Article Per Year (5 Year)
p-Index From 2021 - 2026
7.64
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Agronomi Indonesia (Indonesian Journal of Agronomy) Jurnal Hortikultura Indonesia (JHI) METAMORFOSA Journal of Biological Sciences Kolaboratif AL KAUNIYAH Jurnal Biologi Universitas Andalas Jurnal Riset Kimia Biocelebes Kultivasi Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis Jurnal Agrotek Tropika BIOEDUSAINS: Jurnal Pendidikan Biologi dan Sains Agritrop : Jurnal Ilmu-Ilmu Pertanian (Journal of Agricultural Science) Jurnal Hilirisasi IPTEKS (JHI) Agro Bali: Agricultural Journal BERNAS: Jurnal Pengabdian Kepada Masyarakat Jurnal Pengabdian kepada Masyarakat Nusantara Bioscientist : Jurnal Ilmiah Biologi Dharma: Jurnal Pengabdian Masyarakat Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat Eduvest - Journal of Universal Studies Jurnal Pengabdian Harapan Ibu (JPHI) AGRIC Jurnal Biosilampari: Jurnal Biologi
Zozy Aneloi Noli
Departemen Biologi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Andalas
Religion Aerospace Engineering Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Earth & Planetary Sciences Economics, Econometrics & Finance Education Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Veterinary Other

Published : 91 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 91 Documents
Search

 1   2   3   4   5 
Pemberian Beberapa Jenis Dan Konsentrasi Auksin Untuk Menginduksi Perakaran Pada Stek Pucuk Bayur (Pterospermum javanicum Jungh.) Dalam Upaya Perbanyakan Tanaman Revegetasi Agusti Apriliani; Zozy Aneloi Noli; Suwirmen Suwirmen
Jurnal Biologi Universitas Andalas Vol 4, No 3 (2015)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.4.3.%p.2015

Abstract

The research on effect of types and concentration of auxin on root induction of apical shoots Bayur (Pterospermum javanicum jungh.) in attempt to propagate of revegetation plants was conducted from May to August 2015 in the Nursery and Greening of Andalas University, and Laboratory of Plant Physiology Department of Biology, Faculty of Mathematics and Natural Sciences, Andalas University. The aimed to know the response of apical shoots Bayur (P. javanicum) on  root induction by providing some type and concentration of Auxin. This research used method of Complete Randomized Design (CRD) with seven treatments and three replications. The treatments consist of control, IBA 100 ppm, IBA 200 ppm, NAA 100 ppm, NAA 200 ppm, IAA 100 ppm, IAA 200 ppm. The result of this study showed that there was no respons of any treatments in inducing root of  apical shoots of Bayur (P. javanicum).Keywords: Auxin, Pterospermum javanicum, revegetation, root induction
Induksi Kalus Tanaman Puspa (Schima wallichii (DC.) Korth) dengan Penambahan Beberapa Konsentrasi Benzyl Amino Purin (BAP) dan 2,4-Diklorofenoksiasetat (2,4-D) Husri Meli; Zozy Aneloi Noli; Suwirmen Suwirmen
Jurnal Biologi Universitas Andalas Vol 7, No 1 (2019)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.7.1.1-5.2019

Abstract

The research about Callus Induction of Puspa (Schima wallichii (DC.) Korth) with several concentrations addition of Benzyl Amino Purine (BAP) and 2,4-Dichlorophenoxyacetid acid  (2,4-D) had been done from October until November 2016 at Plant Physiology dan Tissue Culture Laboratory, Biology Department, Faculty of Mathematics and Natural Science, Andalas University. The aim of this researh is to get the combination of 2,4-D and BAP to induce the best callus of Schima wallichii. This research used a Completely Randomized Design Method with 10 treatments and 3 replications. The result showed that combination of 2 ppm 2,4-D + 0,75 ppm BAP was the best concentration to induce callus of Schima wallichii.
The Growth of Shoot Cutting of Ant-nest Plant (Myrmecodia pendens Merr. & L.M. Perry) that Planted in Various Planting Medium Suci Rahmadani Putri; Suwirmen Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 7, No 2 (2019)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.7.2.91-99.2019

Abstract

The research about The Growth of Shoot Cutting of Ant-nest Plant (Myrmecodia pendens Merr. & L.M. Perry) that Planted in various planting medium was held from May until August 2018 in Greenhouse and Plant Physiology Laboratory, Department of Biology, Faculty of Mathematics and Natural Science, Andalas University, Padang. The aim of this research was to find out the effects of various planting medium to the growth of shoot cutting Ant-nest Plant. This research used Completely Randomized Design (CRD) with five treatments (sand, husk charcoal, media moss, coconut fiber and fern’s root) and six replications. The results showed that shoot cutting that planted in sand, husk charcoal and fern had a highest life percentage (100%). Shoot cutting that planted in coconut fiber showed a highest height accretion. Shoot cutting that planted in media moss showed the highest root amount, longest root length and containing clorophyl level.
Induksi kalus Artemisia vulgaris L. dengan Pemberian Beberapa Konsentrasi 2,4-Dichlorophenoxyacetic Acid(2,4-D) Nazhira - Fadhilah; Zozy Aneloi Noli; Suwirmen - Suwirmen
Jurnal Biologi Universitas Andalas Vol 4, No 4 (2015)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.4.4.216-222.2015

Abstract

The research about callus induction Artemisia vulgaris L. by giving several concentration 2,4-Dichlorophenoxyacetic acid (2,4-D), has been done from May to August 2015 in Plant Physiology Laboratory and Tissue Culture, Department of Biology, Faculty of Mathematics and Natural Science, University of Andalas. The aim of this studywas found the effective concentration of 2,4-D to induce callus of A. vulgaris. The research used Completely Randomized Design (CRD) with 7 treatments and 4 replications. The treatments were : without 2,4-D (control); 0.25 mg/L 2,4-D; 0.50 mg/L 2,4-D; 0.75 mg/L 2,4-D; 1.00 mg/L 2,4-D; 1.25 mg/L 2,4-D; 1.5 mg/L 2,4-D. The result showed that 0.25-1,5 mg/L 2,4-D were able induction callus of A. vulgaris, withcompactuntilthefriabletexture, color ofthe resultingcallusisyellowish green, brownish-green, yellow-brown, whiteyellowishandgreenishwhite. 2,4-D 1.5mg/Lwas the best concentrationto increase fresh weight of callus.
Pengaruh Ekstrak Daun Tumbuhan Mikania micrantha Kunth. (Invasif) dan Cosmos sulphureus Cav. (Non Invasif) Terhadap Perkecambahan Jagung (Zea mays L.) Ayu Utami Rezki; Suwirmen Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 6, No 2 (2018)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.6.2.79-83.2018

Abstract

The Research about the effects of extract from the invasive plant leaves of Mikania micrantha Kunth. and non-invasive plant leaves of Cosmos sulphureus Cav. on the germination of corn (Zea mays L.) has been conducted in July 2016 in Plant Physiology and Tissue Culture Laboratory, Biology Department, Mathematics and Natural Science Faculty, Andalas University, Padang. The aim of this research was to compare the effect of extract from the leaves of plants M. micrantha and C. sulphureus with several concentrations on the germination of corn. The research used experimental method with Completely Randomized Design (CRD) on Nested, 9 treatments and 4 replications. The treatments were factor A (type of plants, a1= Mikania micrantha and a2= Cosmos sulphureus) and factor B (leaf extract concentration, b0= 0%, b1= 20%, b= 40%, b3= 60%, b4= 80%). The results showed that the extract of the leaves from M. micrantha affected to reduced the fresh weight plants at concentration of 20%, where as in leaf extract of C. sulphureus affected to reduced the fresh weight plants at concentration of 40%.
TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO Sumaryati Syukur; Zozy Aneloi N; Femilya Putri
Jurnal Riset Kimia Vol. 2 No. 2 (2009): March
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v2i2.156

Abstract

 ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and  TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard.  Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin    
PEMANFAATAN SAMPAH ORGANIK KOTA SEBAGAI BAHAN DASAR PUPUK ORGANIK CAIR (POC) UNTUK PERTUMBUHAN Lactuca sativa L.var. crispa DENGAN SISTEM VERTIKULTUR Eka Muliani; Zozy Aneloi Noli; Periadnadi Periadnadi
Metamorfosa: Journal of Biological Sciences Vol 4 No 2 (2017)
Publisher : Prodi Magister Ilmu Biologi, Fakultas MIPA, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/metamorfosa.2017.v04.i02.p03

Abstract

Pemanfaatan kembali sampah organik sebagai bahan dasar pupuk organik cair (POC) merupakan salah satu cara dalam mengatasi permasalahan sampah terutama di perkotaan. POC yang dihasilkan dapat digunakan untuk meningkatkan pertumbuhan tanaman, seperti Lactuca sativa var. crispa (selada merah). Penelitian ini dilakukan untuk mengetahui pengaruh konsentrasi POC berbahan dasar sampah organik kota terhadap pertumbuhan selada merah yang ditanam dengan sistem vertikultur. Penelitian dilakukan dengan mengunakan Rancangan Acak Kelompok (RAK) yang terdiri dari 5 perlakuan dan 5 kali ulangan. Perlakuan adalah konsentrasi POC (0%, 10%, 20%, 30% dan 40%). Hasil penelitian menunjukkan bahwa konsentrasi POC memberikan pengaruh yang berbeda nyata terhadap tinggi tanaman, jumlah daun baru, luas daun, berat basah dan kadar klorofil total selada merah tetapi tidak berpengaruh nyata terhadap berat kering tanaman. Konsentrasi POC terbaik untuk pertumbuhan selada merah adalah 10%.
PENGARUH KONSENTRASI IBA TERHADAP KEMAMPUAN BERAKAR SETEK PUCUK Alstonia scholaris (L.) R. Br. SEBAGAI UPAYA PENYEDIAAN BIBIT UNTUK REVEGETASI Tiara Tiara; Zozy Aneloi Noli; Chairul Chairul
Metamorfosa: Journal of Biological Sciences Vol 4 No 1 (2017)
Publisher : Prodi Magister Ilmu Biologi, Fakultas MIPA, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/metamorfosa.2017.v04.i01.p05

Abstract

Alstonia scholaris (L.) R. Br. is an indigenous plant species in Indonesia which has been use for multiple purposes. This plant tolerant to poor nutrient and alkaline soil, therefore it is potential to explore as a revegetation plant. The study was conducted to identify effect of IBA concentrations on rooting ability of A. scholaris shoot cutting. Plant materials (shoot cutting) were collected from trubusan in Mandeh Area, Tarusan, West Sumatra. This study used Completely Randomized Design (CRD). The treatment was IBA concentrations (0 ppm, 50 ppm, 100 ppm, 150 ppm and 200 ppm). The result showed that IBA concentrations was significant different (P ? 0,05) for length, fresh weight and dry weight of root. The application of 150 ppm IBA was the best concentration to enhance the rooting ability of A. scholaris shoot cuttings.
Induksi Akar dan Pertumbuhan Stek Pucuk Jirak (Eurya acuminata DC.) dengan Pemberian Beberapa Zat Pengatur Tumbuh Pada Berbagai Media Tanam Tressa Pratywi Gupitasari; Zozy Aneloi Noli; Suwirmen Suwirmen
Metamorfosa: Journal of Biological Sciences Vol 6 No 2 (2019)
Publisher : Prodi Magister Ilmu Biologi, Fakultas MIPA, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/metamorfosa.2019.v06.i02.p19

Abstract

The research about roots induction and growth of shoot cutting of Jirak (Eurya acuminata DC.) by adding some growth regulator solutions in various planting medium, was conducted from May until August 2017 in Greenhouse and Plant Physiology Laboratory, Department of Biology, Faculty of Mathematics and Natural Science, Andalas University. The aims of the research to find out effect of providing growth regulator solution with different types, used of planting medium and interaction of both factors the best to roots induction and growth Jirak (E. acuminata DC.) by cutting. The research used Complete Randomized Design (CRD) factorial with two factors and three replications. Factors A were growth regulator solution (a0: control, a1: IBA 100 ppm, a2: NAA 100 ppm, a3: IAA 100 ppm) and factors B were various planting medium (b0: garden soil, b1: sand, b2: charcoal husk). The research result were adding some growth regulator solutions and various planting medium significanly affected roots induction and growth of jirak and there is interaction on the high of plant. The treatment of 100 ppm IAA and treatment using sand medium obtain the highest result in increasing roots induction and growth of shoot cutting of Jirak.
STUDI ANATOMI DAUN CANTIGI (Vaccinium korinchense Ridl.) PADA ALTITUD BERBEDA DI GUNUNG TALANG Alponsin Alponsin; Tesri Maideliza; Zozy Aneloi Noli
Metamorfosa: Journal of Biological Sciences Vol 4 No 1 (2017)
Publisher : Prodi Magister Ilmu Biologi, Fakultas MIPA, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/metamorfosa.2017.v04.i01.p17

Abstract

The study about leaf anatomy of Bilberry (Vaccinium korinchense RILD.) at altitude gradient on the Talang Mountain has been carried out in October to December 2015. The goal research is to compared that leaf thick tissues Bilbellry at altitude gradient. The sample were collected at Talang Mountain. The research used survey method and purpossive sampling with five altitude gradient (2200-2529 meter above sea level). Leaf section was maked at the Plant Structures developments Laboratory, Department Biology, Faculty of Mathematics and Natural Sciences, Andalas University. Data analysis used Kruskal-Wallis test. The results showed that leaf thickness, palisade and spongy thickness various between altitudes is sequentially 434-685 ?m, 183-322 ?m and 175-283 ?m . While epidermis thickness and cuticle thickness did not differ significantly between altitudes.
Co-Authors . Mansyurdin A. Fadhil Desafa Abdullah Muhammad Faathir Adam Raihan Priambada Adelia, sabbrina Aditya Gufashar Adrial, Rico Afdhal Muttaqin Afifah Hulwah Agusti Apriliani Alimin Mahyudin Alponsin Alponsin Andhini Aurellyta Ridwan Anita Sari Anita Tri Astuti Anthoni Agustien Arif Budiman Arli, Naura Muthiah Asih Maharani Asih, Enda Tarni Asnul Fitria Astuti Aulia Suci Desila Aulia, Annisa Aulya, Nailul Rahmi Ayola Pajrita Ayu Utami Rezki Azharia Khalida Chairul Chairul Chairul Chairul Cleopatra Dahyunir Dahlan De Yudanur, Parissa Anandita Dedi Mardiansyah Dehan Fahresta Delfi, Shyla Aulia Dezi Meutya Dapersal Dian Fitriyani Diana Fadhilah Dilla, Arfa Iskhia Dinya Khairani Aisa Tumanggor Djong Hon Tjong Dola Ratna Yulizar Dwi Pujiastuti Dwi Puryanti Dwisari Dillasamola Efrizal Efrizal Efrizal Efrizal Eka Muliani Elfans Bawalsyah S.A. Elvaswer Elvina Sari Emelta, Citra Endah Mutia Sari Fajrisani, Syifa Fashelia Azizaturrahmah Feby Zulya Femilya Putri Fera Malta Feriska Handayani Ferry Lismanto Syaiful Feskaharny Alamsjah Fiqi Diyona Fira Julia Putri Fitri, Arya Wisata Gian Wulandari Gita Prima Yudha Habib Shidiq Akbar Haldis Alvaro Hany, Iga Permata Helsya Vellarentika Labukti Hesti Dwi Marcellinna Husri Meli Iga Permata Hany Ilham, Kurniadi Imam Taufiq Iva Rama Fitria Ivo Octaviani Izmiarti Izmiarti, Izmiarti Julita Julita khairunnisa, kania Kiki Ayunda Putri Kurniadi Ilham Larisa Aurellia Vilonia Liza Febriani Sukma Lubis, Amelia Sriwahyuni Lufri Lufri Lusi Octaviana M. Ali Shafii M. Idris M. Teguh Dhiya Ulhaq Mairawita Mairawita, Mairawita Maliza, Rita Marta Linda Marta, Fepi Dwi Maulana, Zakiy Mayola Arda Media Media Media, Media Meqorry Yusfi Miftah Mussaumi Adi Mildawati Mildawati Mildawati Millania Putri Shayen Millania Putri Shayen Muhammad Abdul Najib Muhammad Aidi Satryo Muhammad Azwar Muhammad Fazly Muhammad Hanafi Muhammad Idris Muhammad Rahil Dief Nadhira Yuri Maharani Naura Muthiah Arli Naura Muthiah Arli Nazhira - Fadhilah Nini Firmawati Nopiyanti, Tita Novia Rika Deli Novita Sari Nur, Fauziah Nurhafitri, Amanda Nurwijayanti Olly Norita Tetra Pasha, Gusti Ari Afrilya Periadnadi Periadnadi Prima Fauziah Haq Puspita, Ayumi Rizci Puti Khairunnajwa Amar Putra Santoso Putri Aliyyanti Putri Seti Ayu Putri, Mellanie Alia Putri, Suci Indah Rahma Devi Rahmayati, Riesca Salsabilah Ramacos Fardela Resti Rahayu Reswita Reswita Reza Oktavia Riesca Salsabilah Rahmayati Rilwan Efendi Rismayani, Dessy Rizqa Zidna Chairafahmi Rusiati, Anisa Rahman Saniya De Nafisa Santhyami Santhyami Sari, Melda Yunita Shayen, Millania Putri Sherin Dien Salsabila Siagian, Marhamah Solfiyeni Solfiyeni Sri Handani Suci Rahmadani Putri Sumaryati Syukur Suwirmen Suwirmen, Suwirmen Syabila, Hutri Dinda Tesri Maideliza Tesri Maideliza Tiara Tiara Tita Nopiyanti Titiek Rukmini Trengginas Eka Putra Tressa Pratywi Gupitasari Uce Lestari Vika Permata Gustam Wenny Rahma Gusni Widya Faizatul Zuhri Yanti, Irda Yella Prastika Yuda Yossi Eka Saputri Yudistio Arnoza Yufri Aldi Yulianti, Sisi Zainini Arraysa Zulfi Zulkarnain, Alivia