Claim Missing Document
Check
Articles

UJI EFEKTIVITAS MIKROBA ANTAGONIS TERHADAP PATOGEN PENYEBAB BUSUK BUAH KAKAO SUDARMA, I MADE; SUSANTA WIRYA, I G. N. A.
AGRITROP Vol. 28, No. 3 September 2009
Publisher : AGRITROP

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Pod rot disease in cacao (Theobroma cacao) caused by Phytophthora palmivora has been loss until 90%. The major economic loss is from infection of the pod. Pods can be infected at any age, but most significant economic loss arises from infection during the two months prior to ripening. Pod infected at this stage can be a total loss because the fungus can easily pass from the pod husk to the seed-coat of the bean in a cacao still be convergent only at usage of synthetic pesticide. Therefore need to be searched other alternative to control the disease, namely by exploiting antagonist microbe. Research has been done in Laboratory of Microbiology and Microbial Pesticide, Department of Agroecotechnology, Faculty of Agriculture, Udayana University, Jl. PB. Sudirman Denpasar, from April until October 2007. There are three research phases done like : 1) insulation pathogen cause of disease, 2) antagonist microbe inhibitory activity test to growth of pathogen in vitro, and 3) inhibitory activity test free cell antagonist microbe to growth of pathogen in vitro. Result of research shows, found two species pathogen cause of pod rot disease of cacao namely Phytophthora sp. (A) and Phytophthora sp. (B). Based on result of examination out of four antagonist microbes tested like Trichoderma sp.; Saccharomyces sp.; Pseudomonas fluorescens and Bacillus sp., that is most effective in depressing pathogen is Trichoderma sp. with inhibitory activity equal to 83,98% to Phytophthora sp. (A) and 82,18% to Phytophthora sp. (B) at PDA media. Secondary metabolite released by fourth of antagonist microbe depress both pathogen cause of pod rot disease of cacao at PDA media.
Pengendalian Penyakit Layu Fusarium pada Tanaman Cabai Besar (Capsicum annuum L.) dengan Kompos dan Pupuk Kandang yang dikombinasikan dengan Trichoderma sp. di Rumah Kaca SUTARINI, NI LUH WAHYU; SUMIARTHA, I KETUT; SUNITI, NI WAYAN; SUDIARTA, I PUTU; WIRYA, G.N.ALIT SUSANTA; UTAMA, MADE SUPARTHA
Jurnal Agroekoteknologi Tropika (Journal of Tropical Agroecotechnology) Vol.4, No.2, April 2015
Publisher : Program Studi Agroekoteknologi, Fakultas Pertanian, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRACT Utilization of Trichoderma sp. combined with compost and manure to controlling Fusarium wilt disease on long chilli (Capsicum annuum L.) in greenhouse This study aims to determine the effectiveness of Trichoderma sp. combined with compost and manure to controlling Fusarium wilt disease in long chilli (Capsicum annuum L.). Laboratory studies conducted at the Laboratory of Plant Pathology Faculty of Agriculture, University of Udayana and field research conducted in the greenhouse in the village Pancasari Sukasada Buleleng Subdistrict. The experimental design used was completely randomized designs (CRD) with five treatments were repeated 5 times, each treatment consisted of 5 polybag. The treatments used in this study are Po: control (soil + F. oxysporum f.sp. capsici treatment); P1: compost + soil + F. oxysporum f.sp. capsici; P2: compost + Trichoderma sp. + soil + F. oxysporum f.sp. capsici; P3: cow manure + Trichoderma sp. +  soil  + F. oxysporum f.sp. capsici; and P4: chicken manure + Trichoderma sp. + soil  + F. oxysporum f.sp. capsici The results showed that treatment of Trichoderma sp. able to inhibit the growth of F. oxysporum f.sp. capsici with a percentage of 86.05% when compared to the control treatment at 7 days after inoculation observation in vitro. Application of Trichoderma sp. in compost and manure (cow manure and chicken) were able to suppress Fusarium wilt disease in the greenhouse with the lowest percentage of disease were in P3 and P4 treatment by 4.0% in the observation of 16 week after planting compared with 48.0% of control. Further, the application of Trichoderma sp. in compost and manure (cow manure and chicken) have yields greater than the control (soil without Trichoderma sp.) Keywords: Trichoderma sp., F. oxysporum f.sp. capsici, long chili (Capsicum annuum L.), compost, cow manure, chicken manure
Laporan Pertama Infeksi Begomovirus pada Tanaman Mentimun di Bali I Dewa Made Putra Wiratama; Gusti Ngurah Alit Susanta Wirya; I Dewa Nyoman Nyana; Ni Nengah Putri Adnyani; Gede Suastika
Jurnal Fitopatologi Indonesia Vol 11 No 5 (2015)
Publisher : The Indonesian Phytopathological Society (Perhimpunan Fitopatologi Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (471.773 KB) | DOI: 10.14692/jfi.11.5.175

Abstract

Leaf yellowing symptoms was commonly found in cucumber plants in Bali provinces, i.e. in Apuan and Bangli villages recently. Begomovirus infection is suspected as the causal agent, due to similar symptoms previously reported from cucumber plants in Java. In addition, Bemisia tabaci was observed in the field. The objective of this research was to identify the causal agent of leaf yellowing disease of cucumber in Bali. Virus detection and identification was conducted by polymerase chain reaction method using universal primers for Begomovirus, i.e. SPG1/SPG2. DNA fragment of 912 bp in size was successfully amplified from leaf samples. Analysis of nucleotide sequencing indicated that Begomovirus infecting cucumber plants in Bali has the highest homology (91%) with Squash leaf curl China virus (SLCCNV) isolate from Malaysia. This is the first report of SLCCNV infection in Bali.
Penyakit Layu Bakteri Stewart pada Jagung di Bali I Gede Rai Maya Temaja; G.N. Alit Susanta Wirya; Ni Made Puspawati; Khairun Nisak Syahdu
Jurnal Fitopatologi Indonesia Vol. 13 No. 5 (2017)
Publisher : The Indonesian Phytopathological Society (Perhimpunan Fitopatologi Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (414.406 KB) | DOI: 10.14692/jfi.13.5.184

Abstract

Stewart’s wilt is a serious disease of sweet corn (Zea mays). The typical symptoms of the disease are pale-green to yellow linear streaks parallel to the veins. The symptoms were observed on sweet corn in Denpasar, Tabanan, Gianyar, and Karangasem areas during a survey in 2015. Pathogen detection based on a polymerase chain reaction was carried out using total DNA obtained from symptomatic leaf samples and the pairs of primers, CPSL1/CPSR2c. The expected sized (~1100 bp) amplicon was detected in samples from Denpasar. Sequence analysis confirmed that Stewart’s wilt disease symptoms are caused by Pantoea stewartii subsp. stewartii. Nucleotide sequence and phylogenetic analysis showed that P. stewartii subsp. stewartii from Bali has high homology (98.97-99.08 %) and placed in the same clade with isolates from Canada, USA and Japan. This is the first report of P. stewarti subsp. stewartii on corn in Bali.
MOLECULAR IDENTIFICATION OF FUNGI THE CAUSAL AGENT OF STRAWBERRY WILT DISEASE IN BALI Gusti Ngurah Alit Susanta Wirya; I Wayan Diksa Gargita; I Putu Sudiarta
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (385.19 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p02

Abstract

The development of strawberry farming in Bali experiencing some obstacles that cause a decline in production, such as wilting disease. The disease was reported caused by the fungi base on morphological recognition. There are two fungi were recognized caused the strawberry wilt disease in Bali, they are from genus Verticillium and Fusarium. More specific information about causal agent of wilt disease in strawberry especially in Bali is needed. The one accurate identification is done through the molecular approach by analyzing DNA that encode the ribosomal DNA (rDNA). The 18S rDNA, including the internal areas of transcribed spacers (ITS), ITS1 and ITS4 have been widely used in phylogenetic studies. The amplification results of this area produce bands in different sizes that can be used to identify fungal species. Based on that the identification of strawberry wilt disease using molecular analysis was conducted. The 542 bp of Internal Transcribed Spacer (ITS) DNA was successfully amplified using PCR with pairing primers ITS 1 (5-TCCGTAGGTGAACCTGCGG-3’), and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’). The sequences of three isolates were successfully obtained through sequencing. Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Based on phylogeny analysis of Pancasari, Gobleg and Candi Kuning isolates were obtained in one group with Fusarium oxysporum identified in America and Brazil, and also in one group with Fusarium oxysporum f. sp. fragariae that identified in China.
IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA Ni Putu Merthaningsih; I Putu Sudiarta; Gusti Ngurah Alit Susanta Wirya
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (272.586 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p01

Abstract

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.
APLIKASI TEKNOLOGI PEMBUATAN PUPUK ORGANIK PLUS UNTUK MENINGKATKAN PRODUKTIVITAS GAPOKTAN UMA DESA KABUPATEN I.G.R.M. temaja; G.N.A.S. Wirya; N.L.G. Sumardani
Buletin Udayana Mengabdi Vol 17 No 1 (2018): Buletin Udayana Mengabdi
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (425.432 KB) | DOI: 10.24843/BUM.2018.v17.i01.p08

Abstract

The short course on organic fertilizer plus was held on Thursday, April 20, 2017 at Simantri 376. There are32 members of Gapoktan Uma Desa participated in this program. The purpose of the short course is toprovide knowledge, understanding and skill to members of Gapoktan about increasing productivity throughthe utilization of bali cattle dung as an organic fertilizer that has higher economic value. The problem solvingmethod is to give theory and practice about formulating fermented organic fertilizer, Trichoderma on carriermedia and organic fertilizer plus. During the delivery of theory and practice the participants' responses werevery enthusiastic, so the discussion took place actively
TEKNIK DAN MANAJEMEN PRODUKSI BIBIT SAPI BALI DI SUBAK KACANG DAWA DESA KAMASAN KLUNGKUNG N.L.G. Sumardani; I.G.R. Maya Temaja; G.N.A. Susanta Wirya; N.M. Puspawati
Buletin Udayana Mengabdi Vol 16 No 3 (2017)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (259.841 KB)

Abstract

Penyuluhan dan pelatihan mengenai manajemen produksi peternakan dan pemanfaatan Inseminasi Buatan (IB) pada ternak sapi bali telah dilaksanakan pada tanggal 9 Oktober 2016 di Simantri 451 Sedana Murti Desa Kamasan, Kabupaten Klungkung. Kegiatan ini diiukuti oleh 15 petani yang tergabung dalam kelompok petani Simantri 451 Sedana Murti. Hasil dari kegiatan ini adalah peningkatan produksi bibit sapi bali dengan menerapkan program IB. Metode yang digunakan dalam kegiatan ini meliputi diskusi mengenai pembibitan, manajemen kesehatan ternak, program IB, dan praktek langsung mengenai IB pada sapi bali. Dari kegiatan ini dapat disimpulkan bahwa peserta penyuluhan dan pelatihan sangat antusias dalam menerima materi mengenai IB pada sapi bali.
PELATIHAN PENGENDALIAN PENYAKIT TUNGRO DAN BLAS PADA TANAMAN PADI DI SUBAK BASANGKASA IGRM TEMAJA; M SUDANA; IP SUDIARTA; GNA SUSANTA WIRYA; NM PUSPAWATI
Buletin Udayana Mengabdi Vol 14 No 1 (2015): April 2015
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (758.594 KB)

Abstract

Training on tungro and blast diseases was held at Subak Basangkasa, Kerobokan village, Badung regency onApril 27, 2014. The activities was conducted to educate farmers how to control tungro and blast diseases. Themethods used in this activity were lectures, demonstration and practice in the paddy field. The training wasattended by 30 participants from local farmer groups of Subak Basangkasa. Based on post test, more than 90% ofthe farmers managed to answer the questions about tungro and blast diseases, including pathogens, symptoms ofdiseases, factors affecting the growing of diseases as well as the control of diseases. The data indicated on the finalof training all participants completely understand about the topics. All participants participated enthusiasticallyand hope they have the next intensive training again.Key words :disease control, tungro disease, blast disease, trainin
EFIKASI MINYAK ATSIRI TANAMAN CENGKEH (Syzygium aromaticum (L.) Meer. & Perry), PALA (Myristica fragrans Houtt), DAN JAHE (Zingiber officinale Rosc.) TERHADAP MORTALITAS ULAT BULU GEMPINIS DARI FAMILI LYMANTRIIDAE Made Mika Mega Astuthi; Ketut Sumiartha; I Wayan Susila; Gusti Ngurah Alit Susanta Wirya; I Putu Sudiarta
Journal of Agricultural Science and Biotechnology Volume 1, No 1, Tahun 2012
Publisher : Journal of Agricultural Science and Biotechnology

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (139.32 KB)

Abstract

The analysis of efficacy of clove oil (Syzigium aromaticum), ginger oil (Zingiber officinale), and nutmeg oil (Myristica fragrans) to hairy caterpillar was conducted. The hairy caterpillar were reported to attack some plants in 2010 to 2011 in Indonesia .To control the caterpillar, recently, peoples used chemical insecticide, however the impact of chemicals insecticide is dangerous to human being, livestock, and environmental. Therefore to minimizing those problems, the control methods should be environmental-friendly and safe against human being. One of those methods is utilizing the botanical pesticide which is extracted from tropical plants. Therefore efficacy of essential oils was done in order to find out the method to control population of it with environmental friendly approach. The experiment result shown at the concentration 10%, all of the essential oils are effective to kill the caterpillar (90-100%). Therefore the examinations of low concentrations of essential oils were conducted (5, 2, and 1%). The result of 1% concentration of ginger oil, nutmeg oil and clove oil are 80 %, 76 % and 68 % respectively.
Co-Authors Abd. Rasyid Syamsuri Agung, I Dewa Agung Putra Anak Agung Istri Kesumadewi ARIYANTA, I PUTU BAWA AStiningsih, Ana Agung Made Chiharu Hongo Damastra, Garda Bagus DEBBIE OKTAVIANI DEPARI Devi, Komang Saraswati Devi, Ni Luh Putu Hartika Sinta Devi, Putu Shinta Dewa Gede Wiryangga Selangga Dewa Gede Wiryangga Selangga Dewa Gede Wiryangga Selangga Dewa Gede Wiryangga Selangga Dewa Ngurah Suprapta Dharmadiatmika, I Made Agus Dinarkaya, Shah Mahapati DWI WIDANINGSIH Eka Wijayanti, Febri Emilia Simpllisiu Ake Wangge GARGITA, I WAYAN DIKSA Gede Mekse Korri Arisena Gede Suastika Gede Suastika GEDE WIJANA GREGORY C. LUTHER Gunadi, Gusti Alit GUSTI AYU DWITA ANDRAWINA H. Yuswanti Hanifah, Wafa’ Nur Hartha , I Komang Gede Suweca HERRY KUSUMA YUDHA HESTIN YUSWANTI I Dewa Gede Raka Sarjana I Dewa Made Putra Wiratama I Dewa Nyoman Nyana I Dewa Nyoman Nyana I DEWA PUTU SINGARSA I G. R. M. TEMAJA I Gede Agus Adi Chandra I Gusti Agung Oka Hendrawati I GUSTI ALIT GUNADI I Gusti Alit Gunadi I GUSTI AYU ARI SANTIKADEWI I GUSTI AYU DEVI VALENIA SARI I GUSTI AYU KARISMAYATI I GUSTI NGURAH PRABU WIRA SANJAYA I GUSTI NGURAH RAKA I KADEK ARYARTHA I KETUT PURNA YASA I Ketut Siadi I KETUT SUMIARTHA I Komang Candra Giri Prayoga I Made Arimbawa I MADE DEDIK SETYADI I MADE SUDANA I Made Sudana I MADE SUDANA I Made Sudana I Made Sudana I MADE SUDARMA I MADE SUDARMA I MADE SUPARTHA UTAMA I MADE WINANTARA I NENGAH ARTHA I NYOMAN DARMA YASA I NYOMAN RAI I NYOMAN WIJAYA I PUTU BAWA ARIYANTA I Putu Sudiarta I PUTU WIRYA SUPUTRA I Wayan Diara I WAYAN RUSMAN I Wayan Susila I.G.A. Gunadi Ida Ayu Putri Darmawati Ida Bagus Gde, pranatayana JOKO MARIYONO K.A. Yuliadhi K.B. Susrusa KESUMADEWI, ANAK AGUNG ISTRI KETUT AYU YULIADHI Ketut Ayu Yuliadhi KETUT BUDI SUSRUSA Khairun Nisak Syahdu Khalimi , Khamdan KHAMDAN KALIMI Khamdan Khalimi Klett, Katrina KOMANG ADI MAHARTHA Komang Adi Mahartha Listihani, Listihani Luciana Delavega LUTFI SURYAWAN M SUDANA Made Getas Pudak Wangi MADE MIKA MEGA ASTUTHI Made Satya Andrayuga Masahiro Shishido Maulinda, Restiana MEI NOVITA BR PARDEDE Mimi Sutrawati Muhammad Ikhsan Nulzaen N.N.A. Mayadewi NI KADEK NINA ARI SUCI NI KADEK SRI UTARI Ni Komang Budiyani Ni Luh Gde Sumardani NI LUH MADE INDAH MURDYANI DEWI Ni Luh Putu Citra Innosensia NI LUH WAHYU SUTARINI, NI LUH WAHYU NI MADE INDRA PUSPAWATI Ni Made Intan Maulina Ni Made Puspawati NI MADE SAVITA RASJMAN NI MADE TRIGUNASIH NI NENGAH DARMIATI Ni Nengah Putri Adnyani NI NYOMAN ARI MAYADEWI NI NYOMAN DWI RESPITA NINGSIH Ni Putu Merthaningsih Ni Putu Pandawani NI PUTU RATIH SUDIARTINI NI WAYAN SUNITI Nyoman Bintang Kartika Sari Pradana, I Kadek Wira Putra, I Gusti Putu Semara Putu Perdana Kusuma Wiguna Regina I. M BanoEt Retno Kawuri Rindang Dwiyani SANJAYA, I GUSTI NGURAH PRABU WIRA Sarjana, Dewa Gede Raka Selangga, Dewa Gede Wiryangga SHAH KANIGARA ASADDIARI Silvano, Jesis SONIA ASHA HASARI SUGIARTA, DWI SUNARI, ANAK AGUNG AYU AGUNG SRI Suputra , I Putu Wirya TRI ASMIRA DAMAYANTI TRISNA AGUNG PHABIOLA TRISNA AGUNG PHABIOLA UTAMA, I WAYAN EKA KARYA Wibisana, I Made Dicky Chandra WIDHIANTHINI WIDHIANTHINI Wigunanda, I Wayan Surya Aditya Wiraatmaja, Wayan Wulandari, Ni Kadek Pingkan Y. Fitriani YUDHA, I KADEK WISMA Yuliadhi , Ketut Ayu Yuyun Fitriani