Article Per Year (5 Year)
p-Index From 2021 - 2026
7.768
P-Index
This Author published in this journals
All Journal Bioscience AL KAUNIYAH Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Indonesian Food Science and TechnologyJournal Martabe : Jurnal Pengabdian Kepada Masyarakat JURNAL PENDIDIKAN TAMBUSAI Pelita Eksakta Jurnal Biogenerasi Journal of halal product and research (JHPR) 3BIO: Journal of Biological Science, Technology and Management Jurnal Jeumpa TROPICAL GENETICS MASALIQ: Jurnal Pendidikan dan Sains Promotor: Jurnal Mahasiswa Kesehatan Masyarakat Tropical Genetics Symbiotic: Journal of Biological Education and Science Jurnal Serambi Biologi
Achyar, Afifatul
Departemen Biologi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Negeri Padang, Padang Indonesia
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Economics, Econometrics & Finance Education Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Veterinary Other

Published : 62 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 62 Documents
Search

 1   2   3   4   5 
Analysis of Genetic Variations in PHT1 Gene Sequences in Rice (Oryza sativa) NCBI Popset 240028097 Using In-Silico RFLP Oliv Nurul Kanaya Nurul Kanaya; Afifatul Achyar
Jurnal Serambi Biologi Vol. 8 No. 1 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Abstract Rice is a plant that has high economic value. According to FAO, Indonesia is the third largest rice consuming country in the world. However, rice will become stunted and its growth will be stunted if there is a lack of phosphorus. The PHT1 gene plays an important role in plant growth and development, because this gene plays a role in taking phosphate from the soil. The PHT1 gene is transcribed when there is drought, salt stress, and nutrition in plants. Genetic variation in a population will affect the survival of an individual. This study used the restriction enzyme ScaI. This study aims to analyze genetic variation in the PHT1 gene sequence in NCBI Popset 2400280979 rice using RFLP in silico. The results showed that there was genetic variation in the rice PHT1 gene sequence and two allele variations present in 24 rice gene sequences using the restriction enzyme ScaI.
Specific Primer Design and Optimization of Monodehydroascorbate reductase (MDHAR) Gene Amplification in Rice (Oryza sativa L.) Jumatul Hafsah; Afifatul Achyar; Zulyusri; Yusni Atifah; Linda Advinda; Violita
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Monodehydroascorbate reductase (MDHAR) is an enzyme responsible for growth and response to biotic and abiotic stress. MDHAR in rice shows a higher sensitivity to stress compared to other plants. This study aims to obtain specific primers for the MDHAR gene in rice to be used in PCR amplification so that it can amplify the MDHAR gene. Primers are designed using the Pickprimer and Geneious Primer tools. Optimization of annealing temperature was carried out using the gradient PCR method and then an in vitro primary specification test was carried out using the Touchdown PCR method. The results of the primary design obtained one candidate primer that met the ideal primer requirements, namely a pair of primers (5'-AAAAACACTGCATGGGTCGTC-3' and 5'-CGCCTACCGTTTCCCAAGTT-3') with an amplicon length of 160 bp. The visualization results of PCR products using 1.5% agarose showed that 6 samples were able to amplify the MDHAR gene at 160 bp in size. However, in each lane there is a non-specific DNA band (Primer dimer). In vitro primer specification testing with Touchdown succeeded in increasing product formation specifications and was able to reduce non-specific DNA bands (Primer dimers).
Morphological Response of Several Rice Varieties to Drought Stress Simulation using PEG Rezi Nabilah; Afifatul Achyar; Zulyusri Zulyusri; Yusni Atifah; Dwi Hilda Putri; Violita Violita
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.122676

Abstract

Rice has become food for most of the world's population. Indonesia is the third largest producer in the world. However, in fact rice production in Indonesia has decreased by 0.43% compared to 2020. One of the factors that can cause this decline is drought. Because rice is a semi-aquatic plant that grows normally in flooded conditions, it makes drought stress very threatening. Drought stress that occurs in plants causes plants to experience oxidative stress due to excessive accumulation of ROS. PEG is a compound that is widely used to provide drought conditions in plants. Previous research has classified several varieties of rice plants based on their level of resistance to drought. However, it is not yet known how the morphological response will be in different periods of drought stress and rewatering treatment. This research was conducted by giving treatment in the form of control (Yoshida nutrient culture solution) and drought stress (Yoshida + PEG-6000 20% solution) repeated 3 times. The observed parameters were RWC which were analyzed using standard errors and morphological images of roots and leaves. The results showed that the RWC obtained during the stress period from the third to the fifth day, Harum had the highest value according to its class as tolerant rice. After rewatering Rosna has a better recovery ability. In addition, root morphology shows differences in the form of root length, small root diameter, inhibition of adventive root growth. On the leaves include a decrease in leaf area, leaf curl up, and leaf yellowing.
New Records of Proceratium deelemani Perrault, 1981 (Hymenoptera : Formicidae : Proceratiinae) in Sumatra Rini Wulandari; Dwi Hilda Putri; Dezi Handayani; Afifatul Achyar; Rijal Satria
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.126193

Abstract

Proceratium Roger, 1863 is a genus of ants that has widely distributed throughout the world, Proceratium species rarely collected, their cryptobiotic lifestyle. This condition also occurs on the Sumatra Island, Indonesia. So far, only single species was recorded in this island, namely Proceratium papuanum Emery, 1897. We conducted a survey of leaf-litter ants in June 2021 by using Winkler’s extraction method in lowland disturbed forest near Tiga Tingkat Water fall Lubuk Hitam, Teluk Kabung Utara, Bungus Teluk Kabung, Padang, West Sumatra, Indonesia. The discovery of Proceratium deelemani Perrault, 1981 for the first time in Sumatera Island, Indonesia was increased the total ant fauna in this island. In the present study, we reports new distribution record of Proceratium deelemani Perrault, 1981 in Sumatra. Total two species of this genus was recorded in Sumatra: Proceratium deelemani Perrault, 1981 and Proceratium papuanum Emery, 1897.
Training of Halal Product Process Assistant for Alumni of the UNP Biology Department to Assist Micro and Middle Class Businessman in Self-Declare Halal Certification Afifatul Achyar; Violita Violita; Rijal Satria; Vauzia Vauzia; Yusni atifah
Pelita Eksakta Vol 6 No 2 (2023): Pelita Eksakta, Vol. 6, No. 2
Publisher : Fakultas MIPA Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/pelitaeksakta/vol6-iss2/228

Abstract

The Halal Product Guarantee Organizing Agency (BPJPH) of the Indonesian Ministry of Religion requires human resources as qualified Halal Product Process Assistants (PPH) to help accelerate the halal certification process for MSE products in Indonesia. On the other hand, there are not many alumni of the Biology Department, FMIPA UNP who got jobs in less than 6 months after graduating. Therefore, the solution offered to the problems faced by partners is to conduct halal product process assistance (PPH) training for alumni of the Biology Department, FMIPA UNP so that they have the capacity and competence to assist MSE business actors in halal certification of their products through a self-declaration scheme. Community service activities consist of two main activities, namely the delivery of material about the halal certification self-declaration scheme and the practice of halal product process assistance (PPH) simulations. The competency of PPH assistants is evaluated and used as an indicator of graduation.
The Primer Design and Optimization of Annealing Temperature for Analysis of Glutathione Reductase Gene Expression in Rice (Oryza sativa L.) Annisa Khaira; Afifatul Achyar; Zulyusri Zulyusri; Yusni Atifah; Dwi Hilda Putri; Violita Violita
3BIO: Journal of Biological Science, Technology and Management Vol. 5 No. 1 (2023)
Publisher : School of Life Sciences and Technology, Institut Teknologi Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.5614/3bio.2023.5.1.3

Abstract

Glutathione Reductase (GR) belongs to the NADPH-dependent flavoprotein oxidoreductase family and is found in both prokaryotes and eukaryotes. The GR gene is considered to play a key role in the elimination of oxidative reaction products by looking at the level of gene expression of GR rice in dealing with  drought stress using qPCR. One of the important steps to develop a specific, effective and efficient qPCR is the primer design. Several studies analyzing GR gene expression in rice have also designed primers. However, the primer still lacks an ideal characteristic of primer, as it still has a secondary structure. This studies aims to design rice GR specific primers and optimize the annealing temperature for GR gene expression analysis on rice. Primers were designed using the  Primer3 and Geneious Prime and checked for specificity using the Primer-BLAST tool. The selected primer pairs were then optimized for annealing  temperature using gradient PCR. The best primer design results were GR-Forward 5’-ACGATTGCAGCCAGTGAAGA-3’ and GR-Reverse 5’-TGCGGCAATACTATCAACATCC-3’, with an amplicon length of 204 bp, primer base lengths of 20 and 22 nucleotides, Tm values of 60°C and 58.9°C, %GC of 50% and 45.5%, respectively. This primer pair had no secondary structure, both hairpin and self dimer. Gradient PCR showed the optimum annealing temperature for this primer pair was 52.2oC so that the primer can be used as a specific primer to analyze  the GR gene expression in rice using qPCR.
Variasi Genetik Prion Protein Gene pada Kucing Domestik (Felis catus) Menggunakan Metode RFLP In Silico Pinta, Sari Rahma; Pratama, Chelsylia Dara; Fatiha, Fathma Dwi; Muharani, Silvia; Achyar, Afifatul
Jurnal Jeumpa Vol 11 No 1 (2024): Jurnal Jeumpa
Publisher : Department of Biology Education, Faculty of Teacher Training and Education, Samudra University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33059/jj.v11i1.9933

Abstract

FSE adalah penyakit neurodegeneratif yang disebabkan oleh prion yang mempengaruhi semua keluarga kucing. Penelitian ini bertujuan untuk mengidentifikasi variasi genetik dalam prion protein gene pada kucing domestik (Felis catus) menggunakan RFLP In silico. Penelitian ini merupakan penelitian deskriptif yang menyajikan karakteristik dari sampel yang diuji. Sampel yang digunakan yaitu sekuen prion protein gene dalam format fasta dari NCBI, dengan nomor identitas NCBI Popset 2445476754. Skrining enzim restriksi dilakukan menggunakan situs insilico.ehu.es. Metode RFLP in silico ini dilakukan menggunakan tools pada situs benchling.com dengan enzim restriksi yang diperoleh selama tahap skrining. Data yang telah didapatkan dianalisis secara deskriptif. Enzim restriksi yang digunakan yaitu enzim HhaI dengan sisi pemotongan pada basa G_CG'C dan enzim DpnI dengan sisi pemotongan pada GA'TC. Hasil restriksi dengan enzim HhaI pada 25 isolat prion protein gene Felis catus menghasilkan 4 variasi alel yaitu alel A1 (frekuensi alel 0,08), alel A2 (frekuensi alel 0,16), alel A3 (frekuensi alel 0,68) dan alel A4 (frekuensi alel 0,08). Restriksi yang dilakukan oleh enzim DpnI menghasilkan 2 alel yaitu alel B1(frekensi alel 0,84) dan alel B2 (frekuensi alel 0,16). Hasil penelitian ini dapat digunakan sebagai rujukan awal penelitian tentang gen Prion kucing domestik pada tahap yang lebih kompleks seperti bioinformatika, maupun pada tahap kerja laboratorium.
Isolation and Identification of Lactic Acid Bacteria Using PCR Gene from Tempe Wrapped with Banana Leaves and Plastic Fevria, Resti; Vauzia, Vauzia; Putri, Dwi Hilda; Achyar, Afifatul; Putri, Santi Diana; Edwin, Edwin
Indonesian Food Science and Technology Journal Vol. 7 No. 2 (2024): Volume 7 Number 2, July 2024 |IFSTJ|
Publisher : Department of Technology of Agricultural product (THP) Jambi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/ifstj.v7i2.32503

Abstract

Tempe is a typical Indonesian food that comes from fermenting soybeans with the fungus Rhizopus sp. Tempe is known to have good nutritional value because of the content contained in soybeans themselves and other microorganisms that appear as a result of the tempe fermentation process. The fermentation process increases the activity of bacteria in tempe which are beneficial for digestion, one of which is lactic acid bacteria. This research aims to see the differences morphological forms  and genomic of lactic acid bacteria produced by tempe wrapped in banana leaves and tempe wrapped in plastic. The differences in fermentation that occurred in tempe wrapped in banana leaves and those wrapped in plastic resulted in differences in lactic acid bacteria type. Based on the isolation of bacteria on Mann de Rogosa Sharpe Agar medium, 15 isolates of lactic acid bacteria were produced, with general morphological forms of bacilli and coccus. Then, genomic identification was carried out using the PCR. The phylogenetic tree built based on the 16S rRNA gene sequence can show the relationship between LAB diversity at the species level, but cannot differentiate LAB from the strain level.
Primer Design and Annealing Temperature Optimization for Catalase (CAT) Gene Amplification in Rice (Oryza sativa L.) Yulita, Nelfi; Violita; Achyar, Afifatul; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.222

Abstract

Catalase (CAT) is an antioxidant enzyme that plays an important role in plant growht and defense against abiotic stress, one of which is rice (Oryza sativa). When plants are under abiotic stress conditions, the CAT gene will be regulated and expressed as a form of defense response to stress. To determine the expression of this CAT gene, optimal primers and annealing temperatures are needed to spesifically amplify the CAT gene. This study aims to design primers and determine the optimal annealing temperatures to amplify the CAT gene. Primers are designed using the tools pick primer, primer BLAST and geneious prime. Primers are designed in silico and must meet the ideal primer criteria because they will be used in vitro. Optimization of the annealing temperature was carried out using a PCR temperature gradient. The results of this study obtained a pair of primers, namely forward primer 5’-ATAAGTAGGGCGGTGTGTGG-3’ with a primer length of 20 bp, and reverse primer 5’-GCGAGTTGTTGTTGTTCCATAC-3’ with a primer length 22 bp. This primer pair produces a 185 bp amplicon in the Oryza sativa CAT gene. The optimum annealing temperature for this primer pair is 60ºC.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Co-Authors Afionita, Santi Ahmad Hambali Ahmad Wibisana, Ahmad Alifah Hazelia Elviana Alvenaya Hindayageni Ananda Putri, Ananda Andini Novalia Pradila Annisa Irna Putri Annisa Khaira Annisa Khaira Aprilia, Amanda Ardi Ardi Atifah, Yusni Aura Zahra Nafisah Bintang Fadhil Ramadhan Cici Mustika cynthia perdana putri Dara Suci Amini Des M Dezi Handayani Dezi Handayani Dina Sukma Dini Herisanti Dwi Hilda Putri Dwi Hilda Putri Dwi Hilda Putri Edwin Edwin Edwin Edwin Elisa Suryani Elsa Badriyya Elsa Yuniarti Fadhila Humaira Fardilla, Midratul Farrah Azzahra Ara Fatiha, Fathma Dwi Fevria, Resti Fitri, Afifah Ismu Fronica, Imelda Gilang Amanda Hafizah Fadhilah Hafizh Alza Afra Hafizhah Putrizalda Helsa Rahmatika Indiastri P Monica Indria Palupi Irma Leilani Eka Putri Iyan Robiansyah Jalilah Azizah Jumatul Hafsah Kardiman, Reki Khairani, Fidia Aura Linda Advinda Marten, Threo Wanda Moralita Chatri Muhamad Zacky Pryatna Muhammad Farikh Muharani, Silvia Mukhlis Mukhlis Mutia Andini, Tri Nabilah, Rezi Nadira Nafisa Arini Nella Fauziah Novita, Yeni Nur Aqsha Nurfadillatun Nisa Wijaya Nurul Hasanah NURUL HIDAYAH Oliv Nurul Kanaya Nurul Kanaya Pinta, Sari Rahma Pramila, Cindy Pratama, Chelsylia Dara Pratama, Sandi Fransisco Putri, Aulia Devani Putri, Irma Leilani Putri, Isna Aryunita Putri Putri, Santi Diana Rahmad Wanizal Pastha Rahmawati, Atika Ayu Rahmi Holinesti Rezeki Rival Alridho Rezi Nabilah Ria Fernanda, Irma Rijal Satria Rijal Satria Rini Wulandari Rinti Mutiara Sari Riza Umami Roza, Sri Yenica Ruri Fitriyani S. Syamsurizal Salsabilla, Vishtari Sari Rahma Pinta Satria, Rijal Sefina, Nadia Selaras, Ganda Hijrah Silvy Annisa Sisca Alicia Farma Vauzia Vauzia Vauzia, Vauzia Vauzia, Vauzia Velina Salsabil Violita Violita Violita Violita Violita Violita Violita Yulita, Nelfi Yuni Ahda Yuni Ahda Zultsatunni’mah Zultsatunni’mah Zulyusri Zulyusri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri, Zulzusri