Article Per Year (5 Year)
p-Index From 2021 - 2026
7.885
P-Index
This Author published in this journals
All Journal Bioscience AL KAUNIYAH Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Indonesian Food Science and TechnologyJournal Martabe : Jurnal Pengabdian Kepada Masyarakat JURNAL PENDIDIKAN TAMBUSAI Pelita Eksakta Jurnal Biogenerasi Journal of halal product and research (JHPR) 3BIO: Journal of Biological Science, Technology and Management Jurnal Jeumpa Halal Research Journal TROPICAL GENETICS MASALIQ: Jurnal Pendidikan dan Sains Promotor: Jurnal Mahasiswa Kesehatan Masyarakat Tropical Genetics Symbiotic: Journal of Biological Education and Science Jurnal Serambi Biologi
Achyar, Afifatul
Departemen Biologi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Negeri Padang, Padang Indonesia
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Economics, Econometrics & Finance Education Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Veterinary Other

Published : 63 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 63 Documents
Search

 3   4   5   6   7 
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Optimasi Deteksi Kontaminasi Daging Babi Berbasis Multiplex Real Time Polymerase Chain Reaction (qPCR) pada Produk Makanan Olahan Daging Sapi Pramila, Cindy; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.239

Abstract

Abstrak. Indonesia merupakan salah satu negara dengan mayoritas penduduk beragama Islam. Mengonsumsi pangan yang halal adalah hak dasar setiap muslim. Sampai saat ini harga daging sapi masih relatif mahal. Konsekuensi dari mahalnya harga daging tersebut yaitu ada oknum yang mencampur atau mengganti daging sapi dengan daging hewan lain seperti daging babi. Produk pangan yang dibuat dengan campuran daging sangat sulit dibedakan dengan mata telanjang. Metode Multiplex Real Time PCR merupakan metode pengujian yang cepat, sensitif, dan spesifik untuk mendeteksi kontaminasi daging babi pada produk pangan olahan daging sapi. Hasil penelitian menunjukkan konsentrasi primer yang optimum untuk pasangan primer Bos dan Sus adalah 0,4 μM. Konsentrasi DNA yang optimum untuk mengamplifikasi DNA Bos taurus dan Sus scrofa yaitu pada konsentrasi 100 ng/ μl yang menghasilkan amplikon dengan nilai peak 86,3 o C untuk Bos taurus dan 84,7 oCpada Sus scrofa. Kata kunci optimasi Multiplex Real Time PCR, gen ND5, babi, daging sapi, halal
Optimasi Isolasi DNA Bakteri Patogen pada Sampel Air Sungai Berbasis PCR Putri, Ananda; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.241

Abstract

Abstrak Bakteri patogen adalah mikroorganisme yang menyebabkan penyakit pada inangnya dengan berbagai proses yang secara jelas melalui kerusakan langsung jaringan atau sel selama replikasi, melalui produksi toksin yang memungkinkan patogen mencapai jaringan baru atau keluar dari sel pada tempat bereplikasi. Bakteri patogen seperti E.coli dapat tersebar melalui air sungai karena sungai banyak dijadikan sebagai tempat pembuangan kotoran dan sampah sehingga menjadi penyebaran bakteri patogen. Penelitian ini bertujuan untuk mengetahui optimasi isolasi DNA dan mendeteksi bakteri patogen pada sampel air sungai. Metodologi yang digunakan dalam penelitian ini adalah pengambilan sampel air sungai gangga di sekitar Laboratorium Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Negeri Padang dan dilakukan analisis laboratorium. Hasil penelitian dari optimasi sampel air sungai gangga bahwa primer yang optimal untuk mendeteksi bakteri patogen adalah primer ESS. Primer ESS berpotensi mengamplikasi bakteri E.coli, Salmonella, dan, Shigella dengan ukuran amplikon 825 bp. Optimasi isolasi lebih optimal saat sampel dimasukkan kedalam microtube .
Genetic Variation Analysis of the E6 HPV 16 Gene Using RFLP In Silico Annisa, Silvy; Rahmawati, Atika Ayu; Nadira; Khairani, Fidia Aura; Achyar, Afifatul
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.331

Abstract

Cervical cancer is cancer that attacks epithelial cells or the outer surface layer of the cervix. This cancer is most commonly caused by the high risk type of Human Papillomavirus. The RFLP method uses restriction enzymes to cut certain nucleotide sequences at specific positions that produce fragments of different lengths. The purpose of this study was to determine the polymorphism that occurs in the E6 gene of the HPV 16 virus. This research was conducted using RFLP in silico. Virtual descriptive methods are used to analyze data and collect information about the object of study. The restriction enzyme HpaII was used in this study. The results showed that there were two alleles (A1 and A2) out of a total of 15 sequences of the E6 HPV 16 gene in Popset 636528409 indicating that there was a genetic variation in the gene.
Gambaran Kadar Hemoglobin (Hb) pada Ibu Hamil dengan Menggunakan Alat Hematologi Analyzer di Puskesmas Lubuk Basung Fitri, Afifah Ismu; Achyar, Afifatul; Yuniarti, Elsa
MASALIQ Vol 4 No 4 (2024): JULI
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/masaliq.v4i4.3341

Abstract

Hematological changes in pregnant women are a response to multifactorial hormonal changes, one of the hematological changes that occur is caused by anemia. Anemia in pregnant women is physiological that can occur in normal pregnancy. Some factors that can be experienced by pregnant women to experience anemia are nutritional knowledge factors, age factors that are too young or too old, and health in the nutritional consumption patterns of pregnant women. The purpose of this study was to see a description of hemoglobin (hb) levels in pregnant women using a hematology analyzer at the Lubuk Basung health center. The implementation of activities carried out at the Lubuk Basung Health Center Health Service Laboratory, Agam Regency, West Sumatra Province by performing venous blood collection procedures and then performing hemoglobin level examination procedures using a hematology analyzer. the conclusions obtained are the results of research conducted on 69 samples in June-July 2023 on the description of hemoglobin levels in pregnant women at the Lubuk Basung Health Center, it was concluded that of the 69 samples there were pregnant women with an age range of 20-35 years totaling 62 people (89.9%), and age> 35 years totaling 7 people (10.1%). This shows that pregnant women who do Hb checks at the Lubuk Basung Health Center tend to be productive age, and of the 69 samples, low Hb levels (<11 gr/dl) were 17 people (24.6%) and normal Hb levels (11-15 gr/dl) were 52 people (75.4%).
Variasi fenotip cadel (disartria) pada populasi mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang Hambali, Ahmad; Elviana, Alifah Hazelia; Achyar, Afifatul
Tropical Genetics Vol. 5 No. 1 (2025): Genetics
Publisher : Genetikawan Muda Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/tg.v5i1.78

Abstract

Lisp (Dysarthria) is an abnormality in the nervous system that can affect the performance of the articulatory muscles or speech organs. The Hardy-Weinberg Law states that the frequency of genes in a population remains constant from one generation to the next if there are no evolutionary processes such as migration, mutation, natural selection and gene flow. This research aims to analyze the variation in the Lisp (Dysarthria) phenotype in the Biology Faculty student population. Mathematics and Natural Sciences, Padang State University. Data was obtained through an online questionnaire that identified the predominance of Lisp (Dysarthria) (Dysarthria or not Dysarthria). The results of the study showed that Lisp (Dysarthria) was found in a number of students in a proportion 10 people out of a total of 105 respondents. Analysis using the Hardy-Weinberg law shows that the frequency of dominant (p) and recessive (q) alleles. The frequency of the recessive allele (q) which causes the absence of lisp (dysarthria) is around 0.30, while the frequency of the dominant allele (P) is around 0 .7. Based on calculations, the estimated genotype proportions are 49% homozygous dominant (CC), 42% heterozygous (Cc), and 9.6% homozygous recessive (cc). These results indicate that the population of FMIPA UNP biology students is in Hardy-Weinberg equilibrium regarding the characteristic of lisp (dysarthria). Phenotypic variations of Lisp (Dysarthria) provide an overview of genetic diversity in the population environment of Biology students, Faculty of Mathematics and Natural Sciences, Padang State University and can be the basis for further research regarding the relationship between genetic factors and phenotypic expression in human populations. Keywords: Disartria, Phenotype, Variation, Student, Genetics. ABSTRAK Cadel (Disartria) merupakan kondisi kelainan pada sistem saraf yang dapat memengaruhi kinerja otot artikulator atau organ bicara. Hukum Hardy-Weinberg menyatakan frekuensi gen dalam suatu populasi tetap konstan dari satu generasi ke generasi berikutnya jika tidak ada proses evolusi seperti migrasi, mutasi, seleksi alam dan aliran gen.Penelitian ini bertujuan untuk menganalisis variasi fenotip Cadel (Disartria) pada populasi mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang.Data diperoleh melalui kuisioner daring yang mengidentifikasi dominasi Cadel(Disartria) (Disartria atau tidak Disartria).Hasil penelitian menunjukkan bahwa Cadel (Disartria) ditemukan pada sejumlah mahasiswa dengan proporsi 10 orang dari jumlah total responden 105 orang. Analisis menggunakan hukum Hardy-Weinberg menunjukkan bahwa Frekuensi alel dominan (p) dan resesif (q).frekuensi alel resesif (q) yang menyebabkan tidak adanya Cadel (Disartria) adalah sekitar 0,30, sedangkan frekuensi alel dominan (P) adalah sekitar 0,7. Berdasarkan perhitungan, proporsi genotip yang diestimasi adalah 49% homozigot dominan (CC), 42% heterozigot (Cc), dan 9,6% homozigot resesif (cc). Hasil ini mengindikasikan bahwa populasi mahasiswa biologi FMIPA UNP berada dalam keseimbangan Hardy-Weinberg terkait sifat Cadel (Disartria) . Variasi fenotip Cadel (Disartria) memberikan gambaran keberagaman genetik di lingkungan populasi mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang dan dapat menjadi dasar untuk penelitian lebih lanjut mengenai hubungan antara faktor genetik dan ekspresi fenotipik pada populasi manusia. Kata kunci: Disartria, Fenotip, Variasi, Mahasiswa, Genetika.
Variasi Fenotip Lesung Pipit pada Populasi Mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang Ara, Farrah Azzahra; Suryani, Elisa; Achyar, Afifatul
Tropical Genetics Vol. 5 No. 1 (2025): Genetics
Publisher : Genetikawan Muda Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/tg.v5i1.80

Abstract

Lesung pipi merupakan salah satu variasi fenotip yang mudah diamati pada manusia dan dipengaruhi oleh faktor genetik serta non-genetik. Penelitian ini bertujuan untuk menganalisis variasi fenotip lesung pipit pada populasi mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang. Metode penelitian ini bersifat deskriptif dengan pendekatan survei. Data dikumpulkan melalui pengamatan langsung dan pencatatan karakteristik lesung pipit, meliputi keberadaannya. Hasil penelitian menunjukkan bahwa lesung pipit ditemukan pada sejumlah mahasiswa dengan proporsi 25 orang dari jumlah total responden 105 orang. Analisis menggunakan hukum Hardy-Weinberg menunjukkan bahwa frekuensi alel resesif (d) yang menyebabkan tidak adanya lesung pipi adalah sekitar 0,48, sedangkan frekuensi alel dominan (D) adalah sekitar 0,52. Berdasarkan perhitungan, proporsi genotip yang diestimasi adalah 27,04% homozigot dominan (DD), 49,92% heterozigot (Dd), dan 23,04% homozigot resesif (dd). Hasil ini mengindikasikan bahwa populasi mahasiswa biologi FMIPA UNP berada dalam kesetimbangan Hardy-Weinberg terkait sifat lesung pipi. Variasi fenotip lesung pipit memberikan gambaran keberagaman genetik di lingkungan populasi mahasiswa Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang dan dapat menjadi dasar untuk penelitian lebih lanjut mengenai hubungan antara faktor genetik dan ekspresi fenotipik pada populasi manusia.
Optimization of Deoxyribonucleic Acid (DNA) isolation methods from several types of cosmetic samples for molecular-based halal tests Nafisa Arini; Afifatul Achyar
Journal of Halal Product and Research (JHPR) Vol. 6 No. 1 (2023): The Development of Global Halal: Issues and Challenges
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jhpr.vol.6-issue.1.1-10

Abstract

Bagi seorang muslim status halal suatu produk pangan maupun non-pangan harus terpenuhi secara mutlak, begitu juga dengan produk kosmetik. Kosmetik terdiri dari berbagai bahan dan yang menjadi titik kritis status kehalalan suatu produk kosmetik adalah kompleksitas komposisi produk kosmetik yang memungkinkan penggunaan bahan dasar yang berasal dari babi seperti gelatin, asam lemak, gliserin dan kolagen yang mana bahan-bahan tersebut adalah bahan yang sangat umum digunakan dalam pembuatan produk kosmetik. Tujuan dilakukannya penelitian ini adalah untuk untuk mengoptimasi metode isolasi DNA pada beberapa jenis sampel kosmetik untuk uji halal berbasis molekuler. Penelitian dilakukan dalam tiga tahap, yaitu ekstraksi DNA, amplifikasi dan analisis rt-PCR, dan tahap terakhir adalah visualisasi dengan media elektroforesis gel agarose. Optimasi isolasi DNA dilakukan dengan tiga metode yang berbeda, yaitu dengan menggunakan kit isolasi DNA QIAamp® DNA Mini Kit (QIAGEN), isolasi dengan laruta phenol-chlororoform GENEzolâ„¢ (Geneaid), dan menggunakan campuran resin Chelex-TE 10%. Hasil menunjukkan bahwa metode isolasi terbaik dari ketiga metode yang dilakukan adalah metode isolasi DNA dengan menggunakan QIAamp® DNA Mini Kit (QIAGEN) yang mana berdasarkan visualisasi elektroforesis metode ini dapat mengisolasi DNA dari semua sampel.
Genetic Variation Analysis of L1 gene HPV-16 using RFLP in Silico Afionita, Santi; Putri, Dwi Hilda; Achyar, Afifatul; Yuniarti, Elsa
Jurnal Biologi Tropis Vol. 25 No. 2 (2025): April-Juni
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i2.8415

Abstract

Human papillomavirus (HPV) is one of the leading causes of cervical cancer, with the L1 gene playing an important role in vaccine development. This study aims to analyze the genetic variation of the L1 gene of HPV types 16, 18, 52, and 58 using the RFLP method in silico by utilizing restriction enzymes. The results showed that. The pattern of genetic conservation is more dominant in HPV 16 and 52 than other types, indicating the potential important role of the L1 gene in vaccine development. This study confirms the importance of analyzing genetic variation to understand HPV genetic diversity. These results may contribute to the development of more specific vaccines and molecular markers for HPV detection.
ANALISIS POHON FILOGENETIK GEN ITS1 Amanita muscaria DARI BERBAGAI NEGARA Mutia Andini, Tri; Achyar, Afifatul
Jurnal Biogenerasi Vol. 10 No. 2 (2025): Volume 10 no 2 periode februari - september 2025 ( continues)
Publisher : Universitas Cokroaminoto Palopo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30605/biogenerasi.v10i2.5799

Abstract

The purpose of this study is to determine the genetic diversity of the ITS1 gene from Amanita muscaria originating from various countries and create a phylogenetic tree based on ITS1 gene data to show the evolutionary relationship and distribution history of Amanita muscaria in various countries.The method used in this study is the Neighbor-Joining Method which is used to construct phylogenetic trees quickly and efficiently. Bootstrap tests (10,000 replicates) indicate the confidence level of the tree branches. Evolution was calculated using the Maximum Composite Likelihood method. The analysis involved 13 nucleotide sequences and was performed with MEGA11 software. The results of this study are The phylogenetic tree of Amanita muscaria shows two main clades with bootstrap values of 27 and 39, which reflect the level of confidence in the group of specimens. The first clade with a value of 27 includes specimens AB096048.1, AJ549964.1, AB080778.1, AB081295.1, and LN877747.1, while the second clade with a value of 39 includes AB015700.1, AB081294.1, AB080779.1, and AB080983.1. The branch with a bootstrap value of 63 shows greater genetic diversity. Specimens AB096048.1 and AJ549964.1 and AB080777.1 and AB096052.1 have very close evolutionary relationships.
Co-Authors Afionita, Santi Ahmad Hambali, Ahmad Ahmad Wibisana, Ahmad Alvenaya Hindayageni Ananda Putri, Ananda Annisa Irna Putri Annisa Khaira Annisa Khaira Annisa, Silvy Aprilia, Amanda Ara, Farrah Azzahra Ardi Ardi Atifah, Yusni Aura Zahra Nafisah Azizah, Jalilah Bintang Fadhil Ramadhan Cici Mustika cynthia perdana putri Dara Suci Amini, Dara Suci Des M Dezi Handayani Dezi Handayani Dina Sukma Dwi Hilda Putri Dwi Hilda Putri Dwi Hilda Putri Edwin Edwin Elsa Badriyya Elsa Yuniarti Elviana, Alifah Hazelia Fadhila Humaira Fardilla, Midratul Fatiha, Fathma Dwi Fevria, Resti Fitri, Afifah Ismu Fronica, Imelda Gilang Amanda Hafizah Fadhilah Hafizh Alza Afra Helsa Rahmatika Herisanti, Dini Irma Leilani Eka Putri Iyan Robiansyah Iyan Robiansyah Jalilah Azizah Jumatul Hafsah Kardiman, Reki Khairani, Fidia Aura Linda Advinda Marten, Threo Wanda Monica , Indiastri P Moralita Chatri Muhammad Farikh Muharani, Silvia Mukhlis Mukhlis Mutia Andini, Tri Nabilah, Rezi Nadira Nafisa Arini Nella Fauziah Novita, Yeni Nur Aqsha Nurfadillatun Nisa Wijaya Nurul Hasanah NURUL HIDAYAH Oliv Nurul Kanaya Nurul Kanaya Palupi, Indria Pinta, Sari Rahma Pradila, Andini Novalia Pramila, Cindy Pratama, Chelsylia Dara Pratama, Sandi Fransisco Pryatna, Muhamad Zacky Putri, Aulia Devani Putri, Irma Leilani Putri, Isna Aryunita Putri Putri, Santi Diana Putrizalda, Hafizhah Rahmad Wanizal Pastha Rahmawati, Atika Ayu Rahmi Holinesti Rezeki Rival Alridho Rezi Nabilah Ria Fernanda, Irma Rijal Satria Rijal Satria Rini Wulandari Rinti Mutiara Sari Riza Umami Roza, Sri Yenica Ruri Fitriyani Ruri Fitriyani S. Syamsurizal safitri, fira Salsabil, Velina Salsabilla, Vishtari Sari Rahma Pinta Sari, Rinti Mutiara Satria, Rijal Sefina, Nadia Selaras, Ganda Hijrah Sisca Alicia Farma Suryani, Elisa Vauzia Vauzia Vauzia, Vauzia Velina Salsabil Violita Violita Violita Violita Violita Violita Violita Yulita, Nelfi Yuni Ahda Yuni Ahda Zultsatunni’mah Zultsatunni’mah Zulyusri Zulyusri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri, Zulzusri