Claim Missing Document
Check
Articles

SKRINING AKTIVITAS ANTIBAKTERI PADA EKSTRAK Sargassum polycystum TERHADAP BAKTERI Vibrio harveyi DAN Micrococcus luteus DI PULAU PANJANG JEPARA Riyanto, Erwin Ivan; Widowati, Ita; Sabdono, Agus
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (742.76 KB) | DOI: 10.14710/jmr.v3i2.4972

Abstract

Sargassum polycystum mempunyai berbagai macam zat senyawa bioaktif yang memiliki potensi sebagai antibakteri, antivirus, antijamur, serta antikanker. Pemanfaatan bahan hayati laut sebagai obat antibakteri adalah terobosan baru sebagai alternatif, obat yang sifatnya alami mempunyai efek samping lebih rendah dari pada obat sintetis, karena obat alami bisa tereduksi oleh tubuh ikan budidaya dan mudah tedegradasi lingkungan, sehingga dapat menambah nilai ekonomi Sargassum polycystum tersebut. Pelarut etil asetat mempunyai aktivitas antibakteri paling baik terhadap bakteri Vibrio harveyi dan Micrococcus luteus. Hal tersebut dibuktikan dengan  nilai MBC (minimum bacteriosidal concentration) mencapai konsentrasi 0,5 µg/disk dengan nilai diameter 1.67 mm terhadap bakteri V. harveyi  dan 4.55 mm terhadap bakteri M. luteus. Ekstrak Sargassum polycystum positif mengandung senyawa alkaloid pada ekstrak menggunakan pelarut heksana dan senyawa steroid pada pelarut metanol, Etil asetat, dan heksana. Uji toksisitas ekstrak Sargassum polycystum memiliki efek toksik terhadap Artemia salina dengan kategori toksik golongan kronis pada pengamatan ke-24 jam, dengan kata lain ekstrak Sargassum polycystum bersifat racun pada organisme hidup.
Pengaruh Salinitas terhadap Pertumbuhan dan Aktivitas Antioksidan Dunaliella salina (Chlorophyceae: Dunaliellaceae) Setiasih, Intan Budi; Sabdono, Agus; Pramesti, Rini
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (404.008 KB) | DOI: 10.14710/jmr.v9i2.27028

Abstract

ABSTRAK: Dunaliella salina merupakan salah satu jenis mikroalgae hijau yang mengandung berbagai senyawa bioaktif termasuk senyawa antioksidan untuk melawan radikal bebas. Pertumbuhan mikroalgae dipengaruhi oleh lingkungan salah satunya adalah salinitas. Penelitian ini bertujuan mengetahui salinitas optimal untuk pertumbuhan dan aktivitas antioksidan D. salina berdasarkan nilai persen inhibisi. Penelitian ini dilaksanakan di Laboratorium Terpadu dan Laboratorium Biologi Fakultas Perikanan dan Ilmu Kelautan, Universitas Diponegoro, Semarang pada bulan Mei - Juli 2018. Metode penelitian yang digunakan adalah eksperimental laboratoris. D. salina dikultur pada lima salinitas yang berbeda yaitu 20, 25, 30, 35 dan 40 ppt.  Pengamatan dilakukan selama 7x24 jam, dipanen dan diekstrak dengan pelarut etanol yang selanjutnya dianalisis aktivitas antioksidannya dengan metode 1,1-difenil-2-pikrilhidrazil (DPPH). Hasil penelitian menunjukkan pertumbuhan optimal terjadi pada salinitas 30 ppt, dan aktivitas antioksidan tertinggi dicapai pada salinitas 20 ppt (9,88±0,59) yang termasuk dalam kategori lemah.ABSTRACT: D. salina is a type of green microalgae that contains various bioactive compounds including antioxidant compounds to fight free radicals. Microalgal growth is influenced by the environmental conditions such as  salinity. This study aims were to determine the optimal salinity of growth and antioxidant activity in ethanol extract based on percent inhibition values. This research was conducted in the Integrated Laboratory and Biology Laboratory of the Faculty of Fisheries and Marine Sciences, Diponegoro University, Semarang in May - July 2018.The research method used was an experimental laboratory. D. salina was cultivated with five different salinities on 20,  25, 30, 35 and 40 o/oo. Observation was carried out for 7x24 hours, harvested and extracted with ethanol solvent and then analyzed its antioxidant activity by 1,1-diphenyl-2-picrylhydrazyl (DPPH) method. The results showed that optimal growth of D. salina was 30 o/oo  in salinity, and the highest antioxidant activity was 20 o/oo in salinity (9.88 ± 0.59) and included in the weak category.
Uji Resistensi Bakteri Karang Galaxea sp. dan Porites sp. terhadap Pestisida Triazofos Rafsanjani, Muhammad Eka Darmawan; Sabdono, Agus; Djunaedi, Ali
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (693.601 KB) | DOI: 10.14710/jmr.v9i2.26699

Abstract

ABSTRAK: Kerusakan terumbu karang merupakan permasalahan serius di laut saat ini. Kerusakan tersebut disebabkan oleh beberapa faktor salah satunya penggunaan pestisida. Salah satu jenis pestisida yang digunakan para petani yaitu pestisida triazofos. Penggunaan pestisida triazofos di sektor pertanian akan meninggalkan residu dan terbawa ke perairan melalui sungai dan saluran air. Residu pestisida triazofos diduga dapat menyebabkan kerusakan ekosistem terumbu karang. Tujuan dari penelitian yaitu untuk mengetahui potensi resistensi karang Porites sp. dan Galaxea sp. terhadap pestisida triazofos dari Perairan Pulau Panjang, Jepara. Metode yang digunakan untuk pengambilan sampel adalah purposive sampling method, untuk memperoleh isolat bakteri yang berasosiasi dengan karang Porites sp. dan Galaxea sp., dan metode experimental laboratoris untuk uji resistensi isolat bakteri. Kurva regresi larutan standar dengan persamaan y = 0,0057x + 0,1088 dipakai untuk menentukan konsentrasi pestisida triazofos. Nilai R² menunjukkan angka 0,8694 yang berarti secara umum data yang dihasilkan mempunyai validasi data yang baik. Konsentrasi pestisida triazofos digunakan dalam uji degradasi oleh bakteri sebesar 50 ppm. Nilai absorbansi yang dihasilkan sebanyak 0,5285. Hasil uji menunjukkan seluruh isolat yang digunakan bersifat resisten terhadap pestisida triazofos yaitu PPP 11, PPP 9, GPP 6, PPP 1, GPP 7, GPP 4. Isolat PPP 11 memiliki persen degradasi tertinggi sebanyak 99,67%, GPP 4 memiliki persen degradasi terenddah sebanyak 34,34%. Disimpulkan bahwa isolat bakteri asosiasi karang Porites sp. dan Galaxea sp. memiliki resistnesi terhadap pestisida triazofos. ABSTRACT: Damage to coral reefs is a serious problem at sea at this time. The damage is caused by several factors, one of which is the use of pesticides. One type of pesticide used by farmers is the triazophos pesticide. The use of triazophos pesticides in the agricultural sector will leave residues and be carried into the waters through rivers and waterways. Triazophos pesticide residues are thought to cause damage to coral reef ecosystems. The purpose of this study is to determine the potential of coral resistance Porites sp. and Galaxea sp. against triazofos pesticides from Panjang Island waters, Jepara. The method used for sampling is purposive sampling method, to obtain bacterial isolates associated with Porites sp. and Galaxea sp., and spectrophotometric methods for testing bacterial isolate resistance. Standard solution regression curves with the equation y = 0.0057x+ 0.1088 are used to determine the concentration of the triazophos pesticide. R² value indicates the number 0.8694 which means that in general the data generated has good data validation. The concentration of the triazofos pesticide used in the bacterial degradation test was 50 ppm. The absorbance value produced was 0.5285. The test results showed that all isolates used were resistant to triazophos pesticides namely PPP 11, PPP 9, GPP 6, PPP 1, GPP 7, GPP 4. PPP 11 isolates had the highest degradation percentages of 99.67%, GPP 4 had the lowest degradation percentages 34.34%. It was concluded that the bacterial isolates of Porites sp. and Galaxea sp. has triazofos pesticide resistance.
Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding Larasati, Stefanie Jessica Henny; Sabdono, Agus; Sibero, Mada Triandala
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v10i1.28334

Abstract

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).
Pertumbuhan Rumput Laut Gracilaria sp Greville, 1830 (Rhodophyta: Florideophyceae) di Tambak Tidak Produktif Mangunharjo Tugu Semarang Suryono, Chrisna Adhi; Irwani, Irwani; Sabdono, Agus; Pribadi, Rudhi; Setyani, Wilis Ari; Indarjo, Agus
977-2407769
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jmr.v9i4.29215

Abstract

Rumput laut Gracilaria sp merupakan salah satu hasil produk laut yang masih memiliki permintaan yang tinggi di pasar. Permasalahan yang ada masih rendahnya suplai karena masih banyak mengandalka hasil alam.  Tujuan dari penelitian ini melihat pertumbuhkan rumput laut tersebut di tambak yang tidak produktip.  Metoda yag digunakan adalah lepas dasar sesui dengan hidupnya di alam.  Pegukuran dilakuna terhadap 10 contoh rumput laut yang memiliki berat awal sama ±20gr, pengukuran berat dilakukan setiap 10 hari.  Hasil penelitian menunjukan bahwa Gracilaria mampu tumbuh di tambak dengan awal yang lambat kemudian meningkat setalah hari ke 30.  Uji Anova terhadap berat tiap pengukuran menjukan perbedaan yang sangat sigikan (p= 0.00 ≤ 0,01).  Kualitas perairan tambak secara keseluran mendukung untuk pertumbuhan rumput laut Gracilaria sp. Gracilaria sp seaweed one of marine commodity which still has high demand in the market.  The problem of these produck was a supply still low because the min supplay depand on nature produck.  This study aims to determine the growth of seaweed in non productive brackish waters pounds. Off-bottom method was used to application seaweed growth on brackish fish pounds such as life in nature.  Measurement of weigh was carried out on 10 samples of seaweed which had the same initial weight of ± 20 grams, weight measurements were carried out every 10 days.  The results showed that Gracilaria was able to grow in ponds with a slow start and then increased dramatically after 30 days. Anova test on the weight of each measurement showed a very significant difference (p = 0.00 ≤ 0.01).  Futher more the quality of pond waters was supports to growth of Gracilaria sp.
Antibacterial Property of a Coral-Associated Bacterium Pseudoalteromonas luteoviolacea Against Shrimp Pathogenic Vibrio harveyi (In Vitro Study) OCKY KARNA RADJASA; TORBEN MARTENS; HANS- PETER GROSSART; AGUS SABDONO; MEINHARD SIMON; TONNY BACHTIAR
HAYATI Journal of Biosciences Vol. 12 No. 2 (2005): June 2005
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (56.298 KB) | DOI: 10.4308/hjb.12.2.77

Abstract

A coral-associated bacterium was successfully screened for secondary metabolites production based on PCR amplification of the nonribosomal peptide synthetase gene and was identified as closely related to Pseudoalteromonas luteoviolacea based on its 16S rDNA.The bacterium was found to inhibit the growth of shrimp pathogenic bacterium tested, Vibrio harveyi. To characterize the inhibiting metabolite, a 279 bp long DNA fragment was obtained and the deduced amino acid sequence showed conserved signature regions for peptide synthetases and revealed a high similarity to NosD (40% identity), a multifunctional peptide synthetase from Nostoc sp. GSV224, and NdaB (44% identity), a peptide synthetase module of Nodularia spumigena.
Evaluation of antimicrobial activity and identification of yellow pigmented marine sponge-associated fungi from Teluk Awur, Jepara, Central Java Mada Triandala Sibero; Desy Wulan Triningsih; Ocky Karna Radjasa; Agus Sabdono; Agus Trianto
Indonesian Journal of Biotechnology Vol 21, No 1 (2016)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1137.767 KB) | DOI: 10.22146/ijbiotech.26058

Abstract

Marine sponge associated fungi are known as potential source of metabolites with various biological activities. Natural pigment is one of metabolite which produced by microorgisms. Several researches reported the antimicrobial activity from natural pigment. Unfortunatelly there are lack of information about marine fungi natural pigment and its producer. The aims of this research were to identify yellow pigmented Indonesian marine sponge-associated fungi, to extract the pigment, and to study the antimicrobial activity of the pigment against clinical MDR bacteria and clinical pathogenic fungi. Sponge associated-fungus isolate MT23 was successfully identified as Trichoderma parareesei. The fungal pigment could be extracted only in methanol with yield 6,22±0,29%. The pigment could inhibitted S. typhi and E. coli MDR strains. The biggest antibacterial activity was shown by concentration 1000µg/mL against S. typhi with inhibition zone was 4.03±0.06 mm.
BACTERIAL SYMBIONTS OF REEF’S INVERTEBRATES: A MARINE NATURAL DRUG’S FACTORY Agus Sabdono
JOURNAL OF COASTAL DEVELOPMENT Vol 12, No 1 (2008): Volume 12, Number 1, Year 2008
Publisher : JOURNAL OF COASTAL DEVELOPMENT

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (261.743 KB)

Abstract

Marine invertebrates that are mainly accumulating within coral reef ecosystems such as soft corals, sponges, tunicates, and bryozoans have long been recognized as the prolific sources of structurally unique and diverse natural products since they provide a large proportion of bioactive compounds with different biological activities.Unfortunately, the supply of these bioactive natural products is usually insufficient to meet the ultimate development of most marine natural products. The concentrations of many highly active compounds in reef’s invertebrates are often minute, accounting for less than 10-6% of the wet weight. This problem has been viewed as the most significant threat regarding the development of pharmaceutical from reef’s invertebrates. The secondary metabolites from bacterial symbionts, on the other hand,is a rapidly growing field, due to the suspicion that bioactive metabolites obtained from invertebrates may be produced by their bacterial symbionts. In particular, from sustainability point of view, isolating bioactive-producing bacteria is obviously offers a much better approach than cultivating and harvest invertebrates, which are in most cases extremely difficult.Bacteria isolated from living surfaces, in particular from reef’s invertebrates, are a promising source of natural products. It is expected that still quite a few parts of unexplored culturable bacterial symbionts exists in the reefs. Such information might be desirable, as these bacterial symbionts may serve beneficial purposes as the source of secondary metabolites including novel marine natural products. 
ANTIFOULING ACTIVITY OF BACTERIA ASSOCIATED WITH SOFT CORAL Sarcophyton sp. AGAINST MARINE BIOFILM-FORMING BACTERIA Agus Sabdono; Ocky Karna Radjasa
JOURNAL OF COASTAL DEVELOPMENT Vol 10, No 1 (2006): Volume 10, Number 1, Year 2006
Publisher : JOURNAL OF COASTAL DEVELOPMENT

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (376.854 KB)

Abstract

Marine bacteria associated with soft coral Sarcophyton sp collected from vicinity of Peucang island, Ujung Kulon, West Java, were successfully screened for antifouling activity against marine biofilm-forming bacteria isolated from the surrounding colonies of Sarcophyton sp. Six bacterial isolates were found to inhibit the growth of at least one of 7 biofilm-forming isolates.  The most active strain USP3.37 was identified as Pelagiobacter variabilis by using 16S rDNA gene sequence analysis. Similarly, the active strains USP3.3, USP8.43, USP3.12, USP3.16 and USP8.6 were identified as Arthrobacter nicotianae,  Shewanella alga, Pseudomonas synxantha, Pseudomonas falgida, Pseudovibrio denitrificans and Bacillus aquamaris, respectively. USP3.37 strain was found to amplify gene fragments of non-ribosomal peptide synthetase (NRPS).  This raises the possibility the use of softcoral bacteria as the source of antibacterial compounds for controlling the antifouling in the sea. Therefore,  this bacterium would be better to select eco-friendly antifouling compounds than the other antibacterial activities.
ANTIBACTERIAL ACTIVITY OF A SECONDARY METABOLITE-PRODUCING CORAL BACTERIUM Pseudoalteromonas SPECIES ocky radjasa; Torben Marten; Thorsten Brinkoff; Hans-Peter Grossart; Agus Sabdono; Meinhard Simon
JOURNAL OF COASTAL DEVELOPMENT Vol 7, No 2 (2004): Volume 7, Number 2, Year 2004
Publisher : JOURNAL OF COASTAL DEVELOPMENT

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (468.693 KB)

Abstract

A bacterium, collected at the surface of coral Acropora sp., TAB4.2 was successfully screened for secondary metabolites production based on PCR amplification of the non-ribosomal peptide synthetase gene. It was identified as closely related to Pseudoalteromonas luteoviolacea based on its 16S rDNA. TAB4.2 was found to inhibit the growth of all 5 coral-associated and all 5 pathogenic bacteria tested. To characterize the inhibiting metabolite, a 279 bp long DNA fragment was obtained and the deduced amino acid sequence showed conserved signature regions for peptide synthetases and revealed a high similarity to NosD (40 % identity), a multifunctional peptide synthetase from Nostoc sp. GSV224, and NdaB (44 % identity), a peptide synthetase module of Nodularia spumigena. �m es�`� ��� on their ecology. Due to this, water quality management in these ecosystems has become a necessity. Regular studies of the hydrological parameters are essential for this purpose, as they can assess the status of pollution and help in deciding the mitigation strategy.  Water quality of 26 km stretch of Thane creek, central-west coast of India was analyzed in 5 regions of the creek from May 1999 to April 2000. The study revealed spatial and temporal patterns. Heavy suspended solid load (avg. 5.736 gm/L), frequent hypoxia (DO<2.5 mg/L) coupled with excess nutrients like Phosphate-Phosphorus (avg. 0.26 mg/L) and Nitrate-Nitrogen (avg. 0.96 mg/L) were the main features of the creek. The Thane city region showed more deterioration of water quality compared to the other regions in the creek. In this region the suspended solid load showed an increase of 713.69% and dissolved oxygen decreased by 21.55% compared to the data of 1992-93. This can be attributed to the severe onslaught of activities in this region like solid waste dumping, construction of 3 new bridges, etc. since 1993, thereby affecting the flushing characteristic. Hence in order to protect and preserve such ecosystems, alterations to the environment should be meticulously planned.  
Co-Authors Agus Indarjo Agus Trianto Agus Trianto Agus Trianto Agus Triyanto Agustina Agustina Agustina Aiyen Tjoa Aldion Adin Nugroho Ali Djunaedi Ali Djunaedi Ali Ridlo Ambariyanto , Ambariyanto Ambariyanto Angelina Ferawaty Siregar Angelina Ferawaty Siregar Aninditia Sabdaningsih Azizi, Muhammad Faris B Tyas Susanti B. Tyas Susanti Bambang Yulianto Baskoro Rochaddi Bhaskoro Rochaddi Burhan Habibi Yunus Chrisna A Suryono Chrisna A Suryono Chrisna A Suryono Chrisna Adhi Suryono Chrisna Adhi Suryono Delianis Pringgenies Denny Nugroho Sugianto Desy Wulan Triningsih DIAH AYUNINGRUM Diah Ayuningrum, Diah Diah P Wijayanti Diah P Wijayanti Diah Permata Wijayanti Diah Permata Wijayanti Diah Permata Wijayanti Dio Dirgantara Duhita Sinidhikaraning Kencana Elena Zocchi Endang Sri Lestari Erwin Ivan Riyanto Erwin Ivan Riyanto Eunike Dorothea Hutapea Farrastasya Muflihul Azzami Fauziah Shahul Hamid Gina Saptiani Gina Saptiani Hadi Endrawati Haeruddin Haeruddin Hakim, Muhamad Fikri Hudi Nur Hans Arthur Philips HANS- PETER GROSSART Hans-Peter Grossart Herawati Sudoyo Herida, Azalia Puspa Hermin Pancasakti Kusumaningrum Heru Kurniawan Alamsyah Ibnu Pratikto Ida Ayu Putu Sri Widnyani Intan Budi Setiasih Irwani Irwani Irwani Irwani Irwani Irwani Irwanto, Eko Ita Widowati JOEDORO SOEDARSONO Johannes F Imhoff Jusup Suprijanto Jusup Suprijanto Jutta Wiese Larasati, Stefanie Jessica Henny Leenawaty Limantara Mada Triandala Sibero Mada Triandala Sibero Meinhard Simon Miftahuddin Majid Khoeri Misbakul Munir Muchlissin, Sakti Imam Muhamad Fikri Hudi Nur Hakim Muhamad Ziaul Faiz Muhammad Eka Darmawan Rafsanjani Muhammad Zainuri Nadya Cakasana Norma Afiati Norma Afiati Nur Taufiq Syamsudin Putra Jaya Taufiq Syamsudin Putra Jaya Ocky Karna Radjasa Ocky Karna Radjasa ocky radjasa Popi IL Ayer Prastyo Abi Widyananto Puspa Kapinangasih Putut Har Riyadi Raden Ario Rafsanjani, Muhammad Eka Darmawan Ragil Saptaningtyas Raja Aditya Sahala Siagian Ratna Diyah Palupi Retno Hartati Rignolda Djamaludin Rina Setyowati Sulistiyoningrum Rini Pramesti Rivan Novianto Madilana Romadhon Romadhon Rory Anthony Hutagalung Rosa Amalia Rudhi Pribadi Rudiger Stöhr S Sukarmi S. Sulistiyani Sakti Imam Muchlissin Sakti Imam Muchlissin Sakti Imam Muchlissin Setiasih, Intan Budi Setyani, Wilis Ari Sibero, Mada Triandala Slamet Budi Prayitno Sri Achadi Nugraheni Sri Lintang Artono Sri Redjeki Sri Redjeki Stalis Norma Ethica Stefanie Jessica Henny Larasati Subagiyo Subagiyo Subagiyo Subagiyo Subagyo Subagyo Sugiyanto Sugiyanto Sugiyanto Sugiyanto Sugiyanto Sunaryo Sunaryo Suzana Kristy Satriani Fofied Syauqina Nashihi Aufar Thorsten Brinkoff TONNY BACHTIAR Tonny Bachtiar Tony Bachtiar Tony Bachtiar Torben Marten TORBEN MARTENS Tri Yuni Atmojo Tri Yuni Atmojo Ulfah Amalia Wahyuningsih, Candra Widy Febriansyah Wilis Ari Setyani Yeni Sulistiyani Yesaya Putra Pamungkas