Claim Missing Document
Check
Articles

Screening of Indonesian Streptomyces sp. Capable of Secreting Transglutaminase (Mtgase) and Optimization of Mtgase Production Using Different Growth Media Yusro Nuri Fawzya; Dewi Seswita Zilda; Seprianto Chaniago; Hana Nurullita Prestisia; Puspita Lisdiyanti; Noer Khasanah
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 11, No 1 (2016): May 2016
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15578/squalen.v11i1.195

Abstract

Transglutaminase (TGase), an enzyme that catalyzes the formation of inter- and intra-molecular e-(l-glutamyl) lysine (GL) crosslinks, plays an important role in surimi-based products production. The development and the diversification of surimi-based products have recently been getting popular in Indonesia. These surimi-based products can be made from various types of fish. These products generally exhibit good gel strength properties,  depending on the fish type and the processing method used. Transglutaminase plays an important role in generating such properties. Fish’s endogenous TGase reduces quickly after it is caught and is almost completely destroyed by freezing it, applying exogenous TGase may improve fish’s gel forming ability. Microbial transglutaminase (MTGase) can potentially be used to increase gel properties. In this research, a total of 228 Streptomyces strains from marine and terrestrial environments were screened and selected based on their ability to produce MTGase. Strain TTA 02 SDS 14 exhibited the highest activity; and therefore, it was selected for further study. The 16S-rRNA gene analysis showed that it shared 99% similarity to S. thioluteus. In order to optimize MTGase activity, enzyme production was carried out using six different formulas media, designated as media A, B, C, D, E, and F. The result shows that the highest MTGase activity was observed in medium B that contains pepton (1.5%), MgSO4.7H20 (0.1%), KH2PO4 (0.5%), Na2HPO4 (0.5%), soybean powder (2%), potato starch (2%), and glucose (1.5%). The MTGase activity reached the highest level (1.45 U/ml) after 4 days of incubation
In Silico Analysis of Sox2 Gene for Pluripotency Detection at Mouse Embryonic Fibroblast and induced Pluripotent Stem Cell (iPSC) Aroem Naroeni; Seprianto; Kevin Febrianus Moda
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2101

Abstract

Stem cells are cells that have not been specialized and have a specific characteristic compared to other cells. There are several transcription factors like Sox2, Oct4, c-Myc, and Nanog to maintain embryonic stem cells. In pluripotent stem cells, sex-determining region Y-box 2 (Sox2) is a critical transcriptional regulator, and for somatic cell reprogramming, which involves returning differentiated cells to a pluripotent embryonic state by reversing their epigenetic arrangement. This study aimed to design primers for detecting the Sox2 gene expressed in Mouse Embryonic Fibroblasts and induced Pluripotency Stem Cell as pluripotency detection in stem cell research. In silico analysis was carried out to detect ofx2gene by using several software such as BLAST to search sequence Sox2 gene from Homo sapiens and Mus musculus, Bioedit for sequence alignment, SnapGene for PCR in silico, and PrimerBlast for online primer design. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer (5'- CTACAGCATGTCCTACTCGCA -3') and reverse primer (5'- ACTTGACCACAGAGCCCA -3') were selected primers for M. musculus. Also, forward primer (5’-CTACAGCATGTCCTACTCGCA-3') and reverse primer (5'- ACTT-GACCACCGAACCCA-3') for Homo sapiens. Detection by PCR in silico using templates from H. sapiens and M. musculus sequences showed that the primers could specifically amplify the Sox2 gene in each species. Nevertheless, laboratory experiments need to be carried out for preliminary validation that has been designed. These primers will be used to measure the gene expression of Sox2 in qRT-PCR to detect the stemness characteristic of stem cells.
PENGENALAN KEILMUAN BIOTEKNOLOGI DALAM PENENTUAN JURUSAN BAGI PARA SISWA SMA/SMK DI KOTA JAKARTA DAN TANGERANG : Pengenalan Keilmuan Bioteknologi Bagi Siswa SMA/SMK Seprianto Seprianto
J-ABDI: Jurnal Pengabdian kepada Masyarakat Vol. 1 No. 6: Nopember 2021
Publisher : Bajang Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.53625/jabdi.v1i6.307

Abstract

Kegiatan pengabdian masyarakat tentang pengarahan dan pemberian wawasan keilmuan bioteknologi ini bertempat di beberapa sekolah di Jakarta dan Tangerang diantaranya SMKN 1 Jakarta Barat, SMA Budi Mulia Ciledug, SMA 12 Kab. Tanggerang, SMA Yadika 3 Ciledug, SMK Yadika 2 Tanjung Duren, SMAN 40 Jakarta, SMA Hangtuah 1 Jakarta dan SMK 9 Tanggerang Selatan. Metode yang digunakan dalam pelaksanaan kegiatan dengan cara presentasi di depan kelas diantara jam pertukaran pelajaran atau pada saat jam mata pelajaran kosong. Antusias para siswa dalam mengikuti sosialiasi ini sangat baik dilihat dari ketertiban siswa mengikuti selama presentasi berlangsung, serta beberapa dari mereka antusias untuk bertanya tentang keilmuan bioteknologi. Hasil sosialisasi memberikan dampak yang siknifikan terhadap peningkatan peminatan para siswa untuk memilih dan mempelajari bioteknologi. Hal ini dapat dilihat dari hasil survei di SMAN 40 Jakarta dari 27 responden yang sebelumnya menyatakan berminatt mempelajari keilmuan bioteknologi menjadi 46 responden. Sedangkan di SMKN 9 Tangerang Selatan dari 33 responden yang sebelumnya menyatakan berminat, menjadi 55 responden yang ingin mempelajari keilmuan bioteknologi.
TRANSFORMASI PLASMID REKOMBINAN pRI_101-AN MEMBAWA SISIPAN GEN cryIII MELALUI Agrobacterium tumefaciens Febriana Dwi Wahyuni; Muhamad Amza Sidiq; Seprianto Seprianto; Henny Saraswati
BERITA BIOLOGI Vol 21, No 1 (2022)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/beritabiologi.v21i3.4256

Abstract

Sweet potato is a plant that give many benefits because of its high carbohydrate content and is an alternative food source. Behind the benefits of sweet potatoes, there is a threat of pest attack that can cause a decrease in production of up to 19.91%. Sweet potato weevil attack on the leaves, stalks, stems, and tubers. The solution to against this pest attack is by engineering using the cry III gene mediated by A. tumefaciens. The aim of this study was to transform a recombinant plasmid carrying the insertion of the cry III gene into A. tumefaciens cells. The results showed that the recombinant plasmid pRI_101-AN carrying the insertion of the cry III gene was successfully transformed into A. tumefaciens cells by electroporation method by producing 36 recombinant clones on LB media with neomycin and kanamycin antibiotics. Results of colony PCR, DNA bands measuring 1900 bp were successfully amplified using gene-specific primers. Results of the isolation of plasmid DNA bands measuring 12000 bp were obtained from the results of electrophoresis. This size corresponds to the recombinant plasmid pRI_101-AN-cry III.
Optimization of Real-Time PCR Conditions for COVID-19 Diagnosis with Logix Smart Reagent™ Anisa Febriyanti; Seprianto Seprianto; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roselein Putri; Henny Saraswati
BIOEDUKASI Vol 20 No 1 (2022)
Publisher : PROGRAM STUDI PENDIDIKAN BIOLOGI FAKULTAS KEGURUAN DAN ILMU PENDIDIKAN UNIVERSITAS JEMBER

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/bioedu.v20i1.28356

Abstract

Corona Virus Disease 2019 or COVID-19 is a new type of virus that attacks the respiratory tract and can cause death. Laboratory examinations play an essential role in diagnosing COVID-19 with a set of reagents or kits. Sampiand sampling is carried out with a nasopharyngeal swab or oropharyngeal swab. Positive samples of COVID-19 patients used in this study were converted into RNA at the COVID-19 Referral Clinic in Bekasi, after which volume optimization was carried out with a total volume of 5 µl, 8 µl, and 10 µl with the Logix Smart™ kit. The method in this study uses One-Step Real-time PCR. This method is the best method for carrying out several bear tests because it can reduce the possibility of sample contamination. The procedure is fast and has high sensitivity. The fluorescence detection used in this study was FAM with a specific target of COVID-19 RNA and ROX with a particular DNA target of RNase-P. This research was conducted to obtain optimal volume conditions under the manufacturer's standards in detecting the SARS-CoV-2 virus. The results of this study indicate that a total volume of 5 l is the optimal total volume for detecting the presence of the SARS- CoV-2 virus in samples taken from patients.
PEMANFAATAN SAMPAH ORGANIK RUMAH TANGGA MENJADI ECO-ENZYME CAIRAN SEJUTA MANFAAT DI CLUSTER MALTA SENTRALAND PARADISE KEC. PARUNG PANJANG Seprianto Seprianto; Henny Saraswati; Febriana Dwi Wahyuni; Titta Novianti; Adri Nora; Putri Handayani
J-ABDI: Jurnal Pengabdian kepada Masyarakat Vol. 2 No. 8: Januari 2023
Publisher : Bajang Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.53625/jabdi.v2i8.4528

Abstract

Keberadaan sampah dari limbah rumah tangga yang berlebihan di lingkungan merupakan salah satu masalah penting karena dapat merusak keseimbangan ekosistem lingkungan. Perlu adanya pengelolaan terhadap limbah rumah tangga tersebut supaya tidak menimbulkan dampak negatif bagi lingkungan dan kesehatan masyarakat. Perumahan Sentraland paradise merupakan perumahan baru yang terletak di Desa Kabasiran, Kecamatan Parung Panjang Kab. Bogor yang terdiri berbagai cluster salah satunya cluster Malta. Salah satu pemanafaatan sampah organik dari limbah rumah tangga adalan cairan serbaguna eco enzyme. Cairan serbaguna ini bisa menjadi karbol pembersih alami, sabun cuci piring, pemurni udara, pembersih luka, sanitizer alami, pupuk cair, dan cairan pestisidia untuk tanaman. Ada 10 warga yang ikut dalam kegiatan ini, sedikitnya warga yang ikut dikarenakan punya kegiatan lain sehingga tidak dapat berpartisipasi. Selama kegiatan berlangsung peserta sangat aktif bertanya dan berdiskusi dengan pemateri. Pelaksanaan praktek warga ikut terlibat dalam pembuatan eco-enzyme. Kegiatan ini sangat bermanfaat karena banyak informasi yang didapatkan warga tentang bagaimana pemanfaatan sampah dapur yang selama ini hanya dibuang menjadi produk yang bernilai. Kegiatan ini diharapkan dapat memberikan solusi dalam penanganan sampah organik rumah tangga menjadi produk eco-enzyme yang memiliki sejuta manfaat serta menjadi produk komersial yang dapat menjadi tambahan pendapatan warga Malta.
Optimasi Volume Kit Da An Gene Untuk Deteksi SARS-CoV-2 dengan Real Time RT-PCR Seprianto; Muhammad Arreza; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roaslein Putri; Henny Saraswati
BIOEDUSCIENCE Vol 6 No 2 (2022): BIOEDUSCIENCE
Publisher : Universitas Muhammadiyah Prof. Dr. Hamka

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (566.732 KB) | DOI: 10.22236/j.bes/628595

Abstract

Background: SARS-CoV-2 is a new type of coronavirus of the genus Betacoronavirus and the family Coronaviridae that causes a respiratory disease called COVID-19. The virus has a sheath and genetic material in the form of single-chain RNA. The genome structure of this virus is divided into two types, namely genes that encode non-structural proteins consisting of the ORF1a / ORF1b gene and genes that encode structural proteins consisting of spike glycoprotein (S), envelope (E), membrane glycoprotein (M), and nucleocapsid protein (N). Methods: The method of detecting SARS-CoV-2 with real time RT-PCR is the most recommended method because it has high specificity and accuracy. The specificity of a method is necessary to be able to specifically recognize the pathogen that causes the disease. Real time RT-PCR requires sampling with a swab on the oropharynx or nasopharynx to be examined in the laboratory which later the presence of viral RNA becomes a molecule that is assessed for diagnosis results. In this study, volume optimization was carried out on the Da An Gene kit used for the detection of SARS-CoV-2 with Reverse Transcription Polymerase Chain Reaction (Real time RT-PCR) with the aim of saving the use of reagents from available kits but with amplification results remaining optimal and accurate. Results: There were three SARS-CoV-2 RNA samples used consisting of N62, N63, and N79 samples and three types of total volume used were 20 μl, 15 μl, and 10 μl. The results of this study showed that the three positive samples contained SARS-CoV-2 with a Cq value of < 40. Conclusion: A volume of 20 μl is the optimal volume, which is more efficient than the manufacturer's recommended volume of 25 ul.
MUTATION DETECTION OF MULTIDRUG-RESISTANT TUBERCULOSIS BY RT-PCR METHOD AS THE DIAGNOSTIC TOOL OF MDR-TB Titta Novianti; alfero Putra Iryanto; feby feby; callista marsya; putri mega utami; febriana dwi wahyuni; henny saraswati; seprianto; adri nora; roaslein putri; nie nie; sabar pambudi
Jurnal Bioteknologi & Biosains Indonesia (JBBI) Vol. 10 No. 1 (2023): Juni 2023
Publisher : Balai Bioteknologi, Badan Pengkajian dan Penerapan Teknologi (BPPT)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29122/jbbi.v10i1.5653

Abstract

Eight percent of tuberculosis (TB) cases worldwide are resistant to rifampicin, with mutations occurring in the rpoB and katG genes. It is necessary to develop a specific multidrug-resistant (MDR) diagnostic technique using the RT-PCR method in Indonesia to aid in rapid and accurate diagnosis. In-silico testing using SnapGene software resulted in the design of DNA primers for the katG and rpoB genes, plasmids, and specific probes. This study employed a cross-sectional design using 30 non-MDR-TB and MDR-TB samples from RSUD Sitanala, Tangerang Banten, which were tested for amplification of the katG and rpoB genes using Sybr green RT-PCR. Validity testing was conducted using specific probes for the katG and rpoB genes. The amplification results showed that MDR-TB samples and MDR-TB plasmids required a longer time compared to non-MDR-TB samples and non-MDR-TB plasmids. The Quantification Cycle (Cq) value in non-MDR-TB samples was lower than the Cq value in MDR-TB samples. A t-test revealed a significant difference in Cq values of the rpoB and katG genes between MDR-TB and non-MDR-TB patients (p-value < 0.005). These differences in Cq values indicate that the findings of this study can serve as an initial reference for the development of an RT-PCR-based diagnostic kit for MDR-TB.
Optimasi Volume Kit Da An Gene Untuk Deteksi SARS-CoV-2 dengan Real Time RT-PCR Seprianto Seprianto; Muhammad Arreza; Titta Novianti; Febriana Dwi Wahyuni; Oktaviani Naulita Turnip; Roaslein Putri; Henny Saraswati
BIOEDUSCIENCE Vol 6 No 2 (2022): BIOEDUSCIENCE
Publisher : Universitas Muhammadiyah Prof. Dr. Hamka

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/j.bes/628595

Abstract

Background: SARS-CoV-2 is a new type of coronavirus of the genus Betacoronavirus and the family Coronaviridae that causes a respiratory disease called COVID-19. The virus has a sheath and genetic material in the form of single-chain RNA. The genome structure of this virus is divided into two types, namely genes that encode non-structural proteins consisting of the ORF1a / ORF1b gene and genes that encode structural proteins consisting of spike glycoprotein (S), envelope (E), membrane glycoprotein (M), and nucleocapsid protein (N). Methods: The method of detecting SARS-CoV-2 with real time RT-PCR is the most recommended method because it has high specificity and accuracy. The specificity of a method is necessary to be able to specifically recognize the pathogen that causes the disease. Real time RT-PCR requires sampling with a swab on the oropharynx or nasopharynx to be examined in the laboratory which later the presence of viral RNA becomes a molecule that is assessed for diagnosis results. In this study, volume optimization was carried out on the Da An Gene kit used for the detection of SARS-CoV-2 with Reverse Transcription Polymerase Chain Reaction (Real time RT-PCR) with the aim of saving the use of reagents from available kits but with amplification results remaining optimal and accurate. Results: There were three SARS-CoV-2 RNA samples used consisting of N62, N63, and N79 samples and three types of total volume used were 20 μl, 15 μl, and 10 μl. The results of this study showed that the three positive samples contained SARS-CoV-2 with a Cq value of < 40. Conclusion: A volume of 20 μl is the optimal volume, which is more efficient than the manufacturer's recommended volume of 25 ul.
Hilirisasi Produk Eco-enzyme Sebagai Upaya Mandiri Ekonomi di Masyarakat RW 11 Pamulang Timur Tangerang Selatan Titta Novianti; Seprianto; Rini Hidayati
Jurnal Pengabdian Nasional (JPN) Indonesia Vol. 4 No. 3 (2023): September
Publisher : Lembaga Penelitian dan Pengabdian Kepada Masyarakat (LPPM) AMIK Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35870/jpni.v4i3.464

Abstract

Retired people experience reduced income and boredom due to reduced daily activities. This was felt by retirees in RW 11 Pamulang Timur, Tangerang South. High levels of community activity at home also impact the increase in waste in the home environment. Efforts to overcome these two problems include implementing productive activities aimed at increasing household economic income and overcoming the problem of waste in the home environment. It is hoped that community service through training on ecological enzyme production from leftover vegetables or fruits can solve the waste problem and create products with high economic value. Through a 3-month fermentation process with the addition of brown sugar, an ecological enzyme liquid is created that serves as a floor cleaner, dishwashing liquid, disinfectant, bio-fertilizer as well as many other uses. Another benefit is that it contains a variety of enzymes obtained from fermentation. of lactic bacteria. The community received traditional training materials for one day, then was supported in the eco-enzyme production process for 3 months until the product was ready for harvest. The community is also trained in product marketing strategies using online media, advertising strategies, calculating costs, and selling prices, and writing simple financial reports. Production will begin in July 2023 and be ready for harvest in September 2023. Each resident produces a minimum of 1.5 liters to 5 liters of ecological enzyme solution. The resulting product is packaged in used bottles ready for the market. Some are packaged as ready-to-use products, such as hand sanitizer, shampoo, dishwashing liquid, and others. It is hoped that the proceeds from the sale of ecological enzymes can be used as a product to improve the economy at the household level with high efficiency.
Co-Authors Abda Abda Adelia, Ismi Agustinus Robert Uria alfero Putra Iryanto Alham, Fiddini Anisa Febriyanti Ariyadi, Noprizal Aroem Naroeni Ayu, Yulia Agustina Azwar, Beni callista marsya Chikita, Daien Cyndi Prasetya Daflaini, Daflaini Darwata, Siti Riva DEWI PURNAMA Dewi Seswita Zilda Dewi Seswita Zilda Dewi, Lisa Rahma Dewi, Mustika Sandra Dijaya, Rendy Dina Hajja Ristianti, Dina Hajja Dionysius Subali Effendi, Desy Irafadillah Efriyana oksal Erani, Friska Fadila Fadila, Fadila Fajariyanto, Gunawan Febriana Dwi Wahyuni feby feby Feliatra Gifari, Nazhif Gloria, Meilina Gusvina, Fadilla Hana Nurullita Prestisia Hardinsyah Harna, Harna Hasibuan, Molani Paulina Henny Saraswati Henny Saraswati Himarwan, Aditya Idi Warsah Irfandi, Ahmad Jofrishal Jofrishal Juniyati, Sintia Kevin Febrianus Moda Kibtiyah, Maryatul Lawrence, Yoel Lesmawan, Hendra Mahyuny, Siska Rita Manalu, Mely Grace Manalu Maulida, Maulida Mauliza, Mauliza Muhamad Amza Sidiq Muhammad Arreza Mury Kuswari nie nie Noer Khasanah Noperta, Noperta Nora, Adri Novianti, Titta Nugraha, Jaka Setia Nurmalasari, Mieke Nursanah, Nursanah Ogi Danika Pranata Oktaviani Naulita Turnip Oktaviani, Coryna Puspita Lisdiyanti PUSPITA LISDIYANTI Putra, Felicia Kartawidjaja PUTRI HANDAYANI Putri Handayani putri mega utami Putri, Mentari Darma Rahmah, Rasya Aulia Rahmayanti R, Andi Rian Adi Pamungkas Riansyah, Irza Rimbawan , Rini Hidayati roaslein putri Roaslein Putri Roselein Putri Ruhmayanti, Nur Ayu Sa'pang, Mertien Sabar Pambudi Saraswati, Henny Saraswati, Henny Sari, Ratih Permana Seda, Ananda Putri Sianturi, Dody Jhonatan Wilfiez Sidauruk, Christina Siti Komariyah Situmorang, Larissa Kristina T.T. Soleha, Sovatunisa Suharsono Suharsono Surgasari, Tania Susanti, Sela Syamsul Rizal Titania Tjandrawati Nugroho Veza Azteria Widodo Widodo Wiriatmaja, Nuraini Ulya Yusro Nuri Fawzya Yusro Nuri Fawzya Zadrax, Adellino Zhafira, Alipya