Claim Missing Document
Check
Articles

Hydroxyapatite Bilayers Coating on Screw Implant Ti6Al4V ELI with Electrophoretic Deposition Method for Improving Osseointegration Juliadmi, Dian; Oktaviana, Dili; Tjong, Djong Hon; Manjas, Menkher; Gunawarman, Gunawarman
Journal of Ocean, Mechanical and Aerospace -science and engineering- Vol 51 No 1 (2018): Journal of Ocean, Mechanical and Aerospace -science and engineering- (JOMAse)
Publisher : International Society of Ocean, Mechanical and Aerospace -scientists and engineers- (ISOMAse)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36842/jomase.v51i1.42

Abstract

Utilization of an alloy titanium (particularly Ti6Al4V), as fracture fixation in biomedical application has restriction because of will associate with osseointegration failure. An effort to titanium coating by hydroxyapatite monolayer still has poor mechanical properties and may lead to implantation failure. Hydroxyapatite bilayers coating aims to protect releasing hazardous ions from implant to the body and improving the osseointegration at the same time. In this research, nanoparticle hydroxyapatite (first layers) and microparticle hydroxyapatite (second layers) were used as coating materials on implant prototype of Ti6Al4V ELI screws. The coating was carried out by electrophoretic deposition (EPD) method used different voltage (2 and 3 volt) for deposition time of 2 and 3 minutes for forming first layers. The process was then continuing for making second layer at 5 and 10 volt for 2 and 5 minutes. In order to intensify of coatings, hydroxyapatite bilayers-coated titanium was air-dried overnight and then sintered at 700oC for 1 hour. The coating layers were characterized by optical microscope, Scanning Electron Microscope (SEM) and thickness gauge series tester. Result of the study show that nanoparticle hydroxyapatite layers are more uniform, thin, dense than microparticle hydroxyapatite layer. Moreover, the second layer shows less adhesion. The obtained voltage and deposition time for best bilayers coating characteristic are 2 volt/3 minutes for nanoparticles hydroxyapatite and 5volt/5minutes for microparticles hydroxyapatite. By approximately 71%-100% surface coverage and 56µm thickness of bilayers coating, that parameters can be considered to improve osseointegration.
Hydroxyapatite Coating on New Type Titanium, TNTZ, Using Electrophoretic Deposition Nuswantoro, Nuzul Ficky; Maulana, Imron; Tjong, Djong Hon; Manjas, Menkher; Gunawarman, Gunawarman
Journal of Ocean, Mechanical and Aerospace -science and engineering- Vol 56 No 1 (2018): Journal of Ocean, Mechanical and Aerospace -science and engineering- (JOMAse)
Publisher : International Society of Ocean, Mechanical and Aerospace -scientists and engineers- (ISOMAse)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (147.205 KB) | DOI: 10.36842/jomase.v56i1.37

Abstract

In order to improve bioactivity of new type of titanium alloy, TNTZ, Hydroxyapatite (HA) coating is applied. Electrophoretic Deposition (EPD) has chosen as coating method because the simplicity of the instrument and its making, inexpensive cost, and ability to coat things with complicated design. EPD used electric current to move the HA particle through electrode in the suspension of ethanol and HA. Desired HA coating quality can be adjusted with optimizing the voltage and coating time. This research aimed to analyzed the effect of voltage and coating time of EPD process toward the HA coating that produced on the surface of new type titanium implant prototype, Ti-29Nb-13Ta-4.6Zr (TNTZ). Voltages are in range of 3, 5, and 7 volt and coating times are in range of 3, 5, and 7 minutes. Based on the result it is known that the best HA coating that can be produced are on 7 minutes and 7 volt. This best result shows the good surface morphology, highest value of screw mass growth, coating thickness, and surface coverage. Enhancement of voltage will affect the surface coverage value of HA coating, however, coating time will affect the thickness. Based on this research it can be concluded that enhancement of the voltage can produced HA coating that spread more evenly that proved by the increasing of surface coverage value. The enhancement of coating time will produce thicker layer of HA coating and increase deposition rate of HA on the implant surface. This result shows that the EPD can be used to produce TNTZ titanium implant that coated with HA for orthopedic application.
DNA Barcoding and eDNA Metabarcoding for Identification Species: A Case Study (West Sumatra): DNA barcoding and eDNA metabarcoding Roesma, Dewi Imelda; Tjong, Djong Hon; Syaifullah, Syaifullah; Nofrita, Nofrita; Janra, Muhammad Nazri; Aidil, Dyta Rabbani; Prawira, Furqan Dwiki Lintang; Salis, Viola Mutiara
Journal of Tropical Life Science Vol. 15 No. 1 (2025)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/

Abstract

The biodiversity of freshwater fish is important to study because there is data and information that remain undiscovered. The waters of Sumatra, especially West Sumatra, are areas with high freshwater fish diversity but have limited information. Providing information and genetic data has become one of the important things to conduct. DNA barcoding and eDNA metabarcoding have become molecular methods for identifying species and providing information about the presence of species in a region. A study using DNA barcoding and eDNA metabarcoding was conducted on freshwater fish in several locations in West Sumatra. Isolation and amplification of DNA were performed directly on individual samples and sequenced using conventional methods (Sanger sequencing) to generate DNA barcodes. Water samples were collected (2 liters) at each location using a sterile bottle. The water samples were filtrated, isolated, and amplified using universal primer and sequenced with next-generation sequencing techniques. The study successfully collected 25 species belonging to 14 genera, 2 families, and 1 order. A total of 134 sequences from West Sumatra with a length of 648-670 bp were analyzed. All DNA barcodes were submitted to the BOLD System and GenBank, NCBI. The mean Kimura two-parameter model (K2P) genetic distances within species, genera, families, and orders were 0.7%, 8.3%, 15.8%, and 21.3%, respectively. The eDNA metabarcoding technique has successfully detected three native fish species in the waters of West Sumatra (Barbonymus schwanefeldii, Mystacoleucus padangensis, and Rasbora jacobsoni). The availability of fish DNA barcodes in reference databases is crucial for the success of identification using eDNA metabarcoding. Combining identification using conventional methods and eDNA metabarcoding can provide more reliable results and become a reference for future freshwater monitoring.
EXPLORATION OF INDIGENOUS BACTERIA WITH POTENTIAL FOR TOTAL AMMONIA NITROGEN DEGRADATION FROM RUBBER WASTEWATER AND PHYLOGENETIC TREE CONSTRUCTION BASED ON 16S rRNA GENE SEQUENCES Melinda, Annisa; Febria, Fuji Astuti; Tjong, Djong Hon
Jurnal Pendidikan Matematika dan IPA Vol 16, No 3 (2025): September 2025
Publisher : Universitas Tanjungpura

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26418/jpmipa.v16i3.93436

Abstract

Rubber wastewater contains total ammonia nitrogen (TAN) at levels that can potentially cause pollution if discharged into water bodies without proper treatment. TAN content is one of the commonly used parameters for assessing water quality. Certain groups of bacteria are capable of naturally degrading TAN in the environment. This study aimed to isolate bacteria from rubber wastewater, evaluate their potential to degrade TAN, and identify the most effective isolate at the molecular level. Samples were collected from wastewater treatment ponds using random purposive sampling based on specific criteria. A survey method was used to determine sampling locations, while experimental methods were applied in the laboratory. Bacterial isolation was conducted using the serial dilution technique, followed by inoculation with the pour plate technique. Pure isolates were obtained using the streak plate technique. The degradation potential of the bacterial isolates was tested by inoculating 10% v/v of each isolate into 200 mL of rubber wastewater, followed by incubation at room temperature for six days. TAN levels were analyzed using the phenate method with a spectrophotometer, following the Indonesian National Standard SNI 06-6989.30-2005. Three bacterial isolates (NS-1, NS-2, and NB-1) were obtained from the rubber wastewater. All three isolates demonstrated potential in reducing TAN levels, with final TAN concentrations after incubation ranging from 6.75 to 4.8 mg/L, corresponding to a reduction of 52.50"“66.90%. The most effective isolate in reducing TAN was NS-2. Molecular identification using the PCR-seq method of the 16S rRNA gene revealed that isolate NS-2 showed 99.86"“99.93% sequence identity with Enterobacter sp. This study provides a basis for the development of bioremediation technologies for rubber wastewater treatment to improve aquatic environmental quality.
EXPLORATION OF INDIGENOUS LEAD (PB)-RESISTANT BACTERIA FROM RUBBER WASTEWATER AS CANDIDATES FOR BIOREMEDIATION AGENTS Putri, Emilya; Febria, Fuji Astuti; Tjong, Djong Hon
Jurnal Pendidikan Matematika dan IPA Vol 16, No 3 (2025): September 2025
Publisher : Universitas Tanjungpura

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26418/jpmipa.v16i3.93437

Abstract

The presence of heavy metals such as lead (Pb) in rubber processing wastewater originates from coagulant materials, vulcanization processes, and raw water contamination. Pb is toxic and persistent, thus requiring proper treatment. This study aims to isolate indigenous bacteria from rubber wastewater that are resistant to Pb and have potential as bioremediation agents. Isolation was performed using the dilution-pour plate method, with selection on a medium containing Pb(NO₃)â‚‚. Resistance tests were conducted at increasing concentrations (100"“350 ppm). Three isolates (IS-1, IS-2, IS-3) were obtained, with IS-3 exhibiting the best growth (μ = 0.641 day⁻ ¹; generation time (G) 1.08 days). Molecular identification of the best bacterial isolate revealed that IS-3 is Pseudomonas protegens. This isolate shows potential as a bioremediation agent for Pb contamination.
Deteksi crypstosporidium sp. pada pasien dengan kanker kolorektal Handayani, Sri Wahyuni; Irawati, Nuzulia; Tjong, Djong Hon; Tofrizal, Tofrizal; Firdamila, Elli
Majalah Kedokteran Andalas Vol. 48 No. 3 (2025): MKA July 2025
Publisher : Faculty of Medicine, Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/mka.v48.i3.p299-308.2025

Abstract

Cryptosporidium sp. adalah parasit obligat intraseluler yang menyerang sel epitel usus. Infeksinya mengakibatkan diare, malnutrisi, dehidrasi dan cedera usus terutama pada orang dengan gangguan imunitas. Tingginya infeksi Cryptosporidium pada pasien HIV-AIDS pada penelitian  sebelumnya menandakan sumber infeksi yang tinggi di lingkungan. Cryptosporidium dilaporkan memiliki hubungan dengan kanker kolorektal baru-baru ini. Tujuan: tujuan penelitian ini adalah untuk mengetahui prevalensi infeksi Cryptosporidium pada pasien dengan kanker kolorektal. Metode: metode yang digunakan observasional dengan desain cross-sectional study pada 43 pasien kanker kolorektal yang sesuai dengan kriteria yaitu pasien yang baru didiagnosis dan belum mendapatkan terapi onkologis. Pengumpulan sampel feses dilakukan dari bulan April hingga Agustus 2023. Pemeriksaan ookista dilakukan secara mikroskopik dengan pewarnaan tahan asam modifikasi ziehl neelsen. Hasil: hasil penelitian didapatkan 46,5% (20/43) pasien positif terinfeksi Cryptosporidium. Kesimpulan: kesimpulan hasil penelitian, infeksi Cryptosporidium tinggi pada pasien kanker kolorektal, terutama pada lokasi kanker rektum. Penelitian lebih lanjut untuk mengetahui spesies Cryptosporidium diperlukan untuk mengetahui  rute penularan dan sumber infeksi.
Differences in Scube1 and Scube2 Gene Expression in Type II Diabetes Mellitus Patients with Dyslipidemia Saputri, Rahmi Agu; Ali, Hirowati; Tjong, Djong Hon; Anggraini, Debie; Yarni, Sisca Dwi
Jurnal Biologi Tropis Vol. 25 No. 4 (2025): Oktober-Desember
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4.9875

Abstract

The Scube1 gene is expressed in atherosclerosis (plaque buildup in blood vessels), while Scube2 is expressed in DIT (Diffuse Intimal Thickening) which is used to describe diffuse thickening of the intima of blood vessels. This study aims to determine the differences in the expression of the scube1 gene in blood samples of type II DM patients with dyslipidemia and type II DM with non-dyslipidemia and differences in the expression of the scube2 gene in blood samples of type II DM patients with dyslipidemia and type II DM with non-dyslipidemia. With a comparative cross-sectional research method, the sample size of this study was determined based on the Lameshow hypothesis test formula which obtained 18 blood samples of type II DM with dyslipidemia, and 18 blood samples of type II DM with non-dyslipidemia. Blood samples of type II DM patients with dyslipidemia and blood samples of type II DM patients without dyslipidemia showed significantly different expression of the scube1 gene, with a p-value of 0.000. Similarly, blood samples from type II DM patients with dyslipidemia and those from type II DM patients without dyslipidemia showed a significant difference in scube2 gene expression (p = 0.001). Thus, it can be said that the expression of the Scube1 and Scube2 genes is significantly influenced by the complications of diabetes mellitus with dyslipidemia. This happens because it is believed that hyperglycemia in type II DM contributes to endothelial cell dysfunction, which occurs prior to blood vessel damage and results in progressively more severe blood vessel problems. Along with hyperglycemia, type II diabetes also results in dyslipidemia, an alteration in the normal lipid profile. Both dyslipidemia and hyperglycemia contribute to macrovascular and microvascular problems in type II diabetes.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Kariotipe Rana chalconota Kompleks yang Terdapat di Sumatera Barat Karyotype of Rana chalconota Complex in West Sumatera Djong Hon, TJONG
Biospecies Vol. 5 No. 2 (2012): Juli 2012
Publisher : Universitas Jambi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/biospecies.v5i2.641

Abstract

ABSTRACT. Study  of  thekaryotypeRanachalconotacomplexin WestSumatrahas  been  carried  out from  April to August  2010. Samples  were  collected  from  HPPBandthen  analyzed at  the Laboratory  of Geneticsand Cytology Biology  Department  of  FMIPA Andalas  University Padang. The  purpose  of  this study is determine thekaryotypeof the frog speciespreviously classified asR.chalconotathen described asRana  rufipes  and Ranaparvaccolain WestSumatra.  The  object  was  prepared by  using airdrying method.  The data  was  analyzed  bythe  statistical  test Mann-Whitney  Utest andWilcoxonU-Statistics. The results showed that the Ranarufipes has 13pairsof the chromosomesconsistingofonepair of the submetacentricchromosomesand12pairs of the metacentricchromosomes. Ranaparvaccolaalsohas 13pairsof  chromosomesconsistingofthree pairs  of  the submetacentricchromosomesand10pairs  of the metacentric chromosomes. The secondtype has 6pairs oflarge classesand7pairs ofsmallgroups. Keywords: Rana chalconotacomplex, Ranarufipes, Ranaparvaccola, karyotype ABSTRAK. Penelitian mengenai  KariotipeRana chalconotakompleks  yang terdapat  di  Sumatera Barat telah dilaksanakan pada bulan April–Agustus 2010. Pengambilan sampel dilakukan di Hutan Pendidikan dan  Penelitian  Biologi  kemudian  dilanjutkan  dengan  pembuatan  preparat  di  Laboratorium  Genetika  dan Sitologi Jurusan Biologi FMIPA UNAND Padang. Penelitian ini bertujuan untuk mengetahui kariotipe dari dua jenis baru katak yang semula dikelompokkan R. chalconotatetapi, sekarang dideskripsikan sebagai R.  parvaccola  dan R.  rufipes  yang  terdapat  di  Sumatera  Barat. Pembuatan  preparat  dilakukan  dengan metode kering udara dan analisis data dilakukan dengan uji statistik Mann-Whitney U Test  dan Wilcoxon U  Statistik.  Hasil  penelitian  memperlihatkan  bahwaRana  rufipes  memiliki  13  pasang  kromosom  yang terdiri  dari  satu  pasang  kromosom  submetasentrik  dan  12  pasang  kromosom  metasentrik. Rana parvaccola  juga  memiliki  13  pasang  kromosom  yang  terdiri  dari  tiga  pasang  kromosom  submetasentrik dan 10 pasang kromosom metasentrik. Kedua jenis ini memiliki 6 pasang golongan besar dan 7 pasang golongan kecil. Kata Kunci:Rana chalconotakompleks, Ranarufipes, Ranaparvaccola, kariotipe
Cell-Free Therapeutic Mechanisms of AD-MSC Secretome in Type 2 Diabetes Mellitus: Literature Review Padilla, Putri Rahma; Marlina, Marlina; Tjong, Djong Hon
Jurnal Biologi Tropis Vol. 25 No. 4a (2025): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4a.10623

Abstract

Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder with a globally increasing prevalence, while conventional therapies often fail to halt disease progression. The secretome derived from adipose-derived mesenchymal stem cells (AD-MSCs) holds great potential as a cell-free therapy strategy, as it contains various bioactive molecules, cytokines, and extracellular vesicles that regulate glucose metabolism and modulate immune responses. This review discusses the molecular components of AD-MSC secretome, its mechanisms in enhancing insulin sensitivity and protecting pancreatic β-cells, as well as the challenges in its clinical application. Based on literature from 2018–2025 in PubMed, Scopus, and Web of Science, AD-MSC secretome has been shown to enhance IRS-1 phosphorylation, activate the PI3K/Akt pathway, and promote GLUT4 translocation while suppressing chronic inflammation. Growth factors (HGF, IGF-1, VEGF) and microRNAs (miR-126, miR-21, miR-146a) contribute to β-cell regeneration. Donor variability, culture conditions, and isolation methods affect secretome quality, which can be optimized through preconditioning or genetic modification.
Co-Authors - Jumawita - Syaifullah Aadrean Aidil, Dyta Rabbani Aldino Fauzil Fanani Almurdi Almurdi AMIR HAMIDY Amir Hamidy Anggraini, Debie Annisya Fitri Anthoni Agustien Anugrah Viona Agesi Arum Setiawan Asnul Fitria Aurora, Dhea Apriano Dahelmi Dahelmi Dahelmi David Gusman Dewi Imelda Roesma Dharmayanthi, Anik Budhi Dian Juliadmi Djoko T. Iskandar Djoko T. Iskandar, Djoko T. Dwitya Elvira Dyta Rabbani Aidil Elli Firdamila fachrul reza, fachrul Fanny Adhy Putri Fauzan . Feskaharny Alamsjah Firdamila, Elli Fuji Astuti Febria G Gunawarman, G Gusman, David Hadi Addaha, Hadi Hadi Kurniawan Henny Herwina Hirowati Ali Hirowati Ali, Hirowati Huda, Nadyatul Khaira Ida Ayu Putu Sri Widnyani Ilhamdi, Ilhamdi Indra Junaidi Zakaria Irawati Chaniago Irvan Fadli Wanda Jamsari Jamsari Janra, Muhammad Nazri Jon Affi, Jon Juliadmi, Dian Kevin Origia Kevin Origia Kharisma Putra Liza Aulia Yusfi Mahmudul Hasan Mahmudul Hasan, Mahmudul Marlina Marlina Masayuki Sumida Masayuki Sumida, Masayuki Maulana, Imron Melinda, Annisa Menkher Manjas Meri Wulandari Muhamad Irsyad Muhammad Idris Muhammad Silmi Nelmi Fitria Netty Marusin Netty Marusin Nia Kurniawan Nia Kurniawan Nofrita Nofrita Nofrita Nofrita Nurhafitri, Amanda Nurul Aida Nurvalinda Nurvalinda Nuswantoro, Nuzul Ficky Nuzulia Irawati Oktaviana, Dili Padilla, Putri Rahma Prawira, Furqan Dwiki Lintang Putri, Emilya Rahmadina, Shovinda Ravelino Nesty Resti Rahayu Ridho Hendrikos Rifka Rahmat Riska Mayori Rita Permatasari Rivi Hamdani Rizaldi Rizaldi Rizia Irsa Salis, Viola Mutiara Saputri, Rahmi Agu Silvia Indra Sisca Dwi Yarni Sri Wahyuni Handayani Sri Wahyuni Handayani, Sri Wahyuni Syaifullah Syaifullah Syaifullah Syaifullah Syaifullah Syandri, Hafrijal Takeshi Igawa Takeshi Igawa, Takeshi Tesri Maideliza Tofrizal Wilson Novarino Yarni, Sisca Dwi Yelvita Sari Yeni Gusma Yanti Yuliarni Syafrita Yurike Nova Edlin Zil Fadhillah Rahma Zozy Aneloi Noli Zulkarnain, Alivia