Claim Missing Document
Check
Articles

Factors that Contribute to the QTc Interval Prolongation in DR-TB Patients on STR Regimen Tutik Kusmiati1 , Ni Made Mertaniasih2 , Johanes Nugroho Eko Putranto3 , Budi Suprapti4 , Desak Putu
Indian Journal of Forensic Medicine & Toxicology Vol. 15 No. 1 (2021): Indian Journal of Forensic Medicine & Toxicology
Publisher : Institute of Medico-legal Publications Pvt Ltd

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37506/ijfmt.v15i1.13641

Abstract

Introduction: QTc interval prolongation is one of the adverse drug reaction of several drugs used in DR-TBpatients treated with STR regimen. Drug-induced QTc prolongation can predispose patient to develop lifethreatening arrhythmia, increasing hospital length of stay and mortality. This study aims to determine factorsthat contribute to QTc prolongation in DR-TB patients on STR regimen.Methods. This was an observational retrospective study using medical records of DR-TB patients whoreceived STR regimen from August 2017 to March 2019 in tertiary hospital DR Soetomo, Surabaya,Indonesia. QTc interval was calculated by Fredericia formula. The influence of risk factors (age, bodyweight (BW), Body Mass Index (BMI), gender, comorbid, potassium, sodium and QTc baseline) with QTcprolongation was analyzed using multiple regression. The relationship between Moxifloxacin dosage andQTc was analyzed using Chi-Square test.Results Out of the 113 DR-TB patients who received the STR therapy regimen, 98 patients were eligible forthis study. They consist of 62 (%) male; 36 (%) female. Thirty-five (35,7%) of them had Diabetes Mellitusas a comorbid disease. The mean age of the patients was 44±11 years, with the mean of BMI was 20.20±3.73. Potassium and Sodium levels at the baseline were 4.192 ± 0.58 and 138.05 ± 4.562 respectively. TheQTc baseline before receiving STR regimen was 431.9±30,617ms. Patients received a dose of moxifloxacin400 mg (5.1%) , 600 mg (59,2%), and 800 mg (35,7%) according to body weight. There were no correlationbetween age, BW, gender, comorbid, and sodium baseline with QTc. There were correlation betweenpotassium (p=0,001), BMI (p=0,006) and QTc baseline (p <0,001) with QTc.Conclusion QTc baseline and potassium level are factors that contribute to the prolongation of the QTcinterval.
PERAN LABORATORIUM MIKROSKOPIS TB DI PUSTU PULAU MANDANGIN SAMPANG MADURA Ni Made Mertaniasih; Eko Budi Koendhori; Deby Kusumaningrum; Pepy Dwi Endraswari; Djohar Nuswantoro; Soedarsono Soedarsono
Jurnal Layanan Masyarakat (Journal of Public Services) Vol. 1 No. 1 (2017): Jurnal Layanan Masyarakat
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3919.51 KB) | DOI: 10.20473/jlm.v1i1.2017.16-21

Abstract

Mandangin Island is one of the endemic areas of Pulmonary TB in Sampang. Island with an area of about 2 km2 and a population of more than 16 thousand inhabitants, has a high incidence of pulmonary TB. Based on reports from Head of Puskesmas, 57 of every 100 patients who came for treatment were Pulmonary TB patients. The problem is then required the role of TB laboratory for the diagnosis of TB in Pustu I. The method of implementation is done by FGD and mentoring. The results obtained in the implementation of community service is a feed back report and the proposed increase in the role of function of Pustu Mandangin I for the basic process can be PPM, and Pustu II as the preparation laboratory of sputum preparation of suspect tuberculosis patients. Both Pustu in TB laboratory network become the responsibility of Puskesmas Banyuanyar Sampang, as part of national TB laboratory network. It is important to maintain the quality of TB laboratories in TB diagnosis. AbstrakPulau Mandangin merupakan salah satu wilayah endemis TB Paru di Kabupaten Sampang. Pulau dengan dengan luas wilayah sekitar 2 km2 dan berpenduduk lebih dari 16 ribu jiwa, memiliki insidensi TB Paru yang tinggi. Berdasarkan laporan Kepala Puskesmas, sebanyak 57 dari tiap 100 pasien yang datang berobat adalah pasien TB Paru. Permasalahanya kemudian diperlukan peran laboratorium TB untuk penegakan diagnosis TB di Pustu I. Metode pelaksanaan dilakukan dengan cara FGD dan pendampingan. Hasil yang diperoleh dalam pelaksanaan pengabdian masyarakat ini adalah suatu laporan feed back dan usulan peningkatan peran fungsi Pustu Mandangin I untuk dasar proses dapat menjadi PPM, dan Pustu II sebagai laboratorium preparasi sediaan dahak pasien suspect TB. Kedua Pustu dalam jejaring laboratorium TB menjadi tanggung jawab Puskesmas Banyuanyar Sampang, sebagai bagian jejaring laboratorium TB nasional. Sangat penting menjaga mutu laboratorium TB dalam penegakan diagnosis TB. 
PENINGKATAN PENGETAHUAN DAN KEAHLIAN DIAGNOSIS MIKROSKOPIS BTA PETUGAS LABORATORIUM DI SORONG PADA ERA PANDEMI COVID-19 Rebekah J Setiabudi; Ni Made Mertaniasih; Manik Retno Wahyunitisari
Jurnal Layanan Masyarakat (Journal of Public Services) Vol. 5 No. 1 (2021): JURNAL LAYANAN MASYARAKAT
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jlm.v5i1.2021.111-115

Abstract

ABSTRAKPenyakit Tuberkulosis (TB) Paru merupakan salah satu penyebab morbiditas dan mortalitas penting di dunia. Indonesia masih merupakan salah satu negara yang mempunyai beban TB yang terbesar diantara 5 negara yaitu: India, China, Nigeria dan Pakistan. Kota dan Kabupaten Sorong merupakan salah satu daerah di Propinsi Papua Barat dimana TB masih menjadi salah satu permasalahan kesehatan. Pemeriksaan mikroskopis TB dengan metode Ziehl Neelsen, menurut WHO, masih merupakan sarana diagnostik yang sensitif, spesifik, praktis, dan juga murah. Belum terstandardisasinya kinerja petugas laboratorium TB juga menjadi kendala tersendiri dalam diagnosis TB dengan metode Ziehl Neelsen. Munculnya pandemi Covid-19 yang melanda dunia termasuk Indonesia, membuat berbagai kegiatan menjadi tertunda. Kegiatan Pengabdian Kepada Masyarakat di tengah pandemi Covid-19 ini terpaksa dilakukan dalam bentuk “workshop online”. Dalam meningkatkan pengetahuan digunakan aplikasi zoom untuk kuliah penyegaran, memberikan informasi terbaru terkait TB di Indonesia dan pengetahuan tambahan lainnya. Sedangkan dalam meningkatkan keahlian dilakukan praktek pembuatan sediaan mikroskopis TB dan latihan pembacaan sediaan mikroskopis TB yang dilaksanakan secara offline di laboratorium Mikrobiologi Rumah Sakit JP Wanane, yang dimonitor dan dibimbing oleh Dokter Spesialis Mikrobiologi Klinik yang bertugas di sana. Melalui kegiatan Pengabdian Kepada Masyarakat yang dilakukan oleh Universitas Airlangga ini, diharapkan dapat membangkitkan lagi semangat, melakukan penyegaran serta menambah pengetahuan dan ketrampilan bagi tenaga kesehatan di daerah untuk dapat melakukan tugasnya dengan baik sehingga Program Pengendalian Infeksi Tuberkulosis dapat kembali berjalan sebagaimana seharusnya. Kata kunci : tuberkulosis, pemeriksaan mikroskopis, sorong, pandemi Covid-19 ABSTRACTPulmonary Tuberculosis (TB) is one of the most important causes of morbidity and mortality in the world. Indonesia is still one of the countries with the largest burden of TB among 5 countries, namely: India, China, Nigeria and Pakistan. Sorong City is one of the areas in Western Papua, Indonesia, where TB is still a health problem. According to WHO, microscopic examination of TB by the Ziehl Neelsen method is still a sensitive, specific, practical, and inexpensive diagnostic tool. The unstandardized performance of TB laboratory personnel has also become an obstacle in itself in diagnosing TB with the Ziehl Neelsen method. The emergence of the Covid-19 pandemic has delayed various activities. Community Service Activities in the midst of the Covid-19 pandemic had to be carried out in the form of an "online workshop". In increasing knowledge, the zoom application is used for refresher lectures, providing the latest information related to TB in Indonesia and other additional knowledge. Meanwhile, in increasing expertise, the practice of making TB microscopic preparations and reading exercises for TB microscopic preparations was carried out offline in the Microbiology laboratory of the JP Wanane Hospital, which was monitored and guided by the Clinical Microbiology Specialist who served there. Through this Community Service activity carried out by Airlangga University, it is hoped that it can revive enthusiasm, refresh and increase knowledge and skills for health workers in the regions to be able to carry out their duties properly so that the Tuberculosis Infection Control Program can resume running as it should.Keyword : tuberculosis, microscopic examination, Sorong, Covid-19 pandemic
Antimicrobial activity of Streptomyces spp. isolates from vegetable plantation soil Isnaeni Isnaeni; Idha Kusumawati; Mega Ferdina Suwito; Asri Darmawati; Ni Made Mertaniasih
JURNAL PENELITIAN BIOLOGI BERKALA PENELITIAN HAYATI Vol 21 No 2 (2016): June 2016
Publisher : The East Java Biological Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (639.33 KB) | DOI: 10.23869/78

Abstract

Fifteen Streptomyces isolates were isolated from soil in some different location on vegetable plantation at agriculture standard condition. The isolates were assessed for their antibacterial activity against Mycobacterium tuberculosis (MTB) ATCC H37RV and mycobacterial which isolated from Dr. Soetomo Hospital patients in Surabaya. The Interna-tional Streptomyces Project 4 (ISP4) and Middlebrook 7H9 (MB7H9) wwere used as growth or fermentation medium. The screening of inhibition activity was performed using turbidimetry and spot-test on agar medium. Results shown that 33.3% of the isolates (5 isolates) have anti-mycobacterial activities. The first line anti tuberculosis drug rifampicin, (RIF), ethambutol (EMB), isoniazid (INH), and pyrazinamide (PZA) were used as standards or positive controls with concentration 20 ppm. Optical density of crude fermentation broth concentrated from five isolates relatively lower than five anti-tuberculosis drug activity standard, although their activities against some microbial were similar to the stand-ard at spot-test. The most efficient isolate shown anti-mycobacterial activity was Streptomyces B10 which identified as Streptomyces violaceousniger. In addition, fatty acid methyl ester (FAME) profile of gas chromatography-mass spec-trometry chromatogram of each isolates were studied and compared to Streptomyces spp.
Inhibitory activity of fermentation filtrate of red passion fruit pulp (Passiflora edulis sims.) against Escherichia coli extended-spectrum beta-lactamase (ESBL) and methicillin resistant Staphylococcus aureus (MRSA) Iif Hanifa Nurrosyidah; Ni Made Mertaniasih; Isnaeni
JURNAL PENELITIAN BIOLOGI BERKALA PENELITIAN HAYATI Vol 26 No 1 (2020): December 2020
Publisher : The East Java Biological Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23869/bphjbr.26.1.20204

Abstract

This study aims to determine the minimum inhibitory concentration (MIC) and bactericidal concentration (MBC) of the fermentation filtrate (FF) on red passion fruit pulp (Passiflora edulis Sims.) against Escherichia coli Extended Spectrum Beta Lactamase (ESBL) and Methicillin Resistant Staphylococcus aureus (MRSA). The method used was the fermentation of red passion fruit pulp for 24 h using De Man Rogosa Sharpe Broth (MRS-broth) media, and the result showed that the FF of red passion fruit pulp made a dilution series concentration of 50%, 25%, 12.5%, 6.25%. Considering this result, the MIC FF of red passion fruit cells against ESBL and MRSA has a 25% dilution concentration, while MBC has a 50% dilution concentration. This shows that red passion fruit has the potential to be developed as antibacterial material, especially to fight bacteria that are already resistant.
Clinical and Demographic Characteristics Differences between M. tuberculosis and M. bovis Infection in Bronchoalveolar Lavage Pulmonary TB Patients, Indonesia Budi Yanti; Soetjipto Soetjipto; Ni Made Mertaniasih; Muhammad Amin
Jurnal Respirologi Indonesia Vol 39, No 4 (2019)
Publisher : Perhimpunan Dokter Paru Indonesia (PDPI)/The Indonesian Society of Respirology (ISR)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36497/jri.v39i4.76

Abstract

Background: Some species of the Mycobacterium tuberculosis complex (MTBC) which can cause tuberculosis, particularly M. tuberculosis and M. bovis, may have different virulence property and therefore associated with various clinical severity in tuberculosis (TB) patients. The aim of this study was to determine the differences in clinical and demographic characteristics between M. tuberculosis and M. bovis infection among Indonesian TB patients. Methods: Thirty-one new and active TB patients were confirmed to have acid fast bacilli (AFB) sputum positive and/or Xpert MTB/RIF positive for M. tuberculosis from Dr. Soewandhie Hospital, Surabaya, Indonesia. Interviews were conducted to record the clinical and demographics required. The MTBC were isolated from bronchoalveolar lavage fluid (BALF) and determined by primer-specific PCR targeting TbD1 and RD9 region gene. The degree of lung tissue damage was classified using NICE Scoring System. Results: The MTBC were detected in all patients on whom 19 and 12 isolates were classified as M. tuberculosis and M. bovis respectively. There was a different on 74.2% of productive age subjects (21-50 years) with M. tuberculosis infection (P
Tuberculous Meningitis: The Microbiological Laboratory Diagnosis and Its Drug Sensitivity Patterns Titiek Sulistyowati; Deby Kusumaningrum; Eko Budi Koendhori; Ni Made Mertaniasih
Jurnal Respirasi Vol. 3 No. 2 (2017): Mei 2017
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (480.609 KB) | DOI: 10.20473/jr.v3-I.2.2017.35-40

Abstract

Background: Tuberculosis continues one of the major challenges to global health. Mycobacterium tuberculosis complex can affect any organ other than the lung parenchyma, include central nervous system. The mortality rate of tuberculous meningitis (TBM) are high worldwide with up to half of survivors suffering irreversible sequelae. Diagnosis of TBM is difficult due to paucibacillary, various clinical manifestation, and invasive procedure to appropriate specimens. Objective: The objectiveis to study the positivity rate of microbiological laboratory diagnosis and its drug sensitivity patterns of TBM patients in Dr. Soetomo Hospital Surabaya during October 2015 until September 2016. Methods: Specimens were cerebrospinal fluids. Identification and drug anti TB sensitivity test were done by BACTEC MGIT 960 system in Clinical Microbiology Laboratory Dr. Soetomo Hospital Surabaya. Result: Most patients with TBM were women (54.29%). Based on age groups, most dominant was adult population (65.71%). Proportion percentage of positive M. tuberculosis complex among 180 specimens were 19.44%. First line anti TB drug sensitivity pattern of 35 isolates were 1 monoresistant, 1 poly-resistant, no multiple drug resistant (MDR), and 33 pan-susceptible. Conclusion: Positivity rate of Mycobacterium tuberculosis complex laboratory diagnosis from TBM suspect patients were low. There was no MDR TB in this study, but mono-resistant and poly-resistant. Microbiological diagnosis was important to give information of active disease and drug sensitivity pattern. Resistance to first line anti TB drugs is alarming to properly manage TBM patients.
PHYLOGENY MAGNITUDE OF Mycobacterium tuberculosis BASED ON GENOMIC ANALYSIS Budi Yanti; Mulyadi Mulyadi; Soetjipto Soetjipto; Ni Made Mertaniasih; Muhammad Amin
JKKI : Jurnal Kedokteran dan Kesehatan Indonesia JKKI, Vol 11, No 2, (2020)
Publisher : Faculty of Medicine, Universitas Islam Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20885/JKKI.Vol11.Iss2.art12

Abstract

Mycobacterium tuberculosis (MTB) is mostly found in humans, and it can cause more than two million deaths each year with increasing morbidity. Although lineages of MTB show identical nucleotide relationships, they have different characteristics such as evolution, transmission, drug resistance, host interaction, latency, and vaccine effectiveness. It is necessary to have better understanding of MTB relationships based on similarities in genome sizes and phylogenetic analysis. This paper observes the relationships of MTB based on nucleotide through phylogenetic frameworks. The MTB species consist of six lineages, and each lineage has various size of genomes . This difference contributes to virulence of MTB affecting levels of severity, morbidity, and mortality of diseases. Genetic diversity of MTB can contribute to global threats in the world such as outbreak of tuberculosis, Multi Drug Resistant (MDR) and Extensively Drug Resistant (XDR) tuberculosis.
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
Prevalence And Pattern Sensitivity Multidrug Antibiotics Resistant Pseudomonas aeruginosa in the High Care Unit at Dr. Soetomo General Academic Hospital Period 2022-2023 Ratna Kusumawati; Eko Budi Koendhori; Ni Made Mertaniasih; Irfan Arif Ikhwani; Dimas Firman Hidayat; Yelvi Levani; Ayu Lidya Paramitha
Qanun Medika - Jurnal Kedokteran FK UMSurabaya Vol 8 No 02 (2024): Qanun Medika Vol 08 No 02 2024
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/jqm.v8i02.22152

Abstract

The prevalence of Multidrug antibiotic-resistant Pseudomonas aeruginosa (MDRPA) has been increasing during the decade And has become attention in hospital patients. This retrospective descriptive descriptive aimed to determine the prevalence of MDRPA and its sensitivity patterns. Data were taken from results of bacterial culture and antibiotic resistance tests from various clinical specimens from patients at Dr. Soetomo General Academic Hospital throughout 2022-2023. The resistance test was carried out using a Vitek 2 compact instrument. MDRPA is defined as Pseudomonas aeruginosa that is not sensitive to three or more of the following classes of antibiotics: meropenem or imipenem, ciprofloxacin, gentamicin or amikacin, ceftazidime or cefepime, and piperacillin/ tazobactam. The prevalence of MDRPA was 57.0%. MDRPA isolates were also the most common origin from the burn unit and HCU A (high care unit A), mostly from pus specimens and sputum. Pseudomonas aeruginosa sensitivity was best with piperacillin/tazobactam (55.5%), meropenem (54.8%), amikacin (47.5%), gentamicin (46.5%), cefepime (46.3%), ceftazidime (45.0%), ciprofloxacin (44.7%) and aztreonam (43.2%). The sensitivity of MDRPA to antibiotics is much lower than that of Pseudomonas aeruginosa. This study showed high number of MDRPA specifically in Surabaya and the pattern sensitivity of Pseudomonas aeruginosa can become guidelines in choosing antibiotics treatment for patients.
Co-Authors , Atika Abdul Rahman Bahmid Agnes Dwi Sis Perwitasari, Agnes Dwi Sis Aisah, Nurul Akirasena, Mayoori Alimsardjono, Lindawati Alvin Hartanto Kurniawan, Alvin Hartanto Ananda, I Gede Yogi Prema Andy Setiawan Asri Darmawati Atik Kurniawati Atika Ayu Lidya Paramita Ayu Lidya Paramitha Bagus Soebadi Bagus Soebadi, Bagus Bakhtiar, Arief Budi Suprapti Budi Yanti Budi Yanti Catur Endra Arky, Catur Endra Dadik Raharjo Deby Kusumaningrum Diah Savitri Ernawati Didik Didik Handijatmo, Didik Dimas Firman Hidayat Eko Budi Koendhori, Eko Budi Endraswari, Pepy Fedik Abdul Ratam Hanik Urifah, Hanik Hidayat, Dimas Firman I Gusti Ayu Dewi Ratnayanti I Gusti Kamasan Arijana I Gusti Ngurah Mayun I Gusti Nyoman Sri Wiryawan I Nyoman Wande I Wayan Agus Gede Manik Saputra I Wayan Sugiritama Idha Kusumawati Ikhwani, Irfan Arif Irfan Arif Ikhwani Irwanto Irwanto Isnaeni Isnaeni Isnaeni Isnin Anang Marhana Jayanti Putri, Jayanti Juita, Liza Puspa Senja Asmara Junus, Herisa Nataliana Kadariswantiningsih, Ika Kawilarang, Arthur Pohan Kusmiati, Tutik Lestari, Aprilia Dwi Lyndia Effendy Maharani, Sekar Mahdani, Wilda Mangestuti Agil ManikRetno Wahyunitisari Maria Inge Lusida Marsha Maritsa, Olivia Mega Ferdina Suwito Mochamad Amin Mochammad Afif Ziaulhaq Muhammad Amin Muhammad Amin Mulyadi Mulyadi Ni Made Linawati Ni Nengah Dwi Fatmawati Ni Nyoman Sri Budayanti Nurrosyidah, Iif Hanifa Nurul Wiqoyah, Nurul Nuswantoro, Djohar Paramitha, Ayu Lidya Pepy Dwi Endraswari, Pepy Dwi Permatasari, Ariani Priyo Hadi Purwanta, Marijam Putranto, J.Nugroho Eko Ramadhani, Nabila Putri Himawati Rarome, Berlian Beatrix Ratna Kusumawati Ratna Kusumawati Rebekah Setiabudi, Rebekah Reiska Kumala Bakti Resti Yudhawati Retno Asih Setyoningrum Risa Etika, Risa S. Soedarsono Sakran, khawla Abdullah Salsabila, Sabila Sampurna, Mahendra Tri Arif Saputra, I Wayan Agus Gede Manik Sari, Trias Kusuma Sekar Maharani Setiawan, Firman Silvia Sutandhio Soedarsono Soedarsono SOETJIPTO . Soetjipto Soetjipto Sugeng Harijono, Sugeng Sulistyowati, Titiek Titiek sulistyowati Titiek Sulistyowati Titiek Sulistyowati VICTOR EKA NUGRAHAPUTRA Wayan Tunas Artama Widya, Alicia Margaretta Wiwin Retnowati Yelvi Levani Yitijuatni Yudayanti, Elprania Credo