Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

6.66

P-Index

This Author published in this journals

All Journal International Journal of Evaluation and Research in Education (IJERE) Jurnal Dedikasi Jurnal Gamma Jurnal Pangan dan Gizi AL KAUNIYAH Jurnal Pemikiran dan Pengembangan Sekolah Dasar (JP2SD) JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Jurnal CARE Jurnal Edukasi Matematika dan Sains Journal of Tropical Biodiversity and Biotechnology JOIV : International Journal on Informatics Visualization BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) Jurnal Pendidikan Biologi BIOEDUKASI As-Salam: Jurnal Studi Hukum Islam & Pendidikan AL-ATHFAAL : JURNAL ILMIAH PENDIDIKAN ANAK USIA DINI EnviroScienteae JAST : Jurnal Aplikasi Sains dan Teknologi Journal of Education Technology Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Jurnal Pembelajaran dan Biologi Nukleus JSMARTech : Journal of Smart Bioprospecting and Technology Jurnal Pengabdian UNDIKMA Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran Bioscientist : Jurnal Ilmiah Biologi Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Azzahra : Jurnal Pendidikan Anak Usia Dini Proceeding Biology Education Conference Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Research and Development in Education (RaDEn) Biocaster : Jurnal Kajian Biologi Nuras : Jurnal Pengabdian Kepada Masyarakat Jurnal Peduli : Jurnal Pengabdian Kepada Masyarakat Jurnal Informatika Polinema (JIP) Biosaintifika: Journal of Biology & Biology Education JPPG LinguaScopes: International Journal of Language Education Sasambo: Jurnal Abdimas (Journal of Community Service) Jurnal Kesehatan Masyarakat

Elly Purwanti

Universitas Muhammadiyah Malang

Author-ID : 2882372

Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Other

Published : 72 Documents Claim Missing Document

Claim Missing Document

Articles

4 5 6 7 8

Rintisan Pelestarian dan Pengembangan Budidaya Anggur di Desa Sumberbulu Kecamatan Tegalsiwalan Kabupaten Probolinggo Wahyu Prihanta; Elly Purwanti
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 4 No. 4: November 2022
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/sasambo.v4i4.960

Permasalahan yang dihadapi mitra pengabdian kepada masyarakat (Kelompok Masyarakat Anggur Lestari yang berada di Desa Sumberbulu, Kecamatan Tegalsiwalan Kabupaten Probolinggo) ini adalah bahwa dalam budidaya anggur (1) mitra kesulitan untuk memilih jenis-jenis yang sesuai untuk dibudidayakan; (2) mitra masih memiliki pengetahuan yang masih rendah tentang budidaya anggur mulai dari penanaman dan perawatan tanaman anggur; (3) mitra belum memiliki pengetahuan dan ketrampilan yang memadai untuk menghindari kerusakan anggur akibat erupsi gunung dan musim hujan yang lebih panjang dari siklus normal tahuanan; (4) mitra belum memiliki strategi untuk budidaya dan pelestarian anggur baik dari strategi budidaya maupun segi kewirausahaan; dan (5. mitra belum memiliki grand design untuk pengembangan tanaman anggur. Oleh karena itu, tujuan pengabdian ini adalah melakukan pendampingan dalam perintisan pelestarian dan pengembangan budidaya anggur di Desa Sumberbulu Kecamatan Tegalsiwalan Kabupaten Probolinggo. Metode kegiatan dalan program pengabdian ini meliputi (1) persiapan pelaksanaan bersama dengan mitra, (2) pelaksanaan yang meliputi pembuatan grand design, studi banding, diklat dan pendampingan pada penanaman sampai perawatan, dan pembentukan jejaring, serta (3) evaluasi. Indikator keberhasilan program adalah terlaksananya semua kegiatan (100% terlaksana). Dapat disimpulkan bahwa kegiatan pengabdian masyarakat telah berhasil dan telah meningkatkan pengetahuan kelompok dalam pemilihan varietas yang sesuai, meningkatkan pengetahuan dan ketrampilan budidaya anggur, dan membantu dalam pembuatan grand design pengembangan kegiatan budidaya anggur. Pioneering Preservation and Development of Grape Cultivation in Sumberbulu Village, Tegalsiwalan District, Probolinggo Regency The problems faced by community service partners (the Lestari Grape Community Group located in Sumberbulu Village, Tegalsiwalan District, Probolinggo Regency) are that in grape cultivation (1) partners have difficulty choosing the appropriate types for cultivation; (2) partners still have low knowledge about grape cultivation starting from planting and caring for grapevines; (3) partners do not have sufficient knowledge and skills to prevent damage to grapes due to mountain eruptions and rainy seasons which are longer than the annual normal cycle; (4) partners do not yet have a strategy for cultivating and preserving grapes, both from a cultivation strategy and an entrepreneurial perspective; and (5. partners do not yet have a grand design for the development of grapevines. Therefore, the purpose of this service is to provide assistance in pioneering the preservation and development of grape cultivation in Sumberbulu Village, Tegalsiwalan District, Probolinggo Regency. The method of activity in this service program includes (1) preparation joint implementation with partners, (2) implementation which includes making a grand design, comparative studies, training and assistance from planting to care, and forming networks, and (3) evaluation.The indicator of program success is the implementation of all activities (100% implemented). it was concluded that the community service activities had been successful and had increased the group's knowledge in selecting suitable varieties, increased the knowledge and skills of grape cultivation, and assisted in making a grand design for the development of grape cultivation activities

Development of Android-based Bimanji e-media for Innovation Learning Resources on Ecosystem Material Nikmah, Hurrun In; Pantiwati, Yuni; Nurwidodo, Nurwidodo; Purwanti, Elly
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7181

Background: The rapid development of technology in the Industrial Revolution 4.0 era significantly affects various sectors, especially education. This research aimed to develop an innovative Android-based educational game, Bimanji (Biology Jumanji), as an interactive learning medium for ecosystem material in junior high school. Methodology: The study employed the ADDIE (Analysis, Design, Development, Implementation, Evaluation) development model. The product was tested at Junior High School of Muhammadiyah 1 Surabaya. Data was collected through observations, interviews, documentation, and validation questionnaires by media, material, language, IT experts, and student and teacher responses. Bimanji integrates the concept of the popular Jumanji board game with interactive, contextual learning content, including 2D animation and multiplayer features. Findings: The content covers biotic-abiotic interactions, trophic levels, food chains, food webs, and ecological awareness. Validation results showed that Bimanji achieved a 92 % average validity score, indicating a high feasibility level without requiring significant revisions. Practicality tests with 16 students and teacher also resulted in high scores (93 % and 88 %, respectively), confirming its usability and effectiveness. The game enhances students' understanding of ecosystem concepts and motivation through fun and collaborative digital learning. Contribution: This research concludes that Bimanji is a highly valid, practical, and accessible educational medium suitable for classroom and independent learning. Limitations involve limited field trials and require broader implementation. Future development may integrate augmented reality to enrich the user experience further.

Menanamkan Literasi Lingkungan pada Peserta Didik Sekolah Dasar Melalui Spesific Program : Eco-Mapping Prihanta, Wahyu; Purwanti, Elly; Muizzudin, Muizzudin; Cahyono, Eko
Nuras : Jurnal Pengabdian Kepada Masyarakat Vol. 1 No. 1 (2021): October
Publisher : Lembaga Pendidikan, Penelitian, dan Pengabdian Kamandanu

Elementary school students are a period for children's development to acquire the educational process by applying a real learning approach based on facts and not much theory. Elementary school age has an important meaning for children's development, because it is a pillar of support for the solid development of personality, psychomotor, cognitive, and social, including preparing their sensitivity to environmental problems in order to increase the environmental literacy of students. For this reason, it is necessary to develop a learning environment that is in accordance with the characteristics of elementary school students, with the following characteristics: 1) environmental learning that instills environmental-loving behavior; 2) learning environment that intensifies the interaction of students and learning resources; 3) environmental learning is done while playing; 4) learning for the development of the potential of students; 5) learning environment that provides a sense of security to students; 6) environmental learning carried out in an integrated manner; 7) environmental learning that involves community participation; and 8) environment-based thematic learning. The purpose of this activity is to increase the environmental literacy of students through concrete actions of habituation of environmentally friendly and sustainable behavior in order to overcome environmental problems in schools and surrounding communities, including preparing their sensitivity to environmental problems in order to increase students' environmental literacy. Implementation of activities in the form of school environmental audits, through eco-mapping activities of the school environment. Audits conducted by students include: 1) electrical energy; 2) garbage; 3) water sources; 4) noise; and 5) green environment. The results of school environmental audit activities using the eco-mapping method, audits on the parameters of energy sources, waste, water, and the school's green environment, it was found that from all the observed parameters, schools had not utilized environmental resources optimally. Knowledge, awareness, and behavior towards the environment among students at the elementary school level are still quite low.

Agroforesty Curriculum Management at Tunas Rimba I Kindergarten Purwokerto Pujiati, Isti; Wiyani, Novan Ardy; Purwanti, Elly
Al-Athfaal: Jurnal Ilmiah Pendidikan Anak Usia Dini Vol. 6 No. 2 (2023): Al-Athfaal: Jurnal Ilmiah Pendidikan Anak Usia Dini
Publisher : Universitas Islam Negeri Raden Intan Lampung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24042/00202361759600

This research aims to describe the management of the agroforestry curriculum at Tunas Rimba I Kindergarten, Purwokerto. This research is qualitative. Data was collected using interview, observation, and documentation techniques. The data that has been collected is then analyzed through the data reduction, data presentation, and verification stages. The research results show four activities carried out in the agroforestry curriculum management at Tunas Rimba I Kindergarten, Purwokerto. These four activities include planning the agroforestry curriculum. These planning activities prepared an agroforestry learning schedule and a Daily Learning Implementation Plan (RPPH). Second, organizing the agroforestry curriculum. In this organization, teaching tasks are distributed, the academic calendar is prepared, the curriculum structure is prepared, and the study group is determined. Third, implementing the agroforestry curriculum, where in implementing the curriculum, agroforestry learning activities are held through intracurricular and extracurricular activities so that young children can achieve the agroforestry learning objectives set out in the RPPH. Fourth, an evaluation of the agroforestry curriculum is aimed at determining the success of teachers in implementing the agroforestry curriculum.

Identifying Classroom Teachers’ Challenges in Teaching Bahasa Indonesia Vocabulary in Elementary School Rizki, Sarita; Najichah, Amalia Fajriyyatin; Uminar, Ajeng Ninda; Purwanti, Elly
LinguaScopes: International Journal of Language Education Vol. 2 No. 1 (2025): LinguaScopes: International Journal of Language Education
Publisher : Madiha Press

Show Abstract | Download Original | Original Source | Check in Google Scholar

This study identifies and analyzes the obstacles faced by elementary classroom teachers in teaching Bahasa Indonesia vocabulary. Utilizing a qualitative descriptive research design, data was gathered through semi-structured interviews and classroom observations of two experienced teachers. Thematic analysis of the collected data revealed a range of interconnected challenges. Key findings indicate that teachers struggle with insufficient pedagogical training for vocabulary instruction, limited access to engaging teaching resources, and significant time constraints within the curriculum. Furthermore, obstacles related to student motivation and the wide variation in students' prior knowledge were found to impede effective learning. The report concludes that current vocabulary instruction is often insufficient, contributing to a persistent "vocabulary gap" among students. The findings provide crucial insights for educators and policymakers, emphasizing the need for targeted professional development, improved resource allocation, and a curriculum that better supports foundational language skills.

Pelatihan Pengolahan Sampah dan Aplikasinya pada Budidaya Sayuran Organik bagi Siswa Sekolah Menengah Atas Wahyu Prihanta; Elly Purwanti; Muizzudin Muizzudin; Feni Tin Faizah
Jurnal Pengabdian UNDIKMA Vol. 4 No. 2 (2023): May
Publisher : LPPM Universitas Pendidikan Mandalika (UNDIKMA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33394/jpu.v4i2.7017

This service activity aims to foster knowledge, attitudes and skills of high school students regarding waste management and its application to organic vegetable cultivation. The community service is carried out through training which consists of the preparation, implementation and evaluation stages. The target partners for this service are SMAN 2 Kota Batu students with a total of 359 students. The evaluation instrument used a questionnaire and was then analyzed descriptively. The results of the service show that this activity has succeeded in growing students' knowledge and skills in processing organic waste into compost and planting organic vegetables from the compost produced. The results of the activity evaluation show that students have been able to carry out waste processing and planting organic vegetables properly and correctly according to the takakura method. The indicator of the success of this service is the increasing of students' skills in processing organic waste and planting organic vegetables. This has been proven by the success of students in processing organic waste at home and the many plants that have been successfully developed from the results of processing organic waste.

Real-Time Embedded Vision System for Road Damage Detection Utilizing Deep Learning Putri, Ambarwati Rizkia; Irwansyah, Arif; Arifin, Firman; Purwantini, Elly; Wijaya, Candra Kusuma
JOIV : International Journal on Informatics Visualization Vol 9, No 5 (2025)
Publisher : Society of Visual Informatics

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.62527/joiv.9.5.3661

Accidents resulting from road damage are becoming a serious concern, emphasizing the need for efficient monitoring systems and timely government intervention. This research highlights the potential of advanced AI-driven solutions in road safety management, providing a practical approach to efficiently monitoring and maintaining road conditions. It presents a real-time embedded vision system for automatic road damage detection using deep learning techniques. The system is designed to classify six types of road damage and has been implemented on two platforms: Jetson Nano and a personal computer or laptop. A comparative analysis was conducted to evaluate accuracy, computational performance, and power efficiency. The study employs YOLO (v5, v7, v8) and EfficientDet algorithms for detecting road damage. Experimental results indicate that EfficientDet achieves the highest accuracy at 88%, while YOLO attains 63%. In terms of computational performance, YOLOv8 delivers the highest frame rate, reaching 25 FPS on the Jetson Nano. Power efficiency analysis reveals that YOLOv8 on the Jetson Nano is six times more energy-efficient compared to its implementation on a laptop. Likewise, EfficientDet on Jetson Nano demonstrates three times better energy efficiency than on a laptop. These findings underscore the feasibility of deploying AI-powered embedded vision systems for detecting road damage. The use of deep learning models on energy-efficient platforms, such as Jetson Nano, enhances real-time performance while minimizing power consumption. Future research should focus on optimizing these models to enhance performance on edge devices while further assessing their practical applications in real-world environments.

Breeding Site Preferences and Resistance Status of Aedes aegypti in Malang City Nuryady, Moh Mirza; Purwanti, Elly; Permana, Tutut Indria; Ariesaka, Kiky Martha
Jurnal Kesehatan Masyarakat Vol. 21 No. 2 (2025)
Publisher : Universitas Negeri Semarang in collaboration with Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI Tingkat Pusat) and Jejaring Nasional Pendidikan Kesehatan (JNPK)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/kemas.v21i2.21666

Dengue Hemorrhagic Fever (DHF) remains a significant health challenge in urban and semi-urban regions, including Malang City, Indonesia, where Aedes aegypti is the primary vector. This study aimed to identify the breeding site preferences of Ae. aegypti and assess its resistance to 0.8% malathion and 0.05% cypermethrin insecticides. Using a descriptive observational design, ovitraps were deployed in three districts to collect mosquito larvae and eggs, and interviews with residents provided additional data on breeding site preferences. Resistance tests followed WHO guidelines, with mortality rates analysed after insecticide exposure. Results indicated that Ae. aegypti larvae were predominantly found in bathroom water tanks (45%) and flower vases (35%). Resistance status revealed geographical variability: Ae. aegypti in District 1 were resistant to cypermethrin, while populations in Districts 2 and 3 were susceptible, with average status of Ae. Aegypti to cypermethrin is tolerant. For malathion, resistance was widespread, particularly in District 3, with average status of Ae. Aegypti to malathion is resistant. These findings suggest that the use of malathion for vector control in Malang is no longer effective, while cypermethrin remains viable under strict monitoring to prevent future resistance. This study underscores the need for targeted insecticide use and regular monitoring to optimize vector control strategies and minimize DHF transmission.

Dual Inhibition of PTP1B and DPP4 by Canavalia ensiformis Bioactive Compounds: A Synergy of Nutrition and Therapeutics Purwanti, Elly; Rachmawati, Farida; Hasan, Aso Hameed; Nuryady, Mohamad Mirza; Permana, Tutut Indria; Prihanta, Wahyu
JSMARTech: Journal of Smart Bioprospecting and Technology Vol. 6 No. 2 (2025): Vol. 6 No. 2 (2025): JSMARTech Volume 6, No 2, 2025
Publisher : JSMARTech

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jsmartech.2025.006.02.23

Diabetes mellitus affects over 460 million adults worldwide and is projected to rise further, underscoring the urgency for safe, nutrition-based strategies to improve glycaemic control. Legumes have been known for dietary intervention for diabetic patients. However, studies evaluating the functional properties of Canavalia ensiformis for diabetes management are limited. This study investigated C. ensiformis beans for their nutritional profile and therapeutic potential in diabetes management. Nutritional values were analyzed by proximate and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), while bioactive compounds were identified by untargeted metabolite profiling using Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS). Anti-diabetic potential of identified bioactives was evaluated through molecular docking by using AutoDock Vina against dipeptidyl peptidase-4 (DPP4) and protein tyrosine phosphatase 1B (PTP1B) as known diabetic-associated enzymes. Nutritional analysis revealed a composition rich in crude protein (26.34%) and carbohydrates (54.84%), complemented by substantial mineral content, including calcium, iron, and zinc, which collectively support metabolic and physiological functions. Phytochemical profiling identified 22 bioactive compounds, such as flavonoids (e.g., Kaempferol), phenolic derivatives (e.g., Curcumin), and amino acids (e.g., DL-Tryptophan), known for their roles in oxidative stress reduction and glucose metabolism modulation. Molecular docking studies demonstrated that Kaempferol exhibiting binding affinities of − 7.7 kcal mol⁻¹ (DPP4) and − 7.5 kcal mol⁻¹ (PTP1B), while DL-Tryptophan showed comparable interactions. These ligands occupied the catalytic pockets of both enzymes and engaged key residues, mirroring the binding patterns of native ligands, indicating competitive inhibition that may enhance insulin signalling and prolong incretin action. The dual-target inhibition of PTP1B and DPP4, coupled with the bean’s high nutritional value, positions C. ensiformis as a promising functional food for diabetes management, merging dietary benefits with therapeutic potential. Keywords: Functional food, Diabetes Mellitus, Dietary Intervention, DPP4 inhibitor, PTP1B inhibitor.

Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers for the COX-1 gene of A. aegypti.

Co-Authors Ach. Muhib Zainuri Ach. Muhib Zainuri Ahmad Ardiyansyah Ahmad Fauzi Akhmad Sukri Aldina, Siti Nur Amaliyah Dina Anggraeni Asmah Hidayati Astika Dwi Lorosae Atok Miftachul Hudha Atok Miftachul Hudha Dian Trinsiska Anggraini Diani Fatmawati Drs. Sukarsono, M.Si.,, Drs. Sukarsono, Eddy Satriyanto Eko Cahyono, Eko Endrik Nurrohman Faqih Asshiddiqie Farida Rachmawati, Farida Fauzi Ahmad Muda Fendy Hardian Permana Fendy Hardian Permana Feni Tin Faizah Firman Arifin, Firman FITRIYAH Fitriyah Fitriyah Fitriyah Fitriyah Fuad Jaya Miharja Hadi Gunawan Sakti Hasan, Aso Hameed Hermanto, Feri Eko Hidajah Rachmawati Husamah Husamah I Gusti Ngurah Agung Wiwekananda Ilham Budi Setyawan Ilham Budi Setyawan, Ilham Irwansyah, Arif Isti Pujiati Kawurian, Hesti Asri Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Khomsiyati , Siti Khomsiyati, Siti Kiky Martha Ariesaka kin, shodikin Laila Nursafitri Laila Nursafitri, Laila Lestari, Novi Puji Liliek Triani Lud Waluyo Marheny Lukitasari Mashudah Masliyah, Anis Mauridhi Hery Purnomo Moch Agus Krisno Budiyanto Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mohamad Amin Muizzudin Muizzudin Mukhammad Aris Muzzudin Muzzudin Nafiâ€™ah, Elisa Rohimatun Najichah, Amalia Fajriyyatin Nikmah, Hurrun In Ningrum, Retno Novan Ardy Wiyani Novan Ardy Wiyani Novita Herawati Nur Islakhun Nisa’ Nurwidodo, Nurwidodo Nuryady, Mohamad Mirza Panji Ratih Suci, Panji Ratih Patma, Tundung Subali Pujiati, Isti Putri, Ambarwati Rizkia Qoriatul Wahida Rahmat Hidayat Retno Ningrum Rima Kholifatul Janah Riyanto . Rizka, Muhammad Arief Rizki, Sarita Ronny Susetyoko safitri, cikra ikhda Nur Hamidah Sefriyanti SEFRIYANTI, SEFRIYANTI Sely Tunjung Manik Septiani Selly Susanti SITI FATIMAH Siti Khomsiyati Siti Mufidah Siti Nur Aldina Siti Zaenab sitikhomsiyati Sri Wahyuni Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Syamsiar, Syamsiar Tutut Indria Permana Uminar, Ajeng Ninda Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wangiyana, I Gde Adi Suryawan Warkoyo, W. Wijaya, Candra Kusuma Wiratmoko Yuwono Yasmine Salsabila Muninda Yuliani, Rifky Luvia Yuni Pantiwati Yuni Pantiwati Zakiyatul Khoiriyah

Title

Found 72 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 72 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 72 Documents
Search