Claim Missing Document
Check
Articles

Found 11 Documents
Search
Journal : Research Journal of Life Science

Antifungal activity of clove (Eugenia caryophyllata) extract against Fusarium oxysporum cutinase enzyme in Tomato (Solanum lycopersicum) from in vitro study Khairunnisa', Amalia; Syib’li, Muhammad Akhid; Abadi, Abdul Latief
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.3

Abstract

Fusarium oxysporum f.sp. lycopersici presents a notable threat to tomato plants due to the hydrolytic activity of its cutinase enzyme, which facilitates the penetration of plant root tissues. Thus, reducing cutinase activity through the application of cloves as inhibitors offers an environmentally friendly alternative to hazardous chemical fungicides, showing great promise in controlling Fusarium wilt disease, particularly by targeting the cutinase enzyme of Fusarium oxysporum. This study involved GC-MS analysis of clove extract, fungal growth and cutinase activity assay using rhodamine-b olive oil media. Hence, this study aims to reveal the potential and mechanism of clove extracts as inhibitors of cutinase enzymes to reduce the penetration of the Fusarium oxysporum pathogen in tomato plants. The result shows that clove extract, containing approximately 20% antifungal compounds primarily eugenol (11% of total peak area), inhibits Fusarium oxysporum growth. It also reduces the hydrolytic activity of cutinase crucial for fungal penetration, evidenced by decreased fluorescence halos in tests with rhodamine-B and olive oil media under UV light after adding 1%, 2%, and 3% clove extract. Further in vivo studies are needed to explore its direct effects as a plant inhibitor.
Comparison of Primer Types to Produce Fungal DNA Fragment from Garlic Plant Root Samples Dewi, Fibrianti Shinta; Abadi, Abdul Latief; Syib'li, Muhammad Akhid
Research Journal of Life Science Vol 10, No 3 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.03.3

Abstract

Fusarium wilt disease caused by Fusarium oxysporum f.sp cepae is a widespread and dangerous diseases in garlic commodities. The combination of AMF and Bacillus amyloliquefaciens can be an effective solution to reduce losses due to attacks by these pathogens. The PCR technique is initial method that has proven to be significant in detecting fungal target DNA so that the effectiveness of biological agents can be determined. The aim of this study is to compare the types of primers that are effective for use in detecting fungal groups in PCR. This research was conducted in October 2023 - November 2024. The types of primers compared were ITS1-F/ITS4-R and LSU200A-F/LSU476-R with spectophotometry and fluometry quantification. The results show that ITS1-F/ITS4-R forms DNA band with a size of 700 bp, while LSU200A-F/LSU476-R had a size of 290-300 bp. The electropherogram also showed differences in DNA distribution which confirmed the results on agarose more specifically in the range 19-12,999 bp. In general, these results prove that the two types of primers have different abilities in fragmenting target DNA. This knowledge can help in detecting DNA at an early stage which can be used in various analyzes that can help in integrated plant disease management.
Fusarium Rot Biological Control of Citrus caused by Fusarium oxysporum Dewi, Ovilya Kusuma Minarma; Abadi, Abdul Latief; Widyaningsih, Sri
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.5

Abstract

Fusarium oxysporum is a pathogen that causes Fusarium rot disease on citrus plants. The F. oxysporum is a soil-borne pathogen whose fungicide is not effective against it and difficult to cure. Thus, the use of Trichoderma spp. as one of the most effective and well-known biocontrol agents against many plant diseases in agriculture is needed. To test Trichoderma capabilities on the specific pathogen, method of this study consisted of isolation and rejuvenation of F. oxysporum and Trichoderma, morphological identification of the fungus, in vitro test of Trichoderma antagonistic ability against F. oxysporum on PDA medium, and in vivo test conducted in a green house on Rough Lemon (RL) and Japansche Citroen (JC) rootstock seeds to calculate the total disease incidence using a formula. The result of in vitro test of this study shows that 3 Trichoderma isolates (TJ, TKH, and TST) were able to inhibit the growth of F. oxysporum on PDA medium by 65.56%, 62.99%, and 61.19%, respectively. While in vivo test shows that the treatment of TJ isolates on RL seeds and TKH on JC seeds shows lowest disease incidence percentage of 3.33%. Therefore, this study proves that Trichoderma can be used as a biocontrol agent in controlling Fusarium rot disease in citrus plants. However, further research is needed to detect which Trichoderma species TJ and TKH isolates contain.
In Vitro Exploration of Endophytes Bacteria from Platycerium Elephantotis Plants as Nitrogen Fixers and Phosphate Solubilizers Pamungkas, Bayu Aji; Aini, Luqman Qurata; Abadi, Abdul Latief; Trianti, Irisa; Syib`li, Muhammad Akhid; Setiawan, Adi
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.4

Abstract

Platycerium elephantotis, an African epiphytic fern thriving in Indonesia, is prized for its ornamental value and medicinal potential. It aids in fern succession without harming its host, obtaining nutrients from leaf litter and roots. Special water-storing tissues and CAM photosynthesis enhance its resilience. Endophytic bacteria in its roots likely contribute to nutrient absorption, including phosphate solubilization and nitrogen fixation, similar to other fern species. Studies on these bacteria are crucial for enhancing agricultural practices by reducing chemical inputs and promoting plant growth as plant growth-promoting bacteria (PGPB), particularly in nitrogen fixation and phosphate solubilization. The research was conducted from November 2023 to January 2024. Plant samples were collected from Arjuna Park Conservation Garden, Malang, and endophytic bacteria were isolated using serial dilution and nutrient agar media. Hypersensitivity, phosphate solubilization, and nitrogen fixation tests were conducted to assess bacterial traits. The study obtained six bacterial isolates (PE 5, PE 7, PE 24, PE 25, PE 30, and PE 49) from P. elephantotis with potential as biofertilizers due to their nitrogen-fixing and phosphate-solubilizing abilities. The diverse colony morphologies indicate different bacterial species. All isolates are rod-shaped (bacilli). Gram staining shows that PE 25 and PE 49 are gram-negative, while PE 5, PE 7, PE 24, and PE 30 are gram-positive.
Induction Resistance in Chili (Capsicum frutescens L.) to the Geminivirus Disease by Pseudomonas fluorescens Saidi, Aluna Uthilma; Martosudiro, Mintarto; Abadi, Abdul Latief
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.1

Abstract

This study included resistance induced by Pseudomonas fluorescens PGPR in chili (Capsicum frutescens L.) infected with Geminivirus. Geminivirus often attacks chili plants, causing disease with a yellowish color to the leaves, lobes, and stunting. Chili plants that have been attacked by the virus will experience crop failure and plant death. Virus prevention can be done with the application of PGPR by Pseudomonas fluorescens. The method used was 6 treatments on chili plants which were repeated 4 times. The analysis of variance was processed using R software. The results showed that cayenne pepper plants that were given the PGPR application had a shorter incubation period against Geminivirus attacks. Each concentration of Pseudomonas fluorescens has a mean incubation period that is not significantly different. The results also showed that there was a significant difference in the intensity of the disease that attacked the cayenne pepper plant. The application of 107 Pseudomonas fluorescens showed the most optimal results for phenol content, plant height, and number of plant leaves. The application of 109 Pseudomonas fluorescens showed optimal results for the content of IAA and the content of the peroxidase enzyme.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Ma'alifah, Nur; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Resistance of two sugarcane genotypes towards Sporisorium scitamineum Scoring Using Novel Method on Sugarcane buds tissue and Phenol Plant dynamics Supriyono, Supriyono; Abadi, Abdul Latief; Syib’li, Muhammad Akhid; Hidayah, Nurul
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.1

Abstract

Smut disease caused by a basidiomycete fungus, Sporisorium scitamineum, is one of major diseases on sugarcane worldwide. The disease could cause considerable yield losses up to 60% on susceptible varieties. Understanding of resistance characteristics of sugarcane clones is essential to support development of resistant sugarcane varieties to smut fungus infection. This study aimed to determine characteristics of sugarcane genotypes J19R17-325/15/3-9 and ASA Agribun toward S. scitamineum infection and the role of phenolic compound on defense mechanism of sugarcane to smut infection. The research consisted of four treatments and was arranged according to the randomized block design with five replicates. The results revealed that J19R17-325/15/3-9 produced higher phenolic compound (0,192 mg/gr) rather than ASA Agribun (0,182 mg/gr). In addition, the distribution of fungal mycelia within sugarcane tissues on J19R17-325/15/3-9 was also lower than those on ASA Agribun. These results indicated that J19R17-325/15/3-9 might have resistance properties to S. scitamineum infection.
Fourier Transform Infra-Red (FTIR) Spectrum Characterization of Bacillus mycoides Trisnawati, Luh Putu Adi; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.2

Abstract

The presence of Bacillus mycoides and its ability to grow and spread quickly certainly affect the growth of the target pathogen and it can cause invalid detection results. Therefore, the presence of contaminant bacteria needs to be detected to ensure the specificity of the detection results against the target pathogenic bacteria. Various kinds of detection methods are commonly used, such as ELISA (enzyme-linked immunosorbent assay) and PCR (polymerase chain reaction) are time-consuming and not always very specific. Fourier-transform infrared (FTIR) spectroscopy methods were adopted to provide a comprehensive and reliable method for bacterial analysis. In this study, FTIR spectroscopy was used as an initial guess for the identification of bacterial isolates. Our results showed that there are dominant peaks from the FTIR spectrum obtained that were most associated with protein and carbohydrate in the range of wave number 400-4000 cm-1.  
FTIR (Fourier Transform Infrared) Spectroscopy Method for Bacillus cereus Characterization Silfiani, Intan; Abadi, Abdul Latief; Aini, Luqman Qurata; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy; Dianti, Sylvia Herli
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.3

Abstract

One of the potentials of Bacillus cereus bacteria is as an inducer of systemic resistance in plants against plant diseases. FTIR spectroscopy is a traditional method extensively utilized in the pharmaceutical industry, since it is fast, non-destructive, and requires minimal sample preparation. In this study, the indicators that were effectively discovered were the functional groups that compose carbohydrates and lipids. The absorption region to be analyzed for the functional groups that compose carbohydrates is in the wavenumber region of 1200-800 cm-1, whereas the functional groups that compose up lipids are in the wavenumber range of 3020-2800 cm-1 and 1800-800 cm-1. The signal produced on the spectral signature of B. cereus isolates revealing the functional groups that compose carbohydrates is at the absorption values of 1185, 1132, 1122, 1098, 1078, 1056, 1010, and 973 cm-1. This is analogous to the notion that the cell wall of B. cereus is composed of peptidoglycan which contains carbohydrates. While the absorption values that indicate the functional groups that make up lipids are 2969, 2955, 2925, 2870, 2846, 1759, 1733, 1471, 1455, 1234, 895 cm-1, which according to the literature suggests that the body structure of B. cereus contains 2-3% of the dry weight of bacterial cells and consists of neutral lipids and phospholipids.
The Use of Beneficial Microbes Tolerant of the Pyraclostrobin Fungicide, in Controlling the Pathogen Colletotrichum, the Cause of Anthracnose Disease in Chili Plants Tubagus, Satria Wahyu; Syib’li, Muhammad Akhid; Abadi, Abdul Latief
Research Journal of Life Science Vol 10, No 3 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.03.1

Abstract

Global production of chilies is significantly influenced by various biotic and abiotic factors. anthracnose is likely the main inhibiting factor reducing chili productivity in various countries. The use chemicals still formed the basis of disease control. Trichoderma sp. and FB1 bacterial is one such tolerant beneficial microbe belonging to the fungus and bacteria group that can survive under chemical pressure and exhibit antagonistic effects against the pathogen Colletotrichum sp. by the in vitro assay, it was found that in the antagonistic of Colletotrichum sp. with bacteria FB1 and Trichoderma sp., there was a significant difference, that the growth of Colletotrichum sp. could be inhibited by 69%. In the compatibility assay of bacteria FB1 and Trichoderma sp., no significant antagonistic response was found from both beneficial microbes. In the fungicide tolerance test of all isolates, it was found that beneficial microbes could still grow on growth media with a mixture of pyraclostrobin fungicide at a dose of 0.25 ul/ml. FTIR analysis showed the functional groups of the secondary metabolites of both the antagonistic bacteria and the antagonistic fungi had very high similarity in O-H and C=O groups. However, further research is needed on the mechanism of the secondary metabolites of the beneficial microbes involved in the inhibition of the pathogen Colletotrichum sp. 
Co-Authors Abdul Karim Fanani Achmad Baihaqi Achmad Noerkhaerin Putra Ageng Prayoga Wicaksono Ageng Prayoga Wicaksono Agung Wicaksono Ajeng Megasari Akhmad Rizali Alauddin, Mukhammad Wildan Albert Fernando Sitorus Alifia, Reva Yunisa Alvan Fajarudin Aminudin Afandhi Aminudin Afandhi Anak Agung Vini Nathasia Andhy Handoko Andhy Handoko Anggraeni Eka Puspitasari Anggraeni Eka Puspitasari Anis Rosyidah Anton Muhibbudin Anton Muhibuddin Ardiyan Taruna Ariffin Noor Sugiharto Ariffin Noor Sugiharto Arifin Noor Sugiharto Arifin Noor Sugiharto Asnawi Asnawi Asyifa, Ana Nabilah AthoÂ’illah Ahmad Athoillah Ahmad Auliya Zendhabad Aulya Retno Setyari Aulya Retno Setyari Baihaqi, Achmad Bambang Tri Rahardjo Bambang Tri Rahardjo Bambang Tri Raharjo Bambang Tri Raharjo Berliana, Sonia Bosha, Mohammed Chika Gianni Handayani Cokorda Javandira Cokorda Javandira Dewi, Fibrianti Shinta Dewi, Ovilya Kusuma Minarma Dianti, Sylvia Herli Didik Suprayogo Didik Suprayogo Dyah Ayu Kusuma Wardani Eka Kartini Eka Kartini Eko Famuji Ariyanto Eko Famuji Ariyanto Eriyanto Yusnawan Fery Abdul Choliq Firdausi, Wita Fitri Amaniyah Fuji Arriani, Intan Ganestya Indina Sari Ganestya Indina Sari Gatot Mudjiono Gatot Mudjiono Gatot Mudjiono Hagus Tarno Hakimah Halim Hanif, Luthfan Hardiana, Sindy Sukma Husna Fikriya Baroroh Ibrahim, Siti Ghia Azzahra Ichsan Firmansyah Ika Rochdjatun Sastrahidayat Ika Rochdjatun Sastrahidayat Indah Nur Khulillah Irisa Trianti Istiqomah Istiqomah Jantje Pelealu Jantje Pelealu Jasuli, Jasuli Kartika Try Rosanti Kartika Try Rosanti Kepel, Charles Kestrilia Rega Prilianti Khairunnisa', Amalia Khojin Supriadi Khojin Supriadi, Khojin Khotimah, Dwi Kusnul Kliwon Hidayat Liliek Sulistyowati Lilis Suryani Lilis suryani Lilis Suryani Lilis Suryani Luaili Addina LuÂ’aili Addina Luqman Qurata Aini Luqman Qurata Aini Luqman Qurata Aini Luqman Qurata Aini Luqman Qurota Aini Luqman Qurota Aini Ma'alifah, Nur Mahendra, Syah Maulana Maknunin, Lu'lu'il Marsya, Tia Indi Mayasari, Paulina Akita Meity Nelltje Tanor Mintarto Martosudiro Moch. Dawam Maghfoer Mochammad Nawawi Moh. Dawam Maghfoer Moh. Hibban Toana Muhammad Akhid Syib’li Muhammad Febriansyah Nawawi, Mochammad Novie Utami Asputri Novie Utami Asputri Nugroho Sulistyo Putro Nugroho Sulistyo Putro NURUL HIDAYAH Pamungkas, Bayu Aji Prabowo, Matheus Randy Pratama, Alifian Novaldi Satria Prillianti, Kestrillia Rega Putri, Rosy Cahyagung Dewi Basuki Qurata Aini, Luqman R. Sapto Hendri Boedi Soesatyo Ratri Kusuma Devi Ratri Kusuma Devi Rida Iswati Rifani Rusiana Dewi Rina Rachmawati Rudin, Sofyan Sudirman Ruth Stella Petrunella Thei S. Karindah Saidi, Aluna Uthilma Sama’ Iradat Tito Samharinto Samharinto Sektiono, Antok Wahyu Serdani, Army Dita Silfiani, Intan Silvi Ikawati Siska Irhamnawati Pulogu Soemarno Soemarno Sri Karindah Sri Karindah Sri Widyaningsih Sukamto, Ika Sumiyarsi Supriyono Supriyono Syamsuddin Djauhari Syarifah Maulidya Rahmah Syib'li, Muhammad Akhid Syib`'li, Muhammad Akhid Syib`li, Muhammad Akhid Syib’li, Muhammad Akhid Tambas, Jane Sulinda Tatiek Wardiyati Tatik Wardiyati Tatik Wardiyati Theresia Rani Kartika Ayu Toto Himawan Toto Himawan Trisnawati, Luh Putu Adi tubagus, satria wahyu Unun Triasih Vini Nathasia, Anak Agung Wardiyati, Tatiek Wayan Firdaus Mahmudy Wildanya Hafiah Wildanya Hafiah Wiwik Jatnika Wiwik Jatnika Wiwit Wicaksono Jati Yulianti, Novi Dwi Zainudin Zainudin Zainudin Zainudin Zainul Abidin Zainul Abidin