Article Per Year (5 Year)
p-Index From 2021 - 2026
6.705
P-Index
This Author published in this journals
All Journal International Journal of Evaluation and Research in Education (IJERE) Jurnal Dedikasi Jurnal Gamma Jurnal Pangan dan Gizi AL KAUNIYAH Jurnal Pemikiran dan Pengembangan Sekolah Dasar (JP2SD) JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Jurnal CARE Jurnal Edukasi Matematika dan Sains Journal of Tropical Biodiversity and Biotechnology JOIV : International Journal on Informatics Visualization BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) Jurnal Pendidikan Biologi Jurnal Penelitian Pendidikan IPA (JPPIPA) BIOEDUKASI As-Salam: Jurnal Studi Hukum Islam & Pendidikan AL-ATHFAAL : JURNAL ILMIAH PENDIDIKAN ANAK USIA DINI EnviroScienteae JAST : Jurnal Aplikasi Sains dan Teknologi Journal of Education Technology Jurnal Golden Age Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Jurnal Pembelajaran dan Biologi Nukleus JSMARTech : Journal of Smart Bioprospecting and Technology Jurnal Pengabdian UNDIKMA Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran Bioscientist : Jurnal Ilmiah Biologi Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Azzahra : Jurnal Pendidikan Anak Usia Dini Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Research and Development in Education (RaDEn) Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biocaster : Jurnal Kajian Biologi Nuras : Jurnal Pengabdian Kepada Masyarakat West Science Journal Economic and Entrepreneurship Jurnal Informatika Polinema (JIP) JPPG LinguaScopes: International Journal of Language Education Sasambo: Jurnal Abdimas (Journal of Community Service)
Elly Purwanti
Universitas Muhammadiyah Malang
Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Other

Published : 64 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 64 Documents
Search

 3   4   5   6   7 
Identifying Classroom Teachers’ Challenges in Teaching Bahasa Indonesia Vocabulary in Elementary School Rizki, Sarita; Najichah, Amalia Fajriyyatin; Uminar, Ajeng Ninda; Purwanti, Elly
LinguaScopes: International Journal of Language Education Vol. 2 No. 1 (2025): LinguaScopes: International Journal of Language Education
Publisher : Madiha Press

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This study identifies and analyzes the obstacles faced by elementary classroom teachers in teaching Bahasa Indonesia vocabulary. Utilizing a qualitative descriptive research design, data was gathered through semi-structured interviews and classroom observations of two experienced teachers. Thematic analysis of the collected data revealed a range of interconnected challenges. Key findings indicate that teachers struggle with insufficient pedagogical training for vocabulary instruction, limited access to engaging teaching resources, and significant time constraints within the curriculum. Furthermore, obstacles related to student motivation and the wide variation in students' prior knowledge were found to impede effective learning. The report concludes that current vocabulary instruction is often insufficient, contributing to a persistent "vocabulary gap" among students. The findings provide crucial insights for educators and policymakers, emphasizing the need for targeted professional development, improved resource allocation, and a curriculum that better supports foundational language skills.
Pelatihan Pengolahan Sampah dan Aplikasinya pada Budidaya Sayuran Organik bagi Siswa Sekolah Menengah Atas Wahyu Prihanta; Elly Purwanti; Muizzudin Muizzudin; Feni Tin Faizah
Jurnal Pengabdian UNDIKMA Vol. 4 No. 2 (2023): May
Publisher : LPPM Universitas Pendidikan Mandalika (UNDIKMA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33394/jpu.v4i2.7017

Abstract

This service activity aims to foster knowledge, attitudes and skills of high school students regarding waste management and its application to organic vegetable cultivation. The community service is carried out through training which consists of the preparation, implementation and evaluation stages. The target partners for this service are SMAN 2 Kota Batu students with a total of 359 students. The evaluation instrument used a questionnaire and was then analyzed descriptively. The results of the service show that this activity has succeeded in growing students' knowledge and skills in processing organic waste into compost and planting organic vegetables from the compost produced. The results of the activity evaluation show that students have been able to carry out waste processing and planting organic vegetables properly and correctly according to the takakura method. The indicator of the success of this service is the increasing of students' skills in processing organic waste and planting organic vegetables. This has been proven by the success of students in processing organic waste at home and the many plants that have been successfully developed from the results of processing organic waste.
Real-Time Embedded Vision System for Road Damage Detection Utilizing Deep Learning Putri, Ambarwati Rizkia; Irwansyah, Arif; Arifin, Firman; Purwantini, Elly; Wijaya, Candra Kusuma
JOIV : International Journal on Informatics Visualization Vol 9, No 5 (2025)
Publisher : Society of Visual Informatics

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.62527/joiv.9.5.3661

Abstract

Accidents resulting from road damage are becoming a serious concern, emphasizing the need for efficient monitoring systems and timely government intervention. This research highlights the potential of advanced AI-driven solutions in road safety management, providing a practical approach to efficiently monitoring and maintaining road conditions. It presents a real-time embedded vision system for automatic road damage detection using deep learning techniques. The system is designed to classify six types of road damage and has been implemented on two platforms: Jetson Nano and a personal computer or laptop. A comparative analysis was conducted to evaluate accuracy, computational performance, and power efficiency. The study employs YOLO (v5, v7, v8) and EfficientDet algorithms for detecting road damage. Experimental results indicate that EfficientDet achieves the highest accuracy at 88%, while YOLO attains 63%. In terms of computational performance, YOLOv8 delivers the highest frame rate, reaching 25 FPS on the Jetson Nano. Power efficiency analysis reveals that YOLOv8 on the Jetson Nano is six times more energy-efficient compared to its implementation on a laptop. Likewise, EfficientDet on Jetson Nano demonstrates three times better energy efficiency than on a laptop. These findings underscore the feasibility of deploying AI-powered embedded vision systems for detecting road damage. The use of deep learning models on energy-efficient platforms, such as Jetson Nano, enhances real-time performance while minimizing power consumption. Future research should focus on optimizing these models to enhance performance on edge devices while further assessing their practical applications in real-world environments.
Dual Inhibition of PTP1B and DPP4 by Canavalia ensiformis Bioactive Compounds: A Synergy of Nutrition and Therapeutics Purwanti, Elly; Rachmawati, Farida; Hasan, Aso Hameed; Nuryady, Mohamad Mirza; Permana, Tutut Indria; Prihanta, Wahyu
JSMARTech: Journal of Smart Bioprospecting and Technology Vol. 6 No. 2 (2025): Vol. 6 No. 2 (2025): JSMARTech Volume 6, No 2, 2025
Publisher : JSMARTech

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jsmartech.2025.006.02.23

Abstract

Diabetes mellitus affects over 460 million adults worldwide and is projected to rise further, underscoring the urgency for safe, nutrition-based strategies to improve glycaemic control. Legumes have been known for dietary intervention for diabetic patients. However, studies evaluating the functional properties of Canavalia ensiformis for diabetes management are limited. This study investigated C. ensiformis beans for their nutritional profile and therapeutic potential in diabetes management. Nutritional values were analyzed by proximate and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), while bioactive compounds were identified by untargeted metabolite profiling using Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS). Anti-diabetic potential of identified bioactives was evaluated through molecular docking by using AutoDock Vina against dipeptidyl peptidase-4 (DPP4) and protein tyrosine phosphatase 1B (PTP1B) as known diabetic-associated enzymes. Nutritional analysis revealed a composition rich in crude protein (26.34%) and carbohydrates (54.84%), complemented by substantial mineral content, including calcium, iron, and zinc, which collectively support metabolic and physiological functions. Phytochemical profiling identified 22 bioactive compounds, such as flavonoids (e.g., Kaempferol), phenolic derivatives (e.g., Curcumin), and amino acids (e.g., DL-Tryptophan), known for their roles in oxidative stress reduction and glucose metabolism modulation. Molecular docking studies demonstrated that Kaempferol exhibiting binding affinities of − 7.7 kcal mol⁻¹ (DPP4) and − 7.5 kcal mol⁻¹ (PTP1B), while DL-Tryptophan showed comparable interactions. These ligands occupied the catalytic pockets of both enzymes and engaged key residues, mirroring the binding patterns of native ligands, indicating competitive inhibition that may enhance insulin signalling and prolong incretin action. The dual-target inhibition of PTP1B and DPP4, coupled with the bean’s high nutritional value, positions C. ensiformis as a promising functional food for diabetes management, merging dietary benefits with therapeutic potential.   Keywords: Functional food, Diabetes Mellitus, Dietary Intervention, DPP4 inhibitor, PTP1B inhibitor.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Formulasi dan Uji Mutu Fisik Ekstrak Daun Bidara (Ziziphus mauritiana L.) pada Sediaan Lotion Masliyah, Anis; Suci, Panji Ratih; Purwanti, Elly; Safitri, Cikra Ikhda Nur Hamidah
Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) 2021: Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek)
Publisher : Universitas Muhammadiyah Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (195.569 KB)

Abstract

Tanaman Daun Bidara (Ziziphus mauritiana L.) merupakan taman yang berasal dari arab, sejenis pohon kecil yang selalu hijau, penghasil buah yang tumbuh di daerah tropis serta Asia Barat dan dapat tumbuh di lembah-lembah sampai ketinggian 500 m dpl. Tanaman bidara sudah banyak di budidayakan. Dalam pemanfaatan tanaman daun bidara dapat di olah menjadi sediaan lotion karena mengandung senyawa flavonoid dan alkaloid. Untuk membuat penelitian ini menggunakan formulasi sediaan lotion yang akan di uji mutu fisik dari sediaannya. Ekstrak daun bidara dibuat menggunakan metode maserasi menggunakan etanol 96% konsentrasi ekstrak 3%, 5%, 7%. Evaluasi mutu fisik sediaan meliputi berbagai uji termasuk uji organoleptis, uji homogenitas, uji pH, uji ti emulsi dan uji stabilitas penyimpanan selama 30 hari. Hasil penelitian ini bau lotion beraroma khas dari ekstrak daun bidara, warna lotion hijau tua tidak ada perubahan warna selama 30 hari dengan suhu ruang, pH berkisar 6-7, homogenitas lotion stabil, dan tipe emulsi lotion W/O. Berdasarkan hasil penelitian ini dapat disimpulkan bahwa lotion stabil pada parameter, pH dan tipe emulsi tidak ada perubahan mutu fisik sediaan lotion pada konsentrasi 3%, 5%, 7% yang disimpan pada suhu ruang.
Peran Orangtua Dalam Mendampingi Kegiatan Belajar Anak Usia Dini Oktaviana, Anita; Purwanti, Elly
Jurnal Golden Age Vol. 9 No. 2 (2025): Jurnal Golden Age
Publisher : Universitas Hamzanwadi

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Early childhood basically spends more time playing than studying. This will certainly have an impact on children's learning activities. The purpose of this study is to describe the role of parents in assisting early childhood learning activities. This type of research is field research using a descriptive qualitative approach. The data in this study were obtained through observation, interviews and documentation. In analyzing the data, researchers used three stages, namely reduction, data presentation, and drawing conclusions. Based on the results of this study, it can be concluded that parents have a very important role in accompanying early childhood learning activities including: giving children habituation as in everyday life, namely getting children to respect other people. Furthermore, the supporting and inhibiting factors of parents when accompanying children include: applying the lessons that have been given by the teacher at school and parents being impatient when accompanying children in learning activities at home.
TOWARD A GOLDEN STANDARD OF EDUCATION: CONSTRUCTING THE OUTSTANDING SCHOOL MODEL IN MUHAMMADIYAH INSTITUTIONS Mumthaza, Silwana; Utomo, Dwi Priyo; Purwanti, Elly; Pantiwati, Yuni; Rahardjanto, Abdulkadir
Jurnal Ilmiah Ilmu Terapan Universitas Jambi Vol. 10 No. 2 (2026): Volume 10, Nomor 2, April 2026
Publisher : LPPM Universitas Jambi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/jiituj.v10i2.54275

Abstract

Variations in institutional quality indicate the absence of a coherent and standardized framework for defining school excellence. Muhammadiyah has extensive contribution schools in Indonesia. Offers an integrative Outstanding School Model of Muhammadiyah as a strategic framework for achieving a golden standard in future-oriented education. The novelty of this study lies in the integration of Islamic values and future competencies into a unified Outstanding School Model of Muhammadiyah, which is further aligned with a real-world school evaluation system to establish a standardized framework for educational excellence. This study employs a qualitative design-based approach by integrating systematic literature review and document analysis to develop an Outstanding School Model of Muhammadiyah. The findings reveal that, although the MFS instrument is structurally comprehensive, it remains conceptually fragmented. Through thematic and quantitative analysis, its components are reorganized into four core dimensions: academic excellence, Islamic character (Al-Islam and Kemuhammadiyahan), future skills, and institutional quality. The results also indicate an imbalance in indicator distribution, with a strong emphasis on institutional aspects and limited integration of future-oriented competencies. The transformation of an existing evaluation system into a coherent and integrative framework that aligns Islamic educational values with global competencies. Furthermore, the model is aligned with SDG 4 Quality Education, reinforcing its relevance within global educational discourse. This study contributes by providing a standardized reference for improving school quality and guiding the development of Muhammadiyah education toward a sustainable and future-ready paradigm.
Effectiveness of STEM-Based Project-Based Learning in Enhancing Senior High School Students’ Scientific Literacy Ainun Mardiyah Lubis; Yus Mochamad Cholily; Rr. Eko Susetyarini; Elly Purwanti; Yulia Anita; Nor Mita Ika Saputri; Elisa; Dikmatul Qoimah
Jurnal Penelitian Pendidikan IPA Vol 12 No 1 (2026)
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v12i1.14077

Abstract

The purpose of this study was to examine the effectiveness of the STEM (science, technology, engineering, and mathematics)-based Project-Based Learning (PjBL) model in improving senior high school students’ scientific literacy. This study employed a quasi-experimental method with a pre-test and post-test nonequivalent control group design and was conducted at SMA Negeri 5 Padangsidimpuan. The research involved two classes consisting of 35 students each: an experimental class taught using STEM-based PjBL and a control class taught using conventional learning. Scientific literacy was measured using an essay test, while students’ attitudes toward science were assessed through a questionnaire. The results of the independent samples t-test showed no significant difference in students’ initial abilities (sig. = 0.064 > 0.05). However, the post-test results indicated a significant difference between the two groups (sig. = 0.000 < 0.05), with the experimental class achieving a higher mean score. In addition, students’ attitudes toward science in the experimental class were categorized as good to very good. These findings indicate that STEM-based Project-Based Learning is effective in enhancing students’ scientific literacy.
Development of Android-based Bimanji e-media for Innovation Learning Resources on Ecosystem Material Hurrun In Nikmah; Yuni Pantiwati; Nurwidodo Nurwidodo; Elly Purwanti
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7181

Abstract

Background: The rapid development of technology in the Industrial Revolution 4.0 era significantly affects various sectors, especially education. This research aimed to develop an innovative Android-based educational game, Bimanji (Biology Jumanji), as an interactive learning medium for ecosystem material in junior high school. Methodology: The study employed the ADDIE (Analysis, Design, Development, Implementation, Evaluation) development model. The product was tested at Junior High School of  Muhammadiyah 1 Surabaya. Data was collected through observations, interviews, documentation, and validation questionnaires by media, material, language, IT experts, and student and teacher responses. Bimanji integrates the concept of the popular Jumanji board game with interactive, contextual learning content, including 2D animation and multiplayer features. Findings: The content covers biotic-abiotic interactions, trophic levels, food chains, food webs, and ecological awareness. Validation results showed that Bimanji achieved a 92 % average validity score, indicating a high feasibility level without requiring significant revisions. Practicality tests with 16 students and teacher also resulted in high scores (93 % and 88 %, respectively), confirming its usability and effectiveness. The game enhances students' understanding of ecosystem concepts and motivation through fun and collaborative digital learning. Contribution: This research concludes that Bimanji is a highly valid, practical, and accessible educational medium suitable for classroom and independent learning. Limitations involve limited field trials and require broader implementation. Future development may integrate augmented reality to enrich the user experience further.
Co-Authors Abdulkadir Rahardjanto, Abdulkadir Ach. Muhib Zainuri Ach. Muhib Zainuri Ahmad Ardiyansyah Ahmad Fauzi Ainun Mardiyah Lubis Akhmad Sukri Aldina, Siti Nur Amaliyah Dina Anggraeni Asmah Hidayati Astika Dwi Lorosae Atok Miftachul Hudha Atok Miftachul Hudha Darmansyah Pulungan Dian Trinsiska Anggraini Diani Fatmawati Dikmatul Qoimah Drs. Sukarsono, M.Si.,, Drs. Sukarsono, Dwi Priyo Utomo Eddy Satriyanto Eko Cahyono Elisa Elisa Endrik Nurrohman Eny Mayasari Faqih Asshiddiqie Farida Rachmawati, Farida Fauzi Ahmad Muda Fendy Hardian Permana Fendy Hardian Permana Feni Tin Faizah Firman Arifin, Firman FITRIYAH Fitriyah Fitriyah Fuad Jaya Miharja Hadi Gunawan Sakti Hasan, Aso Hameed Hermanto, Feri Eko Hidajah Rachmawati Hurrun In Nikmah Husamah Husamah I Gusti Ngurah Agung Wiwekananda Ilham Budi Setyawan Ilham Budi Setyawan, Ilham Irwansyah, Arif Isti Pujiati Kawurian, Hesti Asri Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Kiky Martha Ariesaka kin, shodikin Laila Nursafitri Lestari, Novi Puji Liliek Triani Lud Waluyo Marheny Lukitasari Mashudah Masliyah, Anis Mauridhi Hery Purnomo Moch Agus Krisno Budiyanto Moh. Mirza Nuryady Mohamad Amin Muizzudin Muizzudin Muizzudin Muizzudin Mukhammad Aris Mumthaza, Silwana Muzzudin Muzzudin Nafi’ah, Elisa Rohimatun Najichah, Amalia Fajriyyatin Ningrum, Retno Nor Mita Ika Saputri Novan Ardy Wiyani Novan Ardy Wiyani Novita Herawati Nur Islakhun Nisa’ Nurwidodo, Nurwidodo Nuryady, Mohamad Mirza Oktaviana, Anita Panji Ratih Suci, Panji Ratih Patma, Tundung Subali Pujiati, Isti Putri, Ambarwati Rizkia Qoriatul Wahida Rahmat Hidayat Retno Ningrum Rima Kholifatul Janah Riski Baroroh Riyanto . Rizka, Muhammad Arief Rizki, Sarita Ronny Susetyoko Rr. Eko Susetyarini safitri, cikra ikhda Nur Hamidah Sefriyanti Sely Tunjung Manik Septiani Selly Susanti SITI FATIMAH Siti Mufidah Siti Nur Aldina Siti Zaenab sitikhomsiyati Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Syamsiar, Syamsiar Tutut Indria Permana Uminar, Ajeng Ninda Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Wahyu Prihanta Warkoyo, W. WIDAYAT - Wijaya, Candra Kusuma Wiratmoko Yuwono Yasmine Salsabila Muninda Yulia Anita Yuliani, Rifky Luvia Yuni Pantiwati Yuni Pantiwati Yus Mochamad Cholily Zakiyatul Khoiriyah