Article Per Year (5 Year)
p-Index From 2021 - 2026
7.75
P-Index
This Author published in this journals
All Journal International Journal of Evaluation and Research in Education (IJERE) Jurnal Dedikasi Jurnal Gamma Jurnal Pangan dan Gizi AL KAUNIYAH Jurnal Pemikiran dan Pengembangan Sekolah Dasar (JP2SD) JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Jurnal CARE Jurnal Edukasi Matematika dan Sains Journal of Tropical Biodiversity and Biotechnology JOIV : International Journal on Informatics Visualization BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) Jurnal Pendidikan Biologi Jurnal Penelitian Pendidikan IPA (JPPIPA) BIOEDUKASI As-Salam: Jurnal Studi Hukum Islam & Pendidikan AL-ATHFAAL : JURNAL ILMIAH PENDIDIKAN ANAK USIA DINI EnviroScienteae JAST : Jurnal Aplikasi Sains dan Teknologi Journal of Education Technology Jurnal Golden Age Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Jurnal Pembelajaran dan Biologi Nukleus JSMARTech : Journal of Smart Bioprospecting and Technology Jurnal Pengabdian UNDIKMA Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran Bioscientist : Jurnal Ilmiah Biologi Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Azzahra : Jurnal Pendidikan Anak Usia Dini Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Research and Development in Education (RaDEn) Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biocaster : Jurnal Kajian Biologi Nuras : Jurnal Pengabdian Kepada Masyarakat Jurnal Peduli : Jurnal Pengabdian Kepada Masyarakat Jurnal Informatika Polinema (JIP) Biosaintifika: Journal of Biology & Biology Education JPPG LinguaScopes: International Journal of Language Education Sasambo: Jurnal Abdimas (Journal of Community Service) Jurnal Kesehatan Masyarakat Indonesian Journal of Education and Youth Development Jurnal Sinergi Bangsa
Elly Purwanti
Universitas Muhammadiyah Malang
Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Other

Published : 72 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 72 Documents
Search

 3   4   5   6   7 
MENINGKATKAN KOSAKATA BAHASA INGGRIS MELALUI LITERASI DIGITAL PADA ANAK USIA 5-6 TAHUN Elly Purwanti
AS-SALAM Vol 13 No 1 (2024): PENDIDIKAN DAN HUKUM DALAM PERSPEKTIF MASA DEPAN
Publisher : LPPM STAI DARUSSALAM LAMPUNG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51226/assalam.v13i1.596

Abstract

Bahasa merupakan salah satu aspek yang perlu dikembangkan hal ini termasuk Bahasa asing yaitu Bahasa Inggris. Penguasaan komponen Bahasa yang masih rendah yaitu kosakata Bahasa Inggris. Hal ini karena kurangnya media pembelajaran Bahasa Inggris yang digunakan dalam pembelajaran. Tujuan penelitian ini adalah untuk meningkatkan kosakata Bahasa Inggris melalui literasi digital pada anak usia 5-6 tahun. Penelitian tindakan kelas (PTK) digunakan untuk mengetahui peningkatan kosakata anak dalam dua siklus yang terdiri dari empat tahapan, yaitu; perencanaan, pelaksanaan tindakan, observasi, dan refleksi. Objek pada penelitian ini Anak dengan usia 5-6 tahun berjumlah 20 orang anak di TK Pertiwi Sribhawono kemudian kosakata Bahasa Inggris dan liretasi digital berperan sebagai objek. Penelitian ini membuktikan bahwa: 1) penguasaan kosakata bahasa Inggris anak pada awal pra siklus yaitu 20%, ini membuktikan penguasaan kosakata Bahasa Inggris anak masih sangat rendah dan belum berkembang. 2) ada peningkatan penguasaan kosakata Bahasa Inggris anak setelah penggunaan media literasi digital yaitu dari 20% menjadi 80%. Hal ini menunjukkan bahwa dari penelitian yang dilakukan mencapai peningkatan keberhasilan secara klasikal.
PENERAPAN STRATEGI PEMBELAJARAN READING ALOUD DALAM MENINGKATKAN KEMAMPUAN MEMBACA SURAH PENDEK PILIHAN PELAJARAN PAI KELAS VA SD NEGERI 2 SRIBHAWONO KECAMATAN BANDAR SRIBHAWONO kin, shodikin; Purwanti, Elly
Jurnal Pengembangan Profesi Guru (JPPG) Vol. 2 No. 2 (2024)
Publisher : LPPM STAI Darussalam Lampung

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Abstract The purpose of this study was to improve the ability to read selected short surahs in PAI lessons for Class VA students at SD Negeri 2 Sribhawono. And to increase the effectiveness of the implementation of PAI learning in Class VA students at SD Negeri 2 Sribhawono. The writer's problem in this study can be formulated as follows: Can the application of the Reading Aloud Strategy improve the ability to read selected short surahs in Class VA students at SD Negeri 2 Sribhawono? This research is Classroom Action Research (CAR), where the teacher plays a direct role in the learning process. The subjects in this study were Class VA students at SD Negeri 2 Sribhawono, while the objects were the Reading Aloud Strategy and students' ability to read selected short surahs in the subject of Islamic Religion. Meanwhile, the sample for this study was all VA Class students for the 2023/2024 school year, which consisted of 22 students. Collecting data in this study used an evaluation test, namely before the action and after the action at each meeting and gave a score to each student. From the field data it is known that the ability to read short surahs chosen by students before the action is still relatively poor with an average acquisition of 58.47 in the 50-59 interval. Then the ability to read the short sura of the students' choice increased after the class action was carried out with an average acquisition of 82.01 in the good group at intervals of 76-100.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Hilirisasi Prototype Diversifikasi Pangan Fungsional Berbasis Koro Lokal dalam Upaya Pengembangan Produk Pangan Sehat Dan Ekonomi Hijau di Sumenep Purwanti, Elly; Warkoyo, W.; Hidayati, Asmah; Nuryady, Moh. Mirza; Permana, Tutut Indria; Lestari, Novi Puji
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 4 (2024): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i4.2305

Abstract

Kegiatan ini bertujuan untuk melakukan hilirisasi prototipe diversifikasi pangan fungsional berbasis kacang koro lokal dalam rangka pengembangan produk pangan sehat dan ekonomi hijau di Sumenep. Program ini dilaksanakan dengan menggunakan pendekatan Triple Helix yang melibatkan tiga komponen utama: Universitas Muhammadiyah Malang (UMM) sebagai pemegang inovasi, Kemendikbudristek sebagai pemberi dana, dan mitra industri rumah tangga (IRT) di Sumenep, yaitu CV Bunga Anggrek dan CV Akancatani, sebagai penerima manfaat utama. Sinergi antara akademisi, pemerintah, dan industri ini bertujuan untuk mendorong inovasi yang mampu meningkatkan kesejahteraan masyarakat melalui pengembangan ekonomi hijau. Kegiatan hilirisasi ini dilakukan melalui Focus Group Discussion (FGD), sosialisasi, dan pendampingan intensif oleh tim UMM kepada mitra IRT, dengan fokus pada peningkatan kualitas dan kuantitas produk berbasis koro. Selain itu, pelaksanaan Kuliah Kerja Nyata (KKN) di Desa Grujugan, Sumenep, turut memperkuat upaya ini dengan program kerja yang mengembangkan potensi desa dan memperluas akses pasar produk koro. Secara keseluruhan, kegiatan ini tidak hanya mendukung keberlanjutan usaha IRT berbasis koro, tetapi juga memperkuat daya saing produk di pasar yang lebih luas, mendukung ekonomi lokal dengan adanya peningkatan pendapatan, dan membangun keterampilan masyarakat dalam pengelolaan bisnis yang berkelanjutan. Kegiatan ini juga dapat menjadi inspirasi bagi pengembangan ekonomi hijau di wilayah lain di Madura dan Indonesia. Downstreaming of Functional Food Diversification Prototype Based on Local Koro in an Effort to Develop Healthy Food Products and a Green Economy in Sumenep Abstract This activity aims to downstream a prototype of functional food diversification based on local koro beans in order to develop healthy food products and a green economy in Sumenep. This program is implemented using the Triple Helix approach involving three main components: the UniversitAS Muhammadiyah Malang (UMM) as the innovation holder, the Ministry of Education, Culture, Research and Technology as the funder, and home industry partners (IRT) in Sumenep, namely CV Bunga Anggrek and CV Akancatani, as the main beneficiaries. The synergy between academics, government, and industry aims to encourage innovation that can improve community welfare through the development of a green economy. This downstream activity is carried out through Focus Group Discussions (FGD), socialization, and intensive mentoring by the UMM team to IRT partners, with a focus on improving the quality and quantity of koro-based products. In addition, the implementation of the Real Work Lecture (KKN) in Grujugan Village, Sumenep, also strengthens this effort with a work program that develops village potential and expands market access for koro products. Overall, this activity not only supports the sustainability of koro-based IRT businesses, but also strengthens product competitiveness in the wider market, supports the local economy with the increase in income, and builds community skills in sustainable business management. This activity can also be an inspiration for the development of a green economy in other regions in Madura and Indonesia.
Implementasi Edukasi Anti Bullying pada Anak Usia Dini melalui Metode Pembelajaran Gerak dan Lagu Kawurian, Hesti Asri; Purwanti, Elly; Sefriyanti
Jurnal CARE (Children Advisory Research and Education) Vol. 12 No. 2 (2025): Januari
Publisher : Universitas PGRI Madiun

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25273/jcare.v12i2.21024

Abstract

Fenomena bullying saat ini memprihatinkan, perlu adanya perhatian khusus dari semua pihak khususnya peran orang tua atau pendidik dalam memberikan pondasi pendidikan anti bullying terutama pendidikan yang dilakukan sejak dini. Pendidikan bagi anak usia dini membutuhkan metode dan stimulasi pembelajaran yang tepat, agar anak dapat memahami dan berkembang sesuai dengan tahap perkembangannya. Penelitian ini bertujuan untuk mengetahui bagaimana guru mengimplementasikan edukasi anti bullying pada anak usia dini melalui metode pembelajaran gerak dan lagu di RA Azzahra Way jepara Lampung Timur. Metode penelitian yang digunakan menggunakan metode kualitatif deskriptif. Teknik pengumpulan data yang digunakan adalah observasi, dokumentasi dan wawacara. Hasil penelitian menunjukkan bahwasanya agar anak mudah memahami prilaku atau sikap yang baik dan mudah terjadinya perubahan tingkah laku perlu menerapkan pembiasaan, keteladanan dan pendampingan dengan cara selalu mengingatkan terhadap anak atas prilaku yang dimunculkan, agar tidak terjadinya sikap bullying yang dilakukan kepada temannya.
IN SILICO AND IN VITRO ANALYSIS OF BLASHV AND BLATEM GENE PRIMERS Khoiro, Aisha Azaria Nisa’ul; Purwanti, Elly; Miharja, Fuad Jaya; Ariesaka, Kiky Martha; Nuryady, Moh. Mirza
BIOLINK (Jurnal Biologi Lingkungan Industri Kesehatan) Vol. 11 No. 2 (2025): Biolink February
Publisher : Universitas Medan Area

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31289/biolink.v11i2.13830

Abstract

Bacterial pollution that occurs in the environment causes an increase in disease and antibiotic use, which leads to resistance. This study analyzes antibiotic-resistant blaSHV and blaTEM genes in silico and in vitro. Antibiotic-resistant bacterial isolates on ESBL will be carried out PCR and electrophoresis. The type of research used is descriptive observational research conducted from April to September 2024. The sampling technique used was random sampling. Primer blaSHV with sequence F' AGGATTGACTGCCTTTTTG and R' ATTTGCTGATTTCGCTCG, while primer blaTEM has sequence F' ATCAGCAATAAACCAGC and R' CCCCGAAGAACGTTTTC. Data analysis was carried out by analyzing in silico results obtained from the NCBI website and observing the visualization results of PCR amplification indicated by the presence of DNA bands.  In silico results showed 25 organisms attached to blaSHV and 29 organisms to blaTEM. In vitro results shown by electrophoresis visualization showed blaSHV amplicons measuring 392 bp with an annealing temperature of 50.5°C, and blaTEM measuring 517 bp with an annealing temperature of 42°C. The success rate of PCR was shown by clear and specific amplification of both genes, indicating that the PCR method performed was effective in detecting blaSHV and blaTEM genes in ESBL antibiotic-resistant bacterial isolate samples.  
Metacognitive Skills of Junior High School Students in a Pandemic Period Based on the Enriched Virtual Model of PjBL Nafi’ah, Elisa Rohimatun; Purwanti, Elly; Permana, Fendy Hardian; Fauzi, Ahmad
Journal of Education Technology Vol. 6 No. 1 (2022): February
Publisher : Universitas Pendidikan Ganesha

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23887/jet.v6i1.41470

Abstract

Currently, the Covid-19 pandemic has become a significant problem faced by the world of education. The presence of Covid-19 has affected the teaching and learning process in various countries. Almost all countries implement physical distancing policies so that many schools are forced to replace face-to-face learning with online learning based on information and communication technology. The limitations of face-to-face activities in online learning are an obstacle for education, especially in the pandemic era. Moreover, the development of science and technology in the 21st century provides new challenges for the world of education, requiring students to have cognitive skills and metacognitive skills. This quantitative study investigates the effect of the project-based learning-based enriched virtual learning model on students' metacognitive skills. The research design was quasi-experimental with a nonequivalent control group design involving 40 students (22 male students and 18 female students) in class VII. Metacognitive skills were measured using a metacognitive rubric. Data collection is done by using pre-test, post-test, and assignment. Successively, the test used to analyze the metacognitive skills data was One-Way ANCOVA. The results showed that the project-based learning-based enriched virtual learning model significantly affected metacognitive skills (Sig = 0.000). Overall, students got a very memorable experience when following the learning stages so that the model can be used as a reference for use in the following science lesson.
Revitalisasi Konservasi Penyu Melalui Wisata Pendidikan di Desa Hadiwarno Pacitan Purwanti, Elly; Muizzudin, M.; Prihanta, Wahyu
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 10 No. 1 (2025): March
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v10i1.2580

Abstract

Desa Hadiwarno, Kecamatan Ngadirojo, Kabupaten Pacitan, merupakan kawasan pesisir dengan potensi besar untuk konservasi penyu, terutama di Pantai Taman yang menjadi satu-satunya lokasi bertelur penyu di Pacitan. Upaya konservasi yang dilakukan sejak 2012, namun, keberhasilan ini tidak diikuti oleh keberlanjutan partisipasi masyarakat, penguatan ekonomi pelaku konservasi, dan pengelolaan organisasi yang memadai. Kegiatan pengabdian kepada masyarakat ini dilakukan dengan tujuan revitalisasi konservasi melalui pembentukan wisata pendidikan berbasis konservasi penyu. Langkah strategis dimulai dengan pembentukan tim khusus yang bertugas mengelola wisata pendidikan, penyusunan program kerja yang terstruktur, pelatihan untuk meningkatkan kapasitas anggota tim dan masyarakat, serta pembangunan wahana edukasi seperti pusat informasi dan museum mini. Wisata pendidikan ini tidak hanya bertujuan untuk memberikan edukasi kepada masyarakat luas tentang pentingnya pelestarian penyu, tetapi juga menjadi sumber pendanaan yang berkelanjutan bagi kegiatan konservasi. Program ini berhasil meningkatkan partisipasi anggota hingga 85%, keaktifan kegiatan sebesar 82.5%, dan tingkat kepuasan pengunjung mencapai 77.5%. Meskipun menunjukkan hasil positif, evaluasi program mengidentifikasi perlunya perbaikan dalam keterampilan tim untuk memandu pengunjung secara lebih interaktif, pengadaan alat peraga edukasi, dan peningkatan fasilitas pendukung. Dengan pelatihan lanjutan dan evaluasi berkala, program ini diharapkan dapat menjadi model keberlanjutan konservasi yang mengintegrasikan pelestarian keanekaragaman hayati dengan pengembangan pariwisata berbasis edukasi. Melalui pendekatan ini, Desa Hadiwarno diharapkan tidak hanya menjadi pusat konservasi penyu, tetapi juga destinasi wisata pendidikan yang mendukung kesejahteraan masyarakat lokal dan memperkuat posisi Indonesia dalam pelestarian lingkungan secara global. Revitalization of Turtle Conservation Through Educational Tourism in Hadiwarno Village, Pacitan Abstract Hadiwarno Village, Ngadirojo District, Pacitan Regency, is a coastal area with great potential for turtle conservation, especially in Taman Beach which is the only turtle egg-laying location in Pacitan. Conservation efforts have been carried out since 2012, however, this success has not been followed by sustainable community participation, strengthening the economy of conservation actors, and adequate organizational management. This community service activity was carried out with the aim of revitalizing conservation through the formation of educational tourism based on turtle conservation. The strategic steps began with the formation of a special team tasked with managing educational tourism, preparing a structured work program, training to increase the capacity of team members and the community, and building educational facilities such as information centers and mini museums. This educational tourism not only aims to provide education to the wider community about the importance of turtle conservation, but also becomes a source of sustainable funding for conservation activities. This program succeeded in increasing member participation by 85%, activity activity by 82.5%, and visitor satisfaction levels reaching 77.5%. Although showing positive results, the program evaluation identified the need for improvements in team skills to guide visitors more interactively, procurement of educational props, and improvement of supporting facilities. With continued training and periodic evaluation, this program is expected to become a model for sustainable conservation that integrates biodiversity conservation with educational tourism development. Through this approach, Hadiwarno Village is expected to not only become a center for turtle conservation, but also an educational tourism destination that supports the welfare of local communities and strengthens Indonesia's position in global environmental conservation.
Numeric–Phenetic Study of Lablab purpureus from East Java Based on Morphology Character and DNA Fingerprinting Purwanti, Elly; Wangiyana, I Gde Adi Suryawan; Prihanta, Wahyu; Sukri, Akhmad
Biosaintifika: Journal of Biology & Biology Education Vol. 17 No. 1 (2025): April 2025
Publisher : Universitas Negeri Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/biosaintifika.v17i1.4604

Abstract

This research aims to conduct a numeric–phenetic study of Lablab purpureus (L) Sweet based on morphology character and DNA fingerprinting with cophenetic–correlation algorithm confirmation. DNA genome extraction is based on the Blood Animal Plant DNA Preparation Kit. Ten RAPD primers were chosen for the amplification DNA genome, including OPA-6, OPA-8, OPA-10, OPA-20, OPC-19, OPD-8, OPD-12, OPE-8, OPE-15, and OPE-16. Cophenetic correlation is used to analyze three clustering algorithms (Nearest Neighbor, UPGMA, Farthest Neighbor) and five similarity indexes (Simple Matching, Jaccard, Nei & Li, Sorensen, Yule). Lablab purpureus (L) Sweet samples have shown morphology variation, mostly on flowers, pods, and seeds. DNA fingerprinting reveals a variety of band numbers ranging from 300BP to 1000BP. RAPD analysis revealed a total of 87 bands, including 18 polymorphic bands, with an average percentage polymorphism of 31.15%. The UPGMA technique was developed as a result of cophenetic-correlation analysis, and the Jaccard similarity index is the optimal combination for dendrogram generation. The topology of a morphology character dendrogram differs slightly from that of a DNA fingerprinting dendrogram. It concluded that the UPGMA algorithm and Jaccard similarity index is the optimum combination to analyze the diversity of L. purpureus (L) Sweet accession from East Java, resulting in the accession of this species having high diversity. This research can give a novel approaching method in the taxonomy field, which is combining morphological and molecular data.
THE ROLE OF TEACHERS IN INTEGRATING ENGLISH IN KINDERGARTEN DAILY ACTIVITIES Purwanti, Elly
LinguaScopes: International Journal of Language Education Vol. 1 No. 1 (2024): LinguaScopes: International Journal of Language Education
Publisher : Madiha Press

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This study explores the vital role of teachers in integrating English language learning into daily activities in kindergarten classrooms. By incorporating English into various activities such as playtime, circle time, and storytime, teachers can create a rich language-learning environment for young learners. The findings of this study suggest that teachers play a crucial role in fostering language development and creating a positive learning experience for kindergarten students. Teachers who actively engage students in English during daily activities help to build a strong foundation for language acquisition. Through interactive games, songs, and simple conversations, teachers can make learning English fun and engaging for young children. By immersing students in the language throughout the day, teachers can ensure that students are exposed to English in a natural and meaningful way, leading to greater language proficiency over time. Overall, the study highlights the importance of teachers in shaping the language learning experience for kindergarten students and emphasizes the impact of their role in creating a supportive and enriching learning environment.
Co-Authors Abdulkadir Rahardjanto, Abdulkadir Ach. Muhib Zainuri Ach. Muhib Zainuri Ahmad Ardiyansyah Ahmad Fauzi Ainun Mardiyah Lubis Akhmad Sukri Aldina, Siti Nur Alhummaira, Satwika Amaliyah Dina Anggraeni Asmah Hidayati Astika Dwi Lorosae Atok Miftachul Hudha Atok Miftachul Hudha Dian Trinsiska Anggraini Diani Fatmawati Dikmatul Qoimah Drs. Sukarsono, M.Si.,, Drs. Sukarsono, Dwi Priyo Utomo Eddy Satriyanto Eko Cahyono, Eko Elisa Elisa Endrik Nurrohman Faqih Asshiddiqie Farida Rachmawati, Farida Fauzi Ahmad Muda Fendy Hardian Permana Fendy Hardian Permana Feni Tin Faizah Firman Arifin, Firman FITRIYAH Fitriyah Fitriyah Fitriyah Fitriyah Fuad Jaya Miharja Hadi Gunawan Sakti Hasan, Aso Hameed Hermanto, Feri Eko Hidajah Rachmawati Husamah Husamah I Gusti Ngurah Agung Wiwekananda Iis Maisaroh Ilham Budi Setyawan Ilham Budi Setyawan, Ilham Irwansyah, Arif Isti Pujiati Kawurian, Hesti Asri Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Khomsiyati , Siti Khomsiyati, Siti Kiky Martha Ariesaka kin, shodikin Laila Nursafitri Laila Nursafitri, Laila Lestari, Novi Puji Liliek Triani Lud Waluyo Marheny Lukitasari Mashudah Masliyah, Anis Mauridhi Hery Purnomo Moch Agus Krisno Budiyanto Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mohamad Amin Muizzudin Muizzudin Mukhammad Aris Mumthaza, Silwana Muzzudin Muzzudin Nafi’ah, Elisa Rohimatun Najichah, Amalia Fajriyyatin Nikmah, Hurrun In Ningrum, Retno Nor Mita Ika Saputri Novan Ardy Wiyani Novan Ardy Wiyani Novita Herawati Nur Islakhun Nisa’ Nurwidodo, Nurwidodo Nuryady, Mohamad Mirza Oktaviana, Anita Panji Ratih Suci, Panji Ratih Patma, Tundung Subali Pradana, Sandi Pujiati, Isti Putri, Ambarwati Rizkia Qoriatul Wahida Rahmat Hidayat Retno Ningrum Rima Kholifatul Janah Riyanto . Rizka, Muhammad Arief Rizki, Sarita Ronny Susetyoko Rr. Eko Susetyarini safitri, cikra ikhda Nur Hamidah Sari, Selvy Ratna Sefriyanti SEFRIYANTI, SEFRIYANTI Sely Tunjung Manik Septiani Selly Susanti SITI FATIMAH Siti Khomsiyati Siti Mufidah Siti Nur Aldina Siti Zaenab sitikhomsiyati Sri Wahyuni Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Syamsiar, Syamsiar Tutut Indria Permana Uminar, Ajeng Ninda Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wangiyana, I Gde Adi Suryawan Warkoyo, W. Wijaya, Candra Kusuma Wiratmoko Yuwono Yasmine Salsabila Muninda Yulia Anita Yuliani, Rifky Luvia Yuni Pantiwati Yuni Pantiwati Yus Mochamad Cholily Zakiyatul Khoiriyah