Claim Missing Document
Check
Articles

Differences in Scube1 and Scube2 Gene Expression in Type II Diabetes Mellitus Patients with Dyslipidemia Saputri, Rahmi Agu; Ali, Hirowati; Tjong, Djong Hon; Anggraini, Debie; Yarni, Sisca Dwi
Jurnal Biologi Tropis Vol. 25 No. 4 (2025): Oktober-Desember
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4.9875

Abstract

The Scube1 gene is expressed in atherosclerosis (plaque buildup in blood vessels), while Scube2 is expressed in DIT (Diffuse Intimal Thickening) which is used to describe diffuse thickening of the intima of blood vessels. This study aims to determine the differences in the expression of the scube1 gene in blood samples of type II DM patients with dyslipidemia and type II DM with non-dyslipidemia and differences in the expression of the scube2 gene in blood samples of type II DM patients with dyslipidemia and type II DM with non-dyslipidemia. With a comparative cross-sectional research method, the sample size of this study was determined based on the Lameshow hypothesis test formula which obtained 18 blood samples of type II DM with dyslipidemia, and 18 blood samples of type II DM with non-dyslipidemia. Blood samples of type II DM patients with dyslipidemia and blood samples of type II DM patients without dyslipidemia showed significantly different expression of the scube1 gene, with a p-value of 0.000. Similarly, blood samples from type II DM patients with dyslipidemia and those from type II DM patients without dyslipidemia showed a significant difference in scube2 gene expression (p = 0.001). Thus, it can be said that the expression of the Scube1 and Scube2 genes is significantly influenced by the complications of diabetes mellitus with dyslipidemia. This happens because it is believed that hyperglycemia in type II DM contributes to endothelial cell dysfunction, which occurs prior to blood vessel damage and results in progressively more severe blood vessel problems. Along with hyperglycemia, type II diabetes also results in dyslipidemia, an alteration in the normal lipid profile. Both dyslipidemia and hyperglycemia contribute to macrovascular and microvascular problems in type II diabetes.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Kariotipe Rana chalconota Kompleks yang Terdapat di Sumatera Barat Karyotype of Rana chalconota Complex in West Sumatera Djong Hon, TJONG
Biospecies Vol. 5 No. 2 (2012): Juli 2012
Publisher : Universitas Jambi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/biospecies.v5i2.641

Abstract

ABSTRACT. Study  of  thekaryotypeRanachalconotacomplexin WestSumatrahas  been  carried  out from  April to August  2010. Samples  were  collected  from  HPPBandthen  analyzed at  the Laboratory  of Geneticsand Cytology Biology  Department  of  FMIPA Andalas  University Padang. The  purpose  of  this study is determine thekaryotypeof the frog speciespreviously classified asR.chalconotathen described asRana  rufipes  and Ranaparvaccolain WestSumatra.  The  object  was  prepared by  using airdrying method.  The data  was  analyzed  bythe  statistical  test Mann-Whitney  Utest andWilcoxonU-Statistics. The results showed that the Ranarufipes has 13pairsof the chromosomesconsistingofonepair of the submetacentricchromosomesand12pairs of the metacentricchromosomes. Ranaparvaccolaalsohas 13pairsof  chromosomesconsistingofthree pairs  of  the submetacentricchromosomesand10pairs  of the metacentric chromosomes. The secondtype has 6pairs oflarge classesand7pairs ofsmallgroups. Keywords: Rana chalconotacomplex, Ranarufipes, Ranaparvaccola, karyotype ABSTRAK. Penelitian mengenai  KariotipeRana chalconotakompleks  yang terdapat  di  Sumatera Barat telah dilaksanakan pada bulan April–Agustus 2010. Pengambilan sampel dilakukan di Hutan Pendidikan dan  Penelitian  Biologi  kemudian  dilanjutkan  dengan  pembuatan  preparat  di  Laboratorium  Genetika  dan Sitologi Jurusan Biologi FMIPA UNAND Padang. Penelitian ini bertujuan untuk mengetahui kariotipe dari dua jenis baru katak yang semula dikelompokkan R. chalconotatetapi, sekarang dideskripsikan sebagai R.  parvaccola  dan R.  rufipes  yang  terdapat  di  Sumatera  Barat. Pembuatan  preparat  dilakukan  dengan metode kering udara dan analisis data dilakukan dengan uji statistik Mann-Whitney U Test  dan Wilcoxon U  Statistik.  Hasil  penelitian  memperlihatkan  bahwaRana  rufipes  memiliki  13  pasang  kromosom  yang terdiri  dari  satu  pasang  kromosom  submetasentrik  dan  12  pasang  kromosom  metasentrik. Rana parvaccola  juga  memiliki  13  pasang  kromosom  yang  terdiri  dari  tiga  pasang  kromosom  submetasentrik dan 10 pasang kromosom metasentrik. Kedua jenis ini memiliki 6 pasang golongan besar dan 7 pasang golongan kecil. Kata Kunci:Rana chalconotakompleks, Ranarufipes, Ranaparvaccola, kariotipe
Cell-Free Therapeutic Mechanisms of AD-MSC Secretome in Type 2 Diabetes Mellitus: Literature Review Padilla, Putri Rahma; Marlina, Marlina; Tjong, Djong Hon
Jurnal Biologi Tropis Vol. 25 No. 4a (2025): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4a.10623

Abstract

Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder with a globally increasing prevalence, while conventional therapies often fail to halt disease progression. The secretome derived from adipose-derived mesenchymal stem cells (AD-MSCs) holds great potential as a cell-free therapy strategy, as it contains various bioactive molecules, cytokines, and extracellular vesicles that regulate glucose metabolism and modulate immune responses. This review discusses the molecular components of AD-MSC secretome, its mechanisms in enhancing insulin sensitivity and protecting pancreatic β-cells, as well as the challenges in its clinical application. Based on literature from 2018–2025 in PubMed, Scopus, and Web of Science, AD-MSC secretome has been shown to enhance IRS-1 phosphorylation, activate the PI3K/Akt pathway, and promote GLUT4 translocation while suppressing chronic inflammation. Growth factors (HGF, IGF-1, VEGF) and microRNAs (miR-126, miR-21, miR-146a) contribute to β-cell regeneration. Donor variability, culture conditions, and isolation methods affect secretome quality, which can be optimized through preconditioning or genetic modification.
A Literature Review on Transgenic Crops in Indonesia and ASEAN Countries: Transgenic Research Development and Future Prospects for Food Sovereignty Zulkarnain, Alivia; Nurhafitri, Amanda; Tjong, Djong Hon; Idris, Muhammad
Jurnal Biologi Tropis Vol. 25 No. 4a (2025): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4a.10224

Abstract

The growing global population, climate change, and limited agricultural land are key challenges threatening food security. One innovative solution is the development of transgenic crops, genetically engineered plants that possess superior traits such as resistance to pests, diseases, abiotic stress, and improved nutritional value. This literature review explores the historical development of transgenic research in Indonesia and other ASEAN countries, the technological approaches used—including Agrobacterium-mediated transformation, biolistic methods, and CRISPR/Cas9 - and the future prospects for achieving national food sovereignty. While countries like China and the Philippines have advanced in Genetically Modified Organism (GMO) commercialization, Indonesia remains in the research phase due to various obstacles, including limited expertise, low research funding, regulatory constraints, and public acceptance. Strengthening regulatory frameworks, human resource development, and international collaborations are essential for supporting sustainable agricultural biotechnology. This paper highlights the need for a strategic, science-based approach to integrating transgenic technology into Indonesia's agricultural system as part of its long-term food security and innovation agenda.
Characteristics of Tuberculous Meningitis Patients at M.Djamil Padang Hospital in 2024 Fanny Adhy Putri; Yuliarni Syafrita; Djong Hon Tjong; Dwitya Elvira; Nurvalinda Nurvalinda
Jurnal Ners Vol. 9 No. 4 (2025): OKTOBER 2025
Publisher : Universitas Pahlawan Tuanku Tambusai

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31004/jn.v9i4.50224

Abstract

Tuberculous meningitis (TBM) is the most severe form of extrapulmonary TB, causing high morbidity and mortality. The Global TB 2022 report estimates that there are at least 100,000 people with MTB each year. In 2021, there were at least 13,400 MTB cases in Indonesia, or about 8% of the global estimate. To determine the characteristics of tuberculous meningitis patients at M. Djamil Padang Hospital in 2024. A descriptive study with cross-sectional method. The sampling technique used was purposive sampling by collecting medical record data of TBM patients at Dr. M. Djamil Padang Hospital in 2024. The number of samples that met the inclusion and exclusion criteria was 45 sample. Data were analyzed using SPSS. Univariate analysis was used to assess the characteristics of patient and presented in the form of a frequency distribution table. The average age of TBM patients in this study was 31 years, dominated by male gender (55.6%). Most of the TBM patients had normal nutritional status (64.4%) and only 17.8% of patients were underweight. Only 13.3% of TBM patients had a history of TB and 6.7% of patients had positive HIV status. Around 4.76% and 11.1% of patients had comorbid DM and hypertension. Most patients were in stage II BMRC (71.1%). Hydrocephalus was the most common CT Scan finding, which was 46.7%. Only 26.7% of patients died during treatment. Tuberculous meningitis is more common in men, with stage II BMRC, has hydrocephalus, and more than a quarter of MTB patients died during treatment.
Variasi Morfologi Fejervarya cancrivora Gravenhorst, 1892 (Anura: Dicroglossidae) di Sumatra Barat Huda, Nadyatul Khaira; Tjong, Djong Hon; Roesma, Dewi Imelda
BEST Journal (Biology Education, Sains and Technology) Vol 7, No 2 (2024): September 2024
Publisher : Program Studi Pendidikan Biologi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30743/best.v7i2.9687

Abstract

Bukit Barisan sebagai barrier ekologi yang dapat membatasi migrasi dan aliran gen khususnya amfibi. Penelitian ini bertujuan untuk melacak variasi morfologi Fejervarya cancrivora di Sumatra Barat berdasarkan morfometrik. Total 120 individu F. cancrivora dari enam populasi meliputi Padang, Pariaman dan Pesisir Selatan sebagai bagian barat Bukit Barisan. Pasaman, Limapuluh Kota dan Sijunjung sebagai bagian timur Bukit Barisan. Hasil analisis data morfometrik didapatkan 13 karakter yang bervariasi pada individu-individu jantan yaitu SL, EN, TEL, MN, HAL, FAL, HLL, THIGHL, TL, FOL, TFOL, 3FL and 1FL.dan 16 karakter bervariasi pada individu-individu betina yaitu SVL, HL, MSL, NS, SL, TEL, MN, MFE, IN, IOD, FAL, THIGHL, FOL, 4TL, IMTL and 1 TL. Berdasarkan hasil analisis PCA menunjukkan keenam plot saling tumpang tindih. Dapat disimpulkan bahwa meskipun terdapat karakter yang bervariasi, tidak ada perbedaan secara signifikan yang memisahkan satu populasi dengan populasi lainnya..
Keterbatasan Data Molekuler Pada Burung Kakatua Raja ((Probosciger aterrimus Gmelin, 1788): Dampak pada Konservasi Rahmadina, Shovinda; Tjong, Djong Hon; Dharmayanthi, Anik Budhi
BEST Journal (Biology Education, Sains and Technology) Vol 8, No 1 (2025): Juni 2025
Publisher : Program Studi Pendidikan Biologi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30743/best.v8i1.10974

Abstract

Probosciger aterrimus atau kakatua raja merupakan spesies burung kakatua yang menghadapi ancaman konservasi akibat deforestasi, perdagangan ilegal, dan tingkat reproduksi yang rendah. Kajian ini bertujuan untuk menelaah literatur terkait genetika molekuler guna memahami struktur populasi serta implikasi konservasinya. Studi terdahulu menunjukkan adanya perbedaan genetik yang signifikan antarpopulasi, yang dapat berdampak pada strategi konservasi, terutama dalam translokasi dan program pemuliaan berbasis konservasi. Namun, keterbatasan data molekuler masih menjadi tantangan dalam pengelolaan spesies ini. Selain itu, kurangnya pemetaan genetik dapat meningkatkan risiko hilangnya adaptasi lokal atau outbreeding depression akibat pencampuran populasi yang tidak sesuai. Oleh karena itu, penelitian lebih lanjut menggunakan teknologi genomik seperti Next-Generation Sequencing (NGS) dan Single Nucleotide Polymorphisms (SNPs) diperlukan untuk memastikan strategi konservasi yang lebih efektif. Kajian ini menekankan pentingnya pendekatan berbasis genetika dalam perlindungan jangka panjang P. aterrimus serta perancangan kebijakan konservasi yang lebih akurat
GENETIC DIVERGENCE AND GEOGRAPHIC DISTRIBUTION OF FROGS IN GENUS FEJERVARYA FROM INDONESIA INFERRED FROM MITOCHONDRIAL 16S rRNA GENE ANALYSIS Nia Kurniawan; Tjong Hon Djong; Tesri Maideliza; Amir Hamidy; Takeshi Igawa; Masayuki Sumida; Mahmudul Hasan
Treubia Vol. 41 (2014): Vol. 41, December 2014
Publisher : BRIN Publishing (Penerbit BRIN)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/treubia.v41i0.361

Abstract

The Indonesian archipelago is an ideal setting for the study of speciation and biogeography. This archipelago is divided into three island groups based on zoogeography: Sundaland, Wallacea and the Australian region. In this paper we used frogs in genus Fejervarya (Bolkay) to study biogeography and examine patterns of gene flow across proposed zoogeographic boundaries. Several molecular studies on Fejervarya species from Indonesia have been carried out, but comparative studies among members of the genus Fejervarya have yet to be performed. In order to elucidate genetic divergence and geographic distribution of these frogs, we conducted a molecular analysis of the mitochondrial 16S rRNA gene using 179 frogs from five Fejervarya species. In total we collected from 32 localities in Sumatra, Kalimantan (Indonesian part of Borneo), Java, Bali, Sulawesi and Lesser Sunda Islands in Indonesia. Molecular phylogenetic analysis recovered 35 haplotypes and showed that frogs in the genus Fejervarya were divided into two well-supported clades. The first group were of three species, F. limnocharis, F. iskandari and F. cf. verruculosa and the other group clade consisted of Fejervarya cancrivora and Fejervarya sp. (Sulawesi-type). The average sequence divergence among these four species ranged from 1.09 to 16.03% (mean = 11.29±2.83%). The present results clearly show that there are five Fejervarya species in the Indonesian archipelago. Fejervarya limnocharis and F. cancrivora are widely distributed and sympatric in Sumatra, Borneo and Java. Fejervarya iskandari is not endemic to Java and also occurs in the Lesser Sundas. Fejervarya cf. verruculosa and Fejervarya sp. (Sulawesi-type) are endemic to Lesser Sunda and Sulawesi Island, respectively.
Relationship between Proximate Characteristics and pH Value with Total Lactic Acid Bacteria in Etawa Goat Milk Annisa Farma; Djong Hon Tjong; Endang Purwati; Anthoni Agustien; Annisa Khaira
Jurnal Biologi Tropis Vol. 26 No. 2 (2026): April - Juni
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v26i2.12044

Abstract

Etawa goat milk is a highly nutritious food source with strong potential to be developed as a functional food. Its nutritional components—such as protein, fat, and water content—along with the presence of lactic acid bacteria (LAB), contribute to its health benefits. This study aimed to analyze the proximate characteristics and pH value of Etawa goat milk and to evaluate their relationship with the total LAB count. Milk samples were collected from three locations in Padang City: Gunung Pangilun, Korong Gadang, and Padayo. Proximate analysis was conducted using standard methods from the Indonesian National Standardization Agency, while total LAB was determined using the Total Plate Count method on MRS Agar media. The results showed that moisture content ranged from 86.11–88.93%, protein content from 3.64–4.17%, fat content from 4.00–5.00%, and pH values from 6.70–7.00. The total LAB ranged from 30.66×10⁸ to 48.33×10⁸ CFU/mL, exceeding the minimum threshold required for probiotic sources. Samples with higher protein and fat content tended to have higher LAB counts. In addition, high moisture content and near-neutral pH supported microbial growth. Therefore, the proximate characteristics and pH value of Etawa goat milk are associated with LAB counts, indicating its potential as a natural probiotic source. The findings of this study provide scientific evidence for the utilization of Etawa goat milk as a natural probiotic product and may contribute to the development of dairy-based functional foods and community nutrition programs.
Co-Authors - Jumawita - Syaifullah Aadrean Aadrean Aadrean ADA CHORNELIA Aidil, Dyta Rabbani Aldino Fauzil Fanani Almurdi Almurdi Amanda Nurhafitri Amir Hamidy AMIR HAMIDY Amir Hamidy ANDRI SAPUTRA Anggraini, Debie Anik Budhi Dharmayanthi Annisa Farma Annisa Khaira Annisya Fitri Anthoni Agustien Anthonie Agustien Anugrah Viona Agesi ANUGRAH VIONA AGESI Arum Setiawan Ashrifurrahman Ashrifurrahman Asnul Fitria Asrori, Ikrima Aurora, Dhea Apriano Cynthia Ericca Dahelmi Dahelmi Dahelmi David Gusman Dewi Imelda Roesma Dewi Roesma Dharmayanthi, Anik Budhi Dian Juliadmi Djoko T. Iskandar Djoko T. Iskandar, Djoko T. Dwitya Elvira Dyta Aidil DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL Dyta Rabbani Aidil Elli Firdamila Endang Purwati RN Essy Harnelly fachrul reza, fachrul Fanny Adhy Putri Fanny Lestari Fatriza, Ayu Septia Fauzan . Feskaharny Alamsjah Firdamila, Elli FURQAN DWIKI LINTANG PRAWIRA FURQAN DWIKI LINTANG PRAWIRA G Gunawarman, G Gusman, David Hadi Addaha, Hadi Hadi Kurniawan Henny Herwina Hirowati Ali Hirowati Ali, Hirowati Huda, Nadyatul Khaira Ida Ayu Putu Sri Widnyani IKRIMA ASRORI IKRIMA ASRORI Ilhamdi, Ilhamdi Indra Junaidi Zakaria INDRI LESTARI Irawati Chaniago Irfan Suliansyah Irvan Fadli Wanda Jamsari Jamsari Janra, Muhammad Nazri Jon Affi, Jon Juliadmi, Dian Kevin Origia Kevin Origia Kharisma Putra Liza Aulia Yusfi M. Idris Mahmudul Hasan Mahmudul Hasan Mahmudul Hasan, Mahmudul Mansyurdin Marlina Marlina Masayuki Sumida Masayuki Sumida Masayuki Sumida, Masayuki Maulana, Imron Melinda, Annisa Menkher Manjas Meri Wulandari Muhamad Irsyad Muhammad Janra Muhammad Idris Muhammad Silmi Nadyatul Khaira Huda Nelmi Fitria Netty Marusin Netty Marusin Nia Kurniawan Nia Kurniawan Nia Kurniawan Nofrita Nofrita Nofrita Nofrita Nurhafitri, Amanda Nurul Aida Nurvalinda Nurvalinda Nuswantoro, Nuzul Ficky Nuzulia Irawati Oktaviana, Dili Padilla, Putri Rahma PATRICK FLAGGELLATA Prawira, Furqan Dwiki Lintang Putri, Emilya Rahmadina, Shovinda Ravelino Nesty Resti Rahayu Revis Asra Ridho Hendrikos Rifka Rahmat Riska Mayori Rita Permatasari Rivi Hamdani Rizaldi Rizaldi Rizia Irsa RUSDIYAN RITONGA Salis, Viola Mutiara Saputri, Rahmi Agu SARUEDI SIMAMORA Shovinda Rahmadina Silvia Indra Sisca Dwi Yarni Sri Wahyuni Handayani Sri Wahyuni Handayani, Sri Wahyuni Suwirmen, Suwirmen Syaifullah Syaifullah Syaifullah SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah Syaifullah Syaifullah SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH Syamsuardi Syamsuardi Syandri, Hafrijal Takeshi Igawa Takeshi Igawa Takeshi Igawa, Takeshi Tesri Maideliza Tesri Maideliza Tofrizal UMMI KURNIA PUTRI VIOLA MUTIARA SALIS VIOLA MUTIARA SALIS WARNETY MUNIR WILA KARLINA Wilson Novarino Yarni, Sisca Dwi Yelvita Sari Yeni Gusma Yanti YOLI ZULFANEDI Yuliarni Syafrita Yurike Nova Edlin Zil Fadhillah Rahma Zozy Aneloi Noli Zulkarnain, Alivia