin Zaenal Bachrudin

Title

Found 51 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 51 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 51 Documents
Search