This Author published in this journals
All Journal International Journal of Evaluation and Research in Education (IJERE) Jurnal Dedikasi Jurnal Gamma Jurnal Pangan dan Gizi AL KAUNIYAH Jurnal Pemikiran dan Pengembangan Sekolah Dasar (JP2SD) JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Jurnal CARE Jurnal Edukasi Matematika dan Sains Journal of Tropical Biodiversity and Biotechnology JOIV : International Journal on Informatics Visualization BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) Jurnal Pendidikan Biologi Jurnal Penelitian Pendidikan IPA (JPPIPA) BIOEDUKASI As-Salam: Jurnal Studi Hukum Islam & Pendidikan AL-ATHFAAL : JURNAL ILMIAH PENDIDIKAN ANAK USIA DINI EnviroScienteae JAST : Jurnal Aplikasi Sains dan Teknologi Journal of Education Technology Jurnal Golden Age Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Jurnal Pembelajaran dan Biologi Nukleus JSMARTech : Journal of Smart Bioprospecting and Technology Jurnal Pengabdian UNDIKMA Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran Bioscientist : Jurnal Ilmiah Biologi Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Azzahra : Jurnal Pendidikan Anak Usia Dini Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Research and Development in Education (RaDEn) Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biocaster : Jurnal Kajian Biologi Nuras : Jurnal Pengabdian Kepada Masyarakat Jurnal Peduli : Jurnal Pengabdian Kepada Masyarakat Jurnal Informatika Polinema (JIP) Biosaintifika: Journal of Biology & Biology Education JPPG LinguaScopes: International Journal of Language Education Sasambo: Jurnal Abdimas (Journal of Community Service) Jurnal Kesehatan Masyarakat Indonesian Journal of Education and Youth Development Jurnal Sinergi Bangsa
Claim Missing Document
Check
Articles

Real-Time Embedded Vision System for Road Damage Detection Utilizing Deep Learning Putri, Ambarwati Rizkia; Irwansyah, Arif; Arifin, Firman; Purwantini, Elly; Wijaya, Candra Kusuma
JOIV : International Journal on Informatics Visualization Vol 9, No 5 (2025)
Publisher : Society of Visual Informatics

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.62527/joiv.9.5.3661

Abstract

Accidents resulting from road damage are becoming a serious concern, emphasizing the need for efficient monitoring systems and timely government intervention. This research highlights the potential of advanced AI-driven solutions in road safety management, providing a practical approach to efficiently monitoring and maintaining road conditions. It presents a real-time embedded vision system for automatic road damage detection using deep learning techniques. The system is designed to classify six types of road damage and has been implemented on two platforms: Jetson Nano and a personal computer or laptop. A comparative analysis was conducted to evaluate accuracy, computational performance, and power efficiency. The study employs YOLO (v5, v7, v8) and EfficientDet algorithms for detecting road damage. Experimental results indicate that EfficientDet achieves the highest accuracy at 88%, while YOLO attains 63%. In terms of computational performance, YOLOv8 delivers the highest frame rate, reaching 25 FPS on the Jetson Nano. Power efficiency analysis reveals that YOLOv8 on the Jetson Nano is six times more energy-efficient compared to its implementation on a laptop. Likewise, EfficientDet on Jetson Nano demonstrates three times better energy efficiency than on a laptop. These findings underscore the feasibility of deploying AI-powered embedded vision systems for detecting road damage. The use of deep learning models on energy-efficient platforms, such as Jetson Nano, enhances real-time performance while minimizing power consumption. Future research should focus on optimizing these models to enhance performance on edge devices while further assessing their practical applications in real-world environments.
Breeding Site Preferences and Resistance Status of Aedes aegypti in Malang City Nuryady, Moh Mirza; Purwanti, Elly; Permana, Tutut Indria; Ariesaka, Kiky Martha
Jurnal Kesehatan Masyarakat Vol. 21 No. 2 (2025)
Publisher : Universitas Negeri Semarang in collaboration with Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI Tingkat Pusat) and Jejaring Nasional Pendidikan Kesehatan (JNPK)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/kemas.v21i2.21666

Abstract

Dengue Hemorrhagic Fever (DHF) remains a significant health challenge in urban and semi-urban regions, including Malang City, Indonesia, where Aedes aegypti is the primary vector. This study aimed to identify the breeding site preferences of Ae. aegypti and assess its resistance to 0.8% malathion and 0.05% cypermethrin insecticides. Using a descriptive observational design, ovitraps were deployed in three districts to collect mosquito larvae and eggs, and interviews with residents provided additional data on breeding site preferences. Resistance tests followed WHO guidelines, with mortality rates analysed after insecticide exposure. Results indicated that Ae. aegypti larvae were predominantly found in bathroom water tanks (45%) and flower vases (35%). Resistance status revealed geographical variability: Ae. aegypti in District 1 were resistant to cypermethrin, while populations in Districts 2 and 3 were susceptible, with average status of Ae. Aegypti to cypermethrin is tolerant. For malathion, resistance was widespread, particularly in District 3, with average status of Ae. Aegypti to malathion is resistant. These findings suggest that the use of malathion for vector control in Malang is no longer effective, while cypermethrin remains viable under strict monitoring to prevent future resistance. This study underscores the need for targeted insecticide use and regular monitoring to optimize vector control strategies and minimize DHF transmission.
Dual Inhibition of PTP1B and DPP4 by Canavalia ensiformis Bioactive Compounds: A Synergy of Nutrition and Therapeutics Purwanti, Elly; Rachmawati, Farida; Hasan, Aso Hameed; Nuryady, Mohamad Mirza; Permana, Tutut Indria; Prihanta, Wahyu
JSMARTech: Journal of Smart Bioprospecting and Technology Vol. 6 No. 2 (2025): Vol. 6 No. 2 (2025): JSMARTech Volume 6, No 2, 2025
Publisher : JSMARTech

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jsmartech.2025.006.02.23

Abstract

Diabetes mellitus affects over 460 million adults worldwide and is projected to rise further, underscoring the urgency for safe, nutrition-based strategies to improve glycaemic control. Legumes have been known for dietary intervention for diabetic patients. However, studies evaluating the functional properties of Canavalia ensiformis for diabetes management are limited. This study investigated C. ensiformis beans for their nutritional profile and therapeutic potential in diabetes management. Nutritional values were analyzed by proximate and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), while bioactive compounds were identified by untargeted metabolite profiling using Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS). Anti-diabetic potential of identified bioactives was evaluated through molecular docking by using AutoDock Vina against dipeptidyl peptidase-4 (DPP4) and protein tyrosine phosphatase 1B (PTP1B) as known diabetic-associated enzymes. Nutritional analysis revealed a composition rich in crude protein (26.34%) and carbohydrates (54.84%), complemented by substantial mineral content, including calcium, iron, and zinc, which collectively support metabolic and physiological functions. Phytochemical profiling identified 22 bioactive compounds, such as flavonoids (e.g., Kaempferol), phenolic derivatives (e.g., Curcumin), and amino acids (e.g., DL-Tryptophan), known for their roles in oxidative stress reduction and glucose metabolism modulation. Molecular docking studies demonstrated that Kaempferol exhibiting binding affinities of − 7.7 kcal mol⁻¹ (DPP4) and − 7.5 kcal mol⁻¹ (PTP1B), while DL-Tryptophan showed comparable interactions. These ligands occupied the catalytic pockets of both enzymes and engaged key residues, mirroring the binding patterns of native ligands, indicating competitive inhibition that may enhance insulin signalling and prolong incretin action. The dual-target inhibition of PTP1B and DPP4, coupled with the bean’s high nutritional value, positions C. ensiformis as a promising functional food for diabetes management, merging dietary benefits with therapeutic potential.   Keywords: Functional food, Diabetes Mellitus, Dietary Intervention, DPP4 inhibitor, PTP1B inhibitor.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Formulasi dan Uji Mutu Fisik Ekstrak Daun Bidara (Ziziphus mauritiana L.) pada Sediaan Lotion Masliyah, Anis; Suci, Panji Ratih; Purwanti, Elly; Safitri, Cikra Ikhda Nur Hamidah
Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) 2021: Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek)
Publisher : Universitas Muhammadiyah Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (195.569 KB)

Abstract

Tanaman Daun Bidara (Ziziphus mauritiana L.) merupakan taman yang berasal dari arab, sejenis pohon kecil yang selalu hijau, penghasil buah yang tumbuh di daerah tropis serta Asia Barat dan dapat tumbuh di lembah-lembah sampai ketinggian 500 m dpl. Tanaman bidara sudah banyak di budidayakan. Dalam pemanfaatan tanaman daun bidara dapat di olah menjadi sediaan lotion karena mengandung senyawa flavonoid dan alkaloid. Untuk membuat penelitian ini menggunakan formulasi sediaan lotion yang akan di uji mutu fisik dari sediaannya. Ekstrak daun bidara dibuat menggunakan metode maserasi menggunakan etanol 96% konsentrasi ekstrak 3%, 5%, 7%. Evaluasi mutu fisik sediaan meliputi berbagai uji termasuk uji organoleptis, uji homogenitas, uji pH, uji ti emulsi dan uji stabilitas penyimpanan selama 30 hari. Hasil penelitian ini bau lotion beraroma khas dari ekstrak daun bidara, warna lotion hijau tua tidak ada perubahan warna selama 30 hari dengan suhu ruang, pH berkisar 6-7, homogenitas lotion stabil, dan tipe emulsi lotion W/O. Berdasarkan hasil penelitian ini dapat disimpulkan bahwa lotion stabil pada parameter, pH dan tipe emulsi tidak ada perubahan mutu fisik sediaan lotion pada konsentrasi 3%, 5%, 7% yang disimpan pada suhu ruang.
Persepsi Mahasiswa Pendidikan Biologi terhadap Praktikum Online dan Perbandingannya dengan Praktikum Tatap Muka Purwanti, Elly; Prihanta, Wahyu; Fauzi, Ahmad
Biocaster : Jurnal Kajian Biologi Vol. 1 No. 1 (2021): October
Publisher : Lembaga Pendidikan, Penelitian, dan Pengabdian Kamandanu

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (249.202 KB) | DOI: 10.36312/bjkb.v1i1.59

Abstract

The COVID-19 pandemic forced lectures to be shifted to online-based learning, including the implementation of practical activities. The purpose of this research is to examine the perception between students who take online practicum with face-to-face practicum. The research was conducted at the University of Muhammadiyah Malang, involving students of the Biology Education Study Program who had participated in environmental biology practicum. Data was collected using an open survey, using the google form. The survey results show that students feel that online practicum activities are not able to optimally facilitate the empowerment of their competencies.
The McDonaldization of Merdeka Belajar: How Globalized Standardization is Quietly Erasing Indigenous Indonesian Pedagogies Maisaroh, Iis; Sari, Selvy Ratna; Purwanti, Elly; Alhummaira, Satwika
Indonesian Journal of Education and Youth Development Vol. 1 No. 3 (2025): Indonesian Journal of Education and Youth Development (IJEYD)
Publisher : STIT Pringsewu

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This library research critically examines the Merdeka Belajar-Kampus Merdeka (MBKM) policy through the lens of George Ritzer’s sociological framework of McDonaldization to understand its impact on Indigenous Indonesian Pedagogies. As Indonesia aligns its higher education system with global neoliberal pressures for workforce readiness, the MBKM policy is championed as a movement for educational autonomy. However, utilizing Critical Discourse Analysis (CDA) and comparative juxtaposition, this study reveals a profound paradox: the policy’s implementation relies on rigid mechanisms of efficiency, calculability, predictability, and control that mirror the rationalization of the fast-food industry. The analysis demonstrates how accelerated degree pathways (Efficiency) and metric-obsessed performance indicators (Calculability) systematically erode traditional Javanese and Pesantren pedagogies, specifically values such as Ngeli (process-oriented depth) and Olah Rasa (emotional refinement). Furthermore, centralized digital platforms (Predictability) and app-based surveillance (Control) displace the context-specific wisdom of Kodrat Alam and the spiritual autonomy of the Pamong. The study concludes that MBKM facilitates the grobalization of Indonesian education, replacing locally significant cultural practices with globally standardized, empty forms (nothing). It advocates for a de-McDonaldization strategy that harmonizes administrative modernization with the preservation of Indonesia's holistic, character-driven educational heritage.
Peran Orangtua Dalam Mendampingi Kegiatan Belajar Anak Usia Dini Oktaviana, Anita; Purwanti, Elly
Jurnal Golden Age Vol. 9 No. 2 (2025): Jurnal Golden Age
Publisher : Universitas Hamzanwadi

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Early childhood basically spends more time playing than studying. This will certainly have an impact on children's learning activities. The purpose of this study is to describe the role of parents in assisting early childhood learning activities. This type of research is field research using a descriptive qualitative approach. The data in this study were obtained through observation, interviews and documentation. In analyzing the data, researchers used three stages, namely reduction, data presentation, and drawing conclusions. Based on the results of this study, it can be concluded that parents have a very important role in accompanying early childhood learning activities including: giving children habituation as in everyday life, namely getting children to respect other people. Furthermore, the supporting and inhibiting factors of parents when accompanying children include: applying the lessons that have been given by the teacher at school and parents being impatient when accompanying children in learning activities at home.
TOWARD A GOLDEN STANDARD OF EDUCATION: CONSTRUCTING THE OUTSTANDING SCHOOL MODEL IN MUHAMMADIYAH INSTITUTIONS Mumthaza, Silwana; Utomo, Dwi Priyo; Purwanti, Elly; Pantiwati, Yuni; Rahardjanto, Abdulkadir
Jurnal Ilmiah Ilmu Terapan Universitas Jambi Vol. 10 No. 2 (2026): Volume 10, Nomor 2, April 2026
Publisher : LPPM Universitas Jambi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/jiituj.v10i2.54275

Abstract

Variations in institutional quality indicate the absence of a coherent and standardized framework for defining school excellence. Muhammadiyah has extensive contribution schools in Indonesia. Offers an integrative Outstanding School Model of Muhammadiyah as a strategic framework for achieving a golden standard in future-oriented education. The novelty of this study lies in the integration of Islamic values and future competencies into a unified Outstanding School Model of Muhammadiyah, which is further aligned with a real-world school evaluation system to establish a standardized framework for educational excellence. This study employs a qualitative design-based approach by integrating systematic literature review and document analysis to develop an Outstanding School Model of Muhammadiyah. The findings reveal that, although the MFS instrument is structurally comprehensive, it remains conceptually fragmented. Through thematic and quantitative analysis, its components are reorganized into four core dimensions: academic excellence, Islamic character (Al-Islam and Kemuhammadiyahan), future skills, and institutional quality. The results also indicate an imbalance in indicator distribution, with a strong emphasis on institutional aspects and limited integration of future-oriented competencies. The transformation of an existing evaluation system into a coherent and integrative framework that aligns Islamic educational values with global competencies. Furthermore, the model is aligned with SDG 4 Quality Education, reinforcing its relevance within global educational discourse. This study contributes by providing a standardized reference for improving school quality and guiding the development of Muhammadiyah education toward a sustainable and future-ready paradigm.
The Synergy of Local Wisdom and National Education Policy: A Literature Review on Character Building in Indonesian Early Childhood Education Purwanti, Elly; Khomsiyati, Siti
Indonesian Journal of Education and Youth Development Vol. 2 No. 1 (2026): Indonesian Journal of Education and Youth Development (IJEYD)
Publisher : STIT Pringsewu

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This integrative literature review explores the synergy between local wisdom (kearifan lokal) and national education policy in shaping character building within Indonesian Early Childhood Education (ECE). Drawing upon 19 peer-reviewed articles published between 2015 and 2026, the study examines how indigenous cultural practices, such as traditional games, folklore, and arts, serve as pedagogical vehicles for realizing the character dimensions outlined in the Profil Pelajar Pancasila and the Kurikulum Merdeka. The findings reveal that project-based learning and ethnopedagogical approaches successfully bridge top-down policy with grassroots cultural realities. However, significant barriers remain, including insufficient teacher competency in culturally responsive pedagogy, a lack of localized teaching materials, and epistemological tensions between universalized developmental standards and diverse indigenous values. The review concludes by advocating for strengthened school-community partnerships, the development of culturally sensitive assessment metrics, and a decolonized paradigm that honors Indonesia's cultural plurality as its primary educational asset.
Co-Authors Abdulkadir Rahardjanto, Abdulkadir Ach. Muhib Zainuri Ach. Muhib Zainuri Ahmad Ardiyansyah Ahmad Fauzi Ainun Mardiyah Lubis Akhmad Sukri Aldina, Siti Nur Alhummaira, Satwika Amaliyah Dina Anggraeni Asmah Hidayati Astika Dwi Lorosae Atok Miftachul Hudha Atok Miftachul Hudha Dian Trinsiska Anggraini Diani Fatmawati Dikmatul Qoimah Drs. Sukarsono, M.Si.,, Drs. Sukarsono, Dwi Priyo Utomo Eddy Satriyanto Eko Cahyono, Eko Elisa Elisa Endrik Nurrohman Faqih Asshiddiqie Farida Rachmawati, Farida Fauzi Ahmad Muda Fendy Hardian Permana Fendy Hardian Permana Feni Tin Faizah Firman Arifin, Firman FITRIYAH Fitriyah Fitriyah Fitriyah Fitriyah Fuad Jaya Miharja Hadi Gunawan Sakti Hasan, Aso Hameed Hermanto, Feri Eko Hidajah Rachmawati Husamah Husamah I Gusti Ngurah Agung Wiwekananda Iis Maisaroh Ilham Budi Setyawan Ilham Budi Setyawan, Ilham Irwansyah, Arif Isti Pujiati Kawurian, Hesti Asri Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Khomsiyati , Siti Khomsiyati, Siti Kiky Martha Ariesaka kin, shodikin Laila Nursafitri Laila Nursafitri, Laila Lestari, Novi Puji Liliek Triani Lud Waluyo Marheny Lukitasari Mashudah Masliyah, Anis Mauridhi Hery Purnomo Moch Agus Krisno Budiyanto Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mohamad Amin Muizzudin Muizzudin Mukhammad Aris Mumthaza, Silwana Muzzudin Muzzudin Nafi’ah, Elisa Rohimatun Najichah, Amalia Fajriyyatin Nikmah, Hurrun In Ningrum, Retno Nor Mita Ika Saputri Novan Ardy Wiyani Novan Ardy Wiyani Novita Herawati Nur Islakhun Nisa’ Nurwidodo, Nurwidodo Nuryady, Mohamad Mirza Oktaviana, Anita Panji Ratih Suci, Panji Ratih Patma, Tundung Subali Pradana, Sandi Pujiati, Isti Putri, Ambarwati Rizkia Qoriatul Wahida Rahmat Hidayat Retno Ningrum Rima Kholifatul Janah Riyanto . Rizka, Muhammad Arief Rizki, Sarita Ronny Susetyoko Rr. Eko Susetyarini safitri, cikra ikhda Nur Hamidah Sari, Selvy Ratna Sefriyanti SEFRIYANTI, SEFRIYANTI Sely Tunjung Manik Septiani Selly Susanti SITI FATIMAH Siti Khomsiyati Siti Mufidah Siti Nur Aldina Siti Zaenab sitikhomsiyati Sri Wahyuni Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Syamsiar, Syamsiar Tutut Indria Permana Uminar, Ajeng Ninda Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wangiyana, I Gde Adi Suryawan Warkoyo, W. Wijaya, Candra Kusuma Wiratmoko Yuwono Yasmine Salsabila Muninda Yulia Anita Yuliani, Rifky Luvia Yuni Pantiwati Yuni Pantiwati Yus Mochamad Cholily Zakiyatul Khoiriyah