Claim Missing Document
Check
Articles

The Potency of UB Forest Chitinolytic Bacteria to Promote Plant Growth and Inhibit Damping off Disease on Soybean Roekhan, Achmad; Dayanti, Ayu Ike; Oktaviani, Rahmania; Dewi, Fibrianti Shinta; Anastasya, Nabilla Alya; Aini, Luqman Qurata
Research Journal of Life Science Vol 8, No 1 (2021)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2021.008.01.4

Abstract

Damping off disease in soybean plants is caused by the fungal Rhizoctonia solani. The damping off disease causes a yield loss of up to 85-100%. The purpose of this study was determining the ability chitinolytic bacteria consortium of UB Forest's in suppressing damping off disease in vitro and in vivo as well as its potential to stimulate the growth of soybean plants. The research stages included isolation of the pathogenic fungus R. solani and the pathogenicity test. Rejuvenation chitinolytic bacterial isolates of UB Forest, test chitinolytic bacteria antagonist of UB Forest against R. solani fungus, test of Plant Growth Promoting (PGP) activities, synergy test of selected chitinolytic bacterial isolates, in vitro test for the inhibition of chitinase crude extract against R. solani, and inhibition test of chitinolytic bacteria consortium against damping off disease. The selected chitinolytic bacteria were code bacteria UB12, UB19, and UB52 with plant growth promoting activities with inhibition percentage of the pathogen R. solani of 73.9%, 67.4%, and 71.7%. The best chitinolytic bacterial isolates were the genus Bacillus sp. and Pseudomonas sp. The inhibition test of chitinase crude extract showed an inhibition percentage of 25-55%.
Identification of Aflatoxigenic Fungi in Myristica fragrans using V8 and CAM Media Arifah, Fitri; Aini, Luqman Qurata; Muhibuddin, Anton; Dianti, Sylvia; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.3

Abstract

Nutmeg is a spice that might be susceptible to being infected with aflatoxigenic fungi. Aflatoxins are mycotoxins synthesized by certain strains of Aspergillus section Flavi. However, not all strains are able to produce aflatoxins. The approach frequently employed for this survey comprises the cultivation of strains in a suitable liquid or solid medium and their subsequent extraction and analysis for the presence of aflatoxins. To date, very few studies have been conducted on the identification of contaminate and aflatoxigenic fungi in Myristica fragrans. Therefore, this study aimed to identify the contaminate and aflatoxigenic fungi in Myristica fragrans growing on V8 and CAM Media. Isolation of the fungus was carried out by direct agar plating. Lasiodiplodia theobromae, Aspergillus niger, A. tamarii, Penicillium citrinum, Rhizopus delemar, A. nomiae, and A. aflatoxiformans were recovered from nutmeg kernels sampled from North Minahasa, North Sulawesi, Indonesia. The findings of fungal isolation demonstrated that L. theobromae was the most prevalent form of fungus detected in the nutmeg kernels (50%), followed by A. niger (38.13%) and A. tamarii (10%). A. nomiae and A. aflatoxiformans were the aflatoxigenic fungi isolated from M. fragrans kernels.
In Vitro Exploration of Endophytes Bacteria from Platycerium Elephantotis Plants as Nitrogen Fixers and Phosphate Solubilizers Pamungkas, Bayu Aji; Aini, Luqman Qurata; Abadi, Abdul Latief; Trianti, Irisa; Syib`li, Muhammad Akhid; Setiawan, Adi
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.4

Abstract

Platycerium elephantotis, an African epiphytic fern thriving in Indonesia, is prized for its ornamental value and medicinal potential. It aids in fern succession without harming its host, obtaining nutrients from leaf litter and roots. Special water-storing tissues and CAM photosynthesis enhance its resilience. Endophytic bacteria in its roots likely contribute to nutrient absorption, including phosphate solubilization and nitrogen fixation, similar to other fern species. Studies on these bacteria are crucial for enhancing agricultural practices by reducing chemical inputs and promoting plant growth as plant growth-promoting bacteria (PGPB), particularly in nitrogen fixation and phosphate solubilization. The research was conducted from November 2023 to January 2024. Plant samples were collected from Arjuna Park Conservation Garden, Malang, and endophytic bacteria were isolated using serial dilution and nutrient agar media. Hypersensitivity, phosphate solubilization, and nitrogen fixation tests were conducted to assess bacterial traits. The study obtained six bacterial isolates (PE 5, PE 7, PE 24, PE 25, PE 30, and PE 49) from P. elephantotis with potential as biofertilizers due to their nitrogen-fixing and phosphate-solubilizing abilities. The diverse colony morphologies indicate different bacterial species. All isolates are rod-shaped (bacilli). Gram staining shows that PE 25 and PE 49 are gram-negative, while PE 5, PE 7, PE 24, and PE 30 are gram-positive.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Ma'alifah, Nur; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Fourier Transform Infra-Red (FTIR) Spectrum Characterization of Bacillus mycoides Trisnawati, Luh Putu Adi; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.2

Abstract

The presence of Bacillus mycoides and its ability to grow and spread quickly certainly affect the growth of the target pathogen and it can cause invalid detection results. Therefore, the presence of contaminant bacteria needs to be detected to ensure the specificity of the detection results against the target pathogenic bacteria. Various kinds of detection methods are commonly used, such as ELISA (enzyme-linked immunosorbent assay) and PCR (polymerase chain reaction) are time-consuming and not always very specific. Fourier-transform infrared (FTIR) spectroscopy methods were adopted to provide a comprehensive and reliable method for bacterial analysis. In this study, FTIR spectroscopy was used as an initial guess for the identification of bacterial isolates. Our results showed that there are dominant peaks from the FTIR spectrum obtained that were most associated with protein and carbohydrate in the range of wave number 400-4000 cm-1.  
Fourier Transform Infrared (FTIR) Spectroscopy Method for Fusarium solani Characterization Hasanah, Ifa Maulidah; Martosudiro, Mintarto; Aini, Luqman Qurata; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 1 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.01.3

Abstract

The detection and identification of microorganisms using spectroscopy techniques promise to be of great value because of their sensitivity, rapidity, low expense, and simplicity.  In this study, we used FTIR spectroscopy for the characterization of Fusarium solani. PCR amplification of DNA extracted from these isolates showed the possibility of amplifying PCR products with sizes 559 bp using the ITS1-ITS4 primers. Based on phylogenetic tree analysis, the isolate of F. solani showed a closely relationship to Fusarium solani isolate MN (MH300495.1) with 99.63% similarity.  The study is focused on the carbohydrate structure which can be analyzed in the range of 900 to 1200 cm-1 of FTIR wavenumber.  The spectra of our samples share similarities with one another, although small differences occur in the absorbance value. The band at 1027 cm-1 is assigned to the C-O stretching of glycogen. Meanwhile, at 1042 cm-1 is interpreted as carbohydrate C-O stretching as well. The band around 1073 cm-1 might arise from both chitin C-C stretching and phosphate stretching of nucleic acids. Other vibrations associated with chitin are also found at 1115 cm-1 and 1151 cm-1 which are assigned to C-O-C symmetric stretching and C-O-C asymmetric stretching, respectively.
FTIR (Fourier Transform Infrared) Spectroscopy Method for Bacillus cereus Characterization Silfiani, Intan; Abadi, Abdul Latief; Aini, Luqman Qurata; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy; Dianti, Sylvia Herli
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.3

Abstract

One of the potentials of Bacillus cereus bacteria is as an inducer of systemic resistance in plants against plant diseases. FTIR spectroscopy is a traditional method extensively utilized in the pharmaceutical industry, since it is fast, non-destructive, and requires minimal sample preparation. In this study, the indicators that were effectively discovered were the functional groups that compose carbohydrates and lipids. The absorption region to be analyzed for the functional groups that compose carbohydrates is in the wavenumber region of 1200-800 cm-1, whereas the functional groups that compose up lipids are in the wavenumber range of 3020-2800 cm-1 and 1800-800 cm-1. The signal produced on the spectral signature of B. cereus isolates revealing the functional groups that compose carbohydrates is at the absorption values of 1185, 1132, 1122, 1098, 1078, 1056, 1010, and 973 cm-1. This is analogous to the notion that the cell wall of B. cereus is composed of peptidoglycan which contains carbohydrates. While the absorption values that indicate the functional groups that make up lipids are 2969, 2955, 2925, 2870, 2846, 1759, 1733, 1471, 1455, 1234, 895 cm-1, which according to the literature suggests that the body structure of B. cereus contains 2-3% of the dry weight of bacterial cells and consists of neutral lipids and phospholipids.
Indigenous Endophytic Bacteria Potentials to Control Black Rot Disease on Cabbage Towards the Development of Organic Vegetables Santoso, Verisca Agil Winanda; Ramadhani, Fatchuliani Safitri; Apriyani, Aliffia Nuraita; Aini, Luqman Qurata
Research Journal of Life Science Vol 8, No 3 (2021)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2021.008.03.8

Abstract

Organic farming plays an important role in achieving SDGs 2030, especially on point 2, 3, 13 and 15. Nevertheless, agriculture commodity often meets challenges in organic farming due to plant pests, for instance: on cabbage. Black rot disease on cabbage causes serious losses up to 70%. Most of farmers use chemical pesticides which leads to lots of negative impact towards the environment. Thus, its essential to control the environmentally friendly by applying bio control agents of indigenous endophyte bacteria instead. This article was aimed to examine the indigenous endophyte bacteria ability which excellences on organic cabbage as well as generating black rot caused by the bacterial pathogen X. campestris. Narrative reviews along was done through finding out the related material from International Journal articles. The result showed that there were indigenous endophyte bacteria which was able to be bio control agents towards black rot disease on cabbage, namely Pseudomonas fluorescens, Bacillus subtilis, and Streptomyces sp with effectivity level between 37-63% within resistance zone 1.44 up to 2.4 cm. Indigenous endophyte bacteria on organic cabbage had various kinds antagonist agents especially on Bacillus sp. and Pseudomonas sp. that able to resist the disease pathogen both in vitro and in vivo.
Effect of Weather Conditions to Vascular Streak Dieback Disease Severity on Some Cocoa Clones with Different Resistant Levels Aini, Febrilia Nur; Aini, Luqman Qurata; Syibli, Muhammad Akhi; Sari, Indah Anita; Susilo, Agung Wahyu; Setyawan, Bayu; Malik, Abdul; Budiman, Aris
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.2

Abstract

Vascular streak dieback is a major disease in cocoa trees that affects at in various stages, and effect in significant yield losses. This study aimed to identify the area under the disease progress curve (AUDPC), infection rate (r), and the influence of weather factors on the development of vascular streak dieback disease caused by Ceratobasidium theobromae in some cocoa clones with different resistant levels. The research used a randomized complete block design consisted six clones as treatment and each treatment consisted of three replications. Disease severity was observed on six different cocoa clones and observations were conducted monthly. The observation of disease severity was observed monthly for 12 months and then used to analyze AUDPC and infection rate. Monthly data on the weather conditions were taken from the climatology station of the Indonesian Coffee and Cocoa Research Center, East Java. The results showed that Sulawesi 01 and ICCRI 09, categorized as resistant clones, showed low AUDPC values, 0.02 and 2.85 respectively. The cocoa clones Sulawesi 02 and MCC 02, categorized as tolerant clones, had higher AUDPC values, 19.87 and 34.27 respectively. The cocoa clones BCL and BL 50 showed the highest AUDPC values, 277.05 and 265.70 respectively. Path analysis on resistant clones indicated that rainfall is the most influential weather factor in increasing the severity of vascular streak dieback, followed by temperature. Higher relative humidity can significantly reduce disease severity, while sunlight and wind speed have smaller effects. In contrast, path analysis on susceptible clones showed that temperature, rainfall, relative humidity, and wind speed all positively influence the severity of vascular streak dieback. At the same time, sunlight has a mitigating effect.
The Influence of Seed Biopriming with Rhizobacteria on The Control of Black Rot Disease by Xanthomonas campestris Pathogens Rahman, Fakih Nur; Aini, Luqman Qurata; Syib`li, Muhammad Akhid
Research Journal of Life Science Vol 10, No 3 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.03.2

Abstract

The use of chemical pesticides in agriculture has negative impacts on the environment and health and leads to pathogen resistance. As an alternative, microorganisms such as PGPR or PGPF can enhance plant resilience and growth. Biopriming can trigger systemic resistance, improve nutrient uptake, and protect plants from pathogen infection. This study aims to evaluate the potential of biopriming and the effects of rhizobacterial application on plants. There are three main tests: the pathogenicity test of Xanthomonas campestris, the rhizobacterial test on cabbage seeds and seedlings, and the effectiveness of rhizobacteria in suppressing black rot disease in cabbage. Rhizobacterial application increased peroxidase enzyme and total phenol levels in plants, as well as plant height and leaf number. Rhizobacteria also improved cabbage seed germination and suppressed plant diseases. In conclusion, all tested rhizobacteria induced resistance in cabbage plants by increasing peroxidase enzyme and total phenol levels. Rhizobacterium TO9 (Clostridium sp.) was the most effective in enhancing plant resistance. Rhizobacteria also stimulated cabbage growth. Further research is needed to understand the mechanisms and effectiveness of rhizobacteria under different agricultural conditions.
Co-Authors Abd Latif Abadi Abd Latif Abadi Abdul Cholil Abdul Cholil Abdul Karim Fanani Abdul Latief Abadi Abdul Latief Abadi Abdul Latief Abadi Achmad Noerkhaerin Putra Achmad Roekhan Adi Setiawan Agung Nugroho Agung Wahyu Susilo Aini Nurul Aini, Febrilia Nur Akhmad Rizali Al Husni, Muhammad Fariq Albert Fernando Sitorus Alda Dwi Aprilia Alfi Inayati Aminudin Afandhi Aminudin Afandhi Anastasya, Nabilla Alya Andhy Handoko Andhy Handoko Anton Muhibuddin Apriyani, Aliffia Nuraita Ardiyan Taruna Arifah, Fitri Ariffin Noor Sugiharto Arifin Noor Sugiharto Aris Budiman Asnawi Asnawi Asparita, Yulia Dwi Auliya Zendhabad Aulya Retno Setyari Aulya Retno Setyari Bayu Setyawan, Bayu Bogi Diyansah Bosha, Mohammed Cindy Diah Ayu Fitriana Cokorda Javandira Daniel Happy Putra Dayanti, Ayu Ike Dewi, Fibrianti Shinta Dian Eka Kusumawati Dianti, Sylvia Dianti, Sylvia Herli Dinata, Gallyndra Fatkhu Diyana Lestari Dwi Wulandari Dyah Ayu Kusuma Wardani Eka Kartini Eriyanto Yusnawan Eriyanto Yusnawan Eriyanto Yusnawan Fibrianti Shinta Dewi Firdausi, Wita Galuh Setyanto Pradana Galuh Setyanto Pradana Ganestya Indina Sari Ganestya Indina Sari Hagus Tarno Hasanah, Ifa Maulidah Husna Fikriya Baroroh I Made Indra Agastya Ichsan Firmansyah Imam Chanif Imam Chanif, Imam Indah Anita Sari Irisa Trianti Irisa Trianti Ishak, Ismat Istiqomah Istiqomah Istiqomah, Istiqomah Ito Fernando Ito, Satoshi Iva Dewi Lestariningsih, Iva Dewi Izza, Junda Fauzul Karuniawan Puji Wicaksono Kestrilia Rega Prilianti Khoirun Enisa Maharina Khoirun Enisa Maharina Khoirunisa, Fenti Rahma Kusuma, Restu Rizkyta Liliek Sulistyowati Lilis Suryani Ma'alifah, Nur Maharina, Khoirun Enisa Minal Maimanah Mintarto Martosudiro Mochammad Syamsul Hadi Mochammad Syamsul Hadi Muhammad Akhid Syib’li Muhammad Akhid Syibli Muhammad Febriansyah Nava Karina Nawangsih, Handani Nindi Kurniasari Novia Dwirani Novie Utami Asputri Nugroho Sulistyo Putro Nugroho Sulistyo Putro Nur Azizah Nurul Aini Nurul Aini Nurul Aini Nurul Aini Oktaviani, Rahmania Pamungkas, Bayu Aji Paramyta Nila Permanasari, Paramyta Nila Prabowo, Matheus Randy Prillianti, Kestrillia Rega Puput Wahyuningsih Putri, Sastia Prama Rachmi Masnilah Rahmadani, Pradina Rahman, Fakih Nur Ramadhan, Varotama Putra Ramadhani, Fatchuliani Safitri Rania, Khansa Diva Ratri Kusuma Devi Ratri Kusuma Devi Rida Iswati Rifani Rusiana Dewi Rina Rachmawati Roekhan, Achmad Saitama, Akbar Sallygresya Theodora Dwifelita Matondang Santoso, Verisca Agil Winanda Sektiono, Antok Wahyu Serdani, Army Dita Setyono Yudo Tyasmoro Sheila Desi Kharisma Sheila Desi Kharisma Silfiani, Intan Siska Irhamnawati Pulogu Soemarno Soemarno Sofyan Sudirman Rudin Sonia Berliana Suharjono Sukamto, Ika Sumiyarsi Sukmarani, Elok Syamsuddin Djauhari Syamsul Arifin Syarifah Maulidya Rahmah Syib'li, Muhammad Akhid Syibli, Muhammad Akhi Syib`'li, Muhammad Akhid Syib`li, Muhammad Akhid Syib’li, Muhammad Akhid Taruna, Ardiyan Tatiek Wardiyati Theresia Rani Kartika Ayu Tita Widjayanti Toto Himawan Toto Himawan Tri Ardiyati Tri Ardiyati Tri Ardyati Trisnawati, Luh Putu Adi Tutung Hadi Astono Tutung Hadiastono Tutung Hadiastono Udayana, Cicik Uma Khumairoh Wardiyati, Tatiek Wita Firdausi Wiwik Jatnika Wiwin Sumiya Dwi Yamika Wiwin Sumiya Dwi Yamika Wiwin Sumiya Dwi Yamika Wiwit Wicaksono Jati Yani Kurniawan, Yani Yogo Setiawan Zainudin Zainudin Zainudin Zainudin Zainul Abidin