Claim Missing Document
Check
Articles

Amplification Pattern of Partial Gene BMP-15 and GDF-9 in Bali Cattle Sri Rahayu; M. Sasmito Djati; Agatha Maria Dian Kusumawati; Oktavia Fitri Santika
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (336.289 KB) | DOI: 10.21776/ub.natural-b.2012.001.03.12

Abstract

The aim of this research was to determine the polymorphisms of BMP-15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9. The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP-15 and GDF-9 gene of Bali cattle.
Penentuan Keberhasilan Involusi Uterus Sapi Perah Friesian Holstein Berdasarkan Kadar Estrogen Setelah Beberapa Penginjeksian Selenium-Vitamin E (DETERMINATION OF THE SUCCESS UTERINE INVOLUTION IN FRIESIAN HOLSTEIN DAIRY COW BASED ESTROGEN LEVELS AFTER MU Widya Ayu Prasdini; Sri Rahayu; Mochammad Sasmito Djati
Jurnal Veteriner Vol 16 No 3 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (102.228 KB)

Abstract

The aims of this study were to determine the effectiveness of selenium-vitamin ETM to the increasedlevels of estrogen as a sign of completion uterine involution process in dairy cows Frisian Holstein (FH)after calving. Twenty pragnant FH cows were used in this experiment. The cows devided into four groups.The first group (as control, P0) was not given selenium-vitamin ETM, the second group (P1) was given 0.5mg/mL selenium + 50 mg/mL vitamin ETM, the third group (P2) was given 1,5 mg/mL selenium + 50 mg/mLvitamin ETM and the fourth group (P3) was given 2 mg/mL selenium + 100 mg/mL vitamin ETM. Theadministration of selenium-vitamin ETM performed at the 7th months of pragnancy, 8th month of pragnancy,two weeks before calving, 7 and 14 days after calving intramuscularly. After calving, the serum of dairycows were taken for analysis of estrogen levels on the 25th day, the 45th, the 65th and current first postpartumestrus in the position of standing heat using Bovine Estrogen ELISA Kit (EST) methode . The results of theanalysis of high estrogen levels on day 25, the 45th, the 65th and current first estrus days after giving birthin units of pg / mL found in treatment 3 (P3), which were a 8.94 ± 0.22; 9.64 ± 0.55; 9.86 ± 0.67and 10.14 ±0.84 respectively, but the fastest uterine involution based estrogen levels was in treatment 2 (P2) on the45th day with 9.12 ± 0.94 for the estrogen levels.. The conclusions of the study was the addition of seleniumand vitamin E at the 7th month of pragnancy until the 14th day after calving may significantly affecton theincreased levels of estrogen which indicates the success of uterine involution in dairy cows FH.
Potency of Purple Yam (Dioscorea alata L) as an Immunomodulatory Agent Sri Nabawiyati Nurul Makiyah; Muhammad Sasmito Djati
Berkala Kedokteran Vol 14, No 1 (2018)
Publisher : Fakultas Kedokteran Universitas Lambung Mangkurat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (311.734 KB) | DOI: 10.20527/jbk.v14i1.4589

Abstract

Abstract: Purple yam tuber (Dioscorea alata L.) is one of tubers that has not been used optimally. One of the nutrients contained in Dioscorea species is Saponin Steroid. This paper aims to examine the potential of Steroid Saponin in purple yam tuber (Dioscorea alata L.) as an immunomodulatory agent. The method is by reviewing from various literatures. This article found that Steroid Saponin in purple yam tuber (Dioscorea alata L.) had a potency as an immunomodulatory agent. Keywords: Purple yam tuber (Dioscorea alata L), Steroid Saponin, Immunomodulatory
ELEPHANTOPUS SCABER AND SAUROPUS ANDROGYNUS REGULATE MACROPHAGES AND B LYMPHOCYTE CELLS DURING SALMONELLA TYPHI INFECTION Muhammad Sasmito Djati; Dinia Rizqi Dwijayanti; Lulut Dwi Nurmamulyosari; Yayu Fuadah; Muhammad Basyarudin; Nur Jannah
UNEJ e-Proceeding 2016: Proceeding The 1st International Basic Science Conference
Publisher : UPT Penerbitan Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Abstract—Macrophages and B lymphocyte play an important role as the first cell type to encounter bacterial pathogen and as a mediator that initiate the adaptive immune response. Those types of cell can die in many ways such as apoptosis, necrosis, pyroptosis and autophagy during the host cell-pathogen recognition. This study aimed to investigate the ability of E. scaber and S. androgynus formula in regulating macrophage and B lymphocyte cells during bacterial infection. The pregnant mice were randomly divided into seven experimental groups: T1 (control), T2 (S. typhi infection), T3 (S. typhi, E. scaber 100%), T4 (S. typhi, E. scaber 75% and S. androgynus 25%), T5 (S. typhi, E. scaber 50% and S. androgynus 50%), T6 (S. typhi, E. scaber 25% and S. androgynus 75%), and T7 (S. typhi, S. androgynus 100%). Flowcytometry analysis was performed on day 18. S. typhi infection decrease the formation of macrophage and B lymphocyte cells in bone marrow and induce cell death in PBMC. We clearly proved that E. scaber 75% and S. androgynus 25% formula was able to ameliorate the formation of macrophage and B lymphocyte cells in BM. While E. scaber 25% and S. androgynus 75% formula increased the relative number of macrophage and B lymphocyte cells in PBMC.
Effect of Elephantopus scaber.L and Polyscias obtusa Leaf Extract for CD8+ and CD8+CD62L+ T Cell Modulation in Balb/c Mice Nurul Faizah; Muhammad Sasmito Djati
Biotropika: Journal of Tropical Biology Vol 2, No 3 (2014)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Medicinal herbal is highly recommended especially for pregnant women with bacterial infection to reduce the consumption of synthetic antibiotics that are harmful to their body and also fetus. E. scaber and P. obtusa are believed to increase the number of imunocompetent cells such as CD8+ and CD8+CD62L+ T cell cause both plants have biochemical compound such as saponin and flavonoid. These plants good for immune system, but optimum dose of mixture extracts from both leaves to increase the number of CD8+ and CD8+CD62L+ T cell in mice is doesnt know yet. This study to determine effect of E. scaber and P. obtusa leaf extract by compared the number of CD8+ and CD8+CD62L+ T cell between control mice and treated mice. E. scaber and P. obtusa leaf extract can not reduce relative number of CD8+ T cells compared with control mice after 14 days treatment and 18 days. Even it show little different number but it was not significantly different, whereas the number of CD8+ decreased in K2 control mice also not significantly different than other treatments. K1 group is always show the highest number of CD8+ T cell compared to other treatments. CD8+ was decreased by increasing the doses of P. obtusa leaf extract. Key word: E. scaber, CD8+ T cell, CD8+CD62L+ T cell, P. obtusa, Salmonella typhimurium.
Perkembangan sel T CD4 dan CD62L pada Organ Spleen Mencit yang diinfeksi Salmonella typhimurium setelah pemberian Ekstrak Ethanol Daun Polyscias obtusa dan Elephantopus scaber Nida Asif; Muhammad Sasmito Djati
Biotropika: Journal of Tropical Biology Vol 2, No 4 (2014)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Polyscias obtusa dan Elephantopus scaber merupakan tanaman yang memiliki kemampuan Immunomodulator. Penelitian menggunakan dua tanaman obat ini secara bersama diharapkan dapat diketahui manfaat sinergis antara kedua tanaman obatini. Penelitian ini dilakukan menggunakan hewan coba mencit Balb/C Musmusculus yang diinfeksi dengan bakteri Salmonella typhi (dosis 108). Treatment diberikansecara oral dari ekstrak etanol daun Tapak liman dan Kedondong laut dengan perbandingan dosis antara kedua yaitu (0%:100%; dan50%:50%) dengan dosis awal Elephantopus scaber dan Polyscias obtuse sebesar 50mg/KgBB. Pembedahan dilakukan pada hari ke-14 dan ke-18 setelah dilakukan injeksi. Sel limfosit diisolasi dari organ spleen, dianalisa dengan flowcitometry dan dianalisa hasil dengan one way ANOVA menggunakan SPSS 16.0 dan dilanjutkan uji Tukey. Berdasarkan hasil yang didapatkan bahwa perlakuan pemberian ekstrak etanol daun Kedondong laut dan Tapak liman menurunkan jumlah relative sel TCD4+ secara signifikan yaitu sebesar 6,29% dibandingkan kontrol positif 18,9%, dan dibandingkan dengan pemberian ekstrak daun tapak liman saja tidak menurun secara signifikan yaitu sebesar 9.22% hal tersebut menunjukkan adanya efek imunosupresan dari Tapak liman dan Kedondong laut yang diberikan bersamaan. Jumlah relative sel T CD62L+ menunjukkan peningkatan yang cukup signifikan pada perlakuan pemberian ekstrak etanol daun Kedondong laut dan Tapak liman yaitu sebesar 14,19% dibandingkan kontrol yaitu 5,35%, dan menurun pada perlakuan pemberian tapak liman saja, hal ini menunjukan bahwa pemberian ekstrak etanoldaun Kedondong laut dan Tapak liman mempengaruhi proliferasi sel naive
Efektivitas Pemberian Ekstrak Ethanol Daun Polyscias obtusa dan Elephantopus scaber terhadap Modulasi Sel T CD4+ dan CD8+ pada Mencit Bunting BALB/c Roffico Roffico; Muhammad Sasmito Djati
Biotropika: Journal of Tropical Biology Vol 2, No 3 (2014)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK Tanaman yang memiliki potensi untuk digunakan sebagai obat dalam pengobatan tradisional adalah Kedondong Laut (Polyscias obtusa) dan Tapak Liman (Elephantopus scaber. L). Tanaman ini mengandung senyawa aktif yang dapat mempengaruhi mekanisme pertahanan tubuh. Penelitian ini bertujuan untuk mengetahui bagaimana efek dari ekstrak ethanol daun Polyscias obtusa dan Elephantopus scaber. L terhadap ekspresi sel T CD4+ dan CD8+ pada mencit bunting BALB/c. Hasil menunjukkan bahwa jumlah relatif sel T CD4+ dan CD8+ tidak berbeda nyata (p> 0,05) dapat diketahui dari peningkatan dan penurunan yang terjadi pada setiap perlakuan dibandingkan dengan kontrol. Hal ini berarti, rata-rata jumlah relatif sel T tidak berbeda secara nyata untuk perlakuan yang diberikan pada mencit bunting BALB/c. Berdasarkan hasil output Tukey Test dan subset yang terbentuk terlihat bahwa jumlah relatif sel T tidak berbeda nyata untuk perlakuan yang diberikan pada mencit bunting BALB/c. Hasil juga menunjukkan jumlah relatif sel T memang berbeda secara nyata (p< 0,05) untuk waktu pembedahan. Namun, setelah dilakukan Tukey Test subset yang terbentuk menunjukkan bahwa jumlah relatif sel T tidak berbeda nyata (p> 0,05) terhadap waktu pembedahan. Kenaikan dan penurunan jumlah sel T CD4+ dan CD8+, kemungkinan karena aktivitas biologis senyawa yang terkandung dalam P. obtusa yaitu panaxidol dan stiqmasterol dalam E. scaber yang dapat bertindak sebagai imunosupresan dan imunomodulasi. Dosis optimum ekstrak ethanol daun P. obtusa dan E. scaber dalam peningkatan sel limfosit belum dapat ditentukan. Kata kunci: Elephantopus scaber, limfosit, Polyscias obtusa
Pendidikan Berperspektif Lingkungan Menuju Pembangunan Berkelanjutan Yuli Prayitno; Muhammad Sasmito Djati; Soemarno Soemarno; Zaenal Fanani
Wacana Journal of Social and Humanity Studies Vol. 16 No. 1 (2013)
Publisher : Sekolah Pascasarjana Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (573.853 KB)

Abstract

Penelitian ini bertujuan menganalisis hubungan antara kepedulian lingkungan dengan model pendidikan untuk pembangunan berkelanjutan.  Penelitian ini menggunakan metode deskriptif-kuantitatif. Subyek penelitian adalah 88 orang siswa. Instrumen yang digunakan adalah kuesioner kepedulian lingkungan dan tes pemahaman paradigma pendidikan untuk pembangunan berkelanjutan. Hasil penelitian menyimpulkan bahwa ada korelasi positif signifikan antara sikap peduli lingkungan, perilaku peduli lingkungan dengan pengetahuan paradigma pendidikan untuk pembangunan berkelanjutan. Hal ini mengindikasikan bahwa kepedulian lingkungan memiliki kesamaan dengan paradigma pendidikan untuk pembangunan berkelanjutan. Dengan demikian pendidikan untuk pembangunan berkelanjutan dapat dilaksanakan melalui pendidikan yang berperspektif lingkungan. Saran yang diajukan kepada para Kepala sekolah adalah penerapan pendidikan peduli lingkungan sebagai best practices di SMK Negeri. Kepada Dinas Pendidikan dan Kebudayaan di kabupaten disarankan untuk mengkaji lebih mendalam tentang fokus pencapaian tujuan pengelolaan dan perlindungan terhadap kelestarian lingkungan hidup melalui pendidikan. Kata kunci: Kepedulian lingkungan, pembangunan berkelanjutan.
PRODUCTION AND POTENCY OF LOCAL RAMBUTAN AT EAST JAVA AS A CANDIDATE PHYTOPHARMACA Sri Rahayu Lestari; Muhammad Sasmito Djati; Ahmad Rudijanto; Fatchiyah Fatchiyah
AGRIVITA, Journal of Agricultural Science Vol 35, No 3 (2013)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v35i3.390

Abstract

Rambutan is a tropical fruit that grow well in Indonesia and the peel is considered as waste. Many researchers’ showed that rambutan peel contains polyphenol that could be expected to avoid obesity.  The objective of this study was to explore the increasing production of local rambutan and to identify the promising phytochemical compounds on its peel as phytopharmaca candidate against obesity. Survey was conducted on the production of rambutan, potential plantation area, and marketing. Sample of rambutan peel collected from the sub-district Kanigoro, Blitar. Phytochemical compounds were analyzed using TLC, HPLC and FT-IR. Bioassay analysis used obesity rat models. The survey result showed a mean of rambutan production increased 2,6% in 2007-2012. Average production of rambutan 70-120 kg/tree. Vegetative multiplication usually done to maintenance of rambutan quality. The main compound of  Rambutan peel  extract (RPE) is flavonoids, tannins, ellagic acid and the major functional group of CH3, aliphatic CH3, and C=O. These compounds have a potential activity against obesity.  RPE 30 mg/kgBW dose was significantly inhibit the weight gain of obese rats and reducing the adipocyte size (p<0.05).Key words: potency, production, local rambutan, blitar, obesity
EFFECT OF CALCUSOL TO REDUCE THE CALCIUM CRYSTAL RETENTION IN KIDNEY EPITHELIAL CELLS MODEL OF NEPHROLITHIASIS Ahmad Soni; Moch. Sasmito Djati; Sri Widyarti
JURNAL PENELITIAN BIOLOGI BERKALA PENELITIAN HAYATI Vol 19 No 1 (2013): December 2013
Publisher : The East Java Biological Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (2027.121 KB) | DOI: 10.23869/138

Abstract

Kidney stones is a disease that characterized by a disturbance in the bladder. The main constituent of kidney stones namely Calcium Oxalate Monohydrate (COM) crystals. The presence of a COM crystal adhesion to renal tubular cells, will initiate the internalization which will further lead to the formation of crystals retention in the kidney. In Indonesia, there are many herbal products are considered able to cope the complaints due to the kidney stone disease. One of the herbal product is Calcusol „¢, which is the main constituent of those herbal product was the leaf extract of tempuyung. This study observed the effectiveness of Calcusol „¢ in reducing crystals retention that was formed in kidney epithelial cells model of nephrolithiasis. The result showed that Calcusol „¢ is able to reduce the average number of calcium crystals retention in the renal epithelial cells. It indicate that Calcusol „¢ has the ability to reduce crystals retention that already formed in renal epithelial cells. Furthermore, the results of this study are expected to be one of the considerations for further research on the potential of overcoming Calcusol „¢ in kidney stone disease
Co-Authors Achfas Zacoeb Agatha Maria Dian Kusumawati Ahmad Imron Rozuli Ahmad Rudijanto Ahmad Shobrun Jamil Ahmad Soni Ahmad Soni Ahmed Hasan Abkar Amin Setyo Leksono Aminullah, Lela - Anak Agung Gede Sugianthara Andi Rizki A, Pradana Andi Rizki Adi Pradana Andi Rizki Adi Pradana Andi Rizki Adi Pradana, Andi Rizki Anis Artiyani Annisa, Yuslinda Aris Soewondo Asfi, Nida Asyhari, Firda Nuri Aya shofiyah Azerlyn, Defiona Rensia Naomi Bagyo Yanuwiadi Chomsa Dintasari Umi Baszary Chomsa Dintasari Umi Baszary Dewi Liesnoor Setyowati Dewi Mustikaningtyas Dinia Rizqi Dwijayanti Dliyauddin, Moh Edi Widjajanto Edi Widjajanto Edi Widjajanto Eko Ganis Sukoharsono Eko Puji Astuti El Baroroh, Alif Rosyidah Erin Kurnianingtyas Erly Nur Aisyah Faiza Tawati Fatchiyah Fatchiyah Gato Gato Grahadi, Rahmat Hafil Kusuma, Kavana Handono Kalim Hendra Susanto Henny Johanna Kambey Herminah Febrianty Herminah Febrianty, Herminah Hindun Habibu HUSNUL KHOTIMAH Ida Idewa Agung Willy Pramana Ika Christina, Yuyun Indriati Dwi Rahayu Izzah, Fathiyah Nurul Jamhari Jamhari Jannah, Nur Kamila, Fairuz Sarah Khodijah, Riska Amalia Kliwon Hidayat Kusuma, Kavana Hafil Kuswati Kuswati Lulut Dwi Nurmamulyosari Lulut Dwi Nurmamulyosari M Aris Widodo Mansur Ibrahim Marlita Marlita, Marlita Miasih, Dewi Sekar Minang, Bony Zulkarnaen Mohammad Rasjad Indra Muhaimin Rifa&#039;i Muhaimin Rifa'i Muhaimin Rifa'i Muhaimin Rifa'i Muhaimin Rifa'i Muhaimin Rifa'i Muhaimin Rifa'i Muhaimin Rifa’i Muhaimin Rifai Muhaimin Rifa’i Muhaimin Rifa’i Muhaimin Rifa’i Muhammad Basyaruddin Muhammad Basyarudin Muhammad Halim Natsir Mutya Farsely Nabilah A Jatiatmaja Nabilah, Sarah Nahdah Nafisah, Wirdatun Nashi Widodo Nelwan, Ester Jeini Nida Asif Noer Hasanah Nur Hidayat Nur Jannah Nurul Faizah NURUL FAIZAH Oktavia Fitri Santika Petrus Sadsoeitoeboen Prima, Alex Putri, Nenis Try Melani Rachmawati , Hidajah Retno Anggraini Retty Ratnawati Rifa'i, Muhaimin Rifa'i, Muhaimin Rifa'i, Muhaimin - Rifa`i, Muhaimin Rifa’i, Muhaimin Rini Dwi Wahyuni Ririn Rochmawati Riska Annisa Rizki Amalia Rizqi Dwijayanti, Dinia Rochmatika, Lailiyavina Roffico Roffico Rohmah, Ilmiana Nurur Rony Irawanto Rooije R.H. Rumende Rosyadah, Nuraini Satuman Satuman septi utami dewi Shofiyah, Aya Siti Aisah SITI AISAH SN Nurul Makiyah soehartojo Hardjopranjoto Soemarno Soemarno Soemarno Soni, Ahmad Sri Andarini Sri Rahayu Sri Rahayu SRI RAHAYU Sri Rahayu Lestari Sri Wahjuningsih Sri Widyarti Sunaryono Sunaryono, Sunaryono Susanti, Winda Karina Susilo Sutiman B. Sumitro Sutiman Bambang Sumitro Swastika Pinca Pinca Swastika Pinca Pinca Syabril Ulum, Akhdiyat Syamsul Arifin Tri Eko Susilorini Turniningtyas Ayu Rachmawati Warsito Warsito Widodo Widodo Widya Ayu Prasdini Widyananda, Muhammad Hermawan Wike andre Septian Yayu Fuadah Yayu Tsamrotul Fuadah, Yayu Tsamrotul Yenny Risjani Yuli Prayitno Yuyun Ika Christina Zulfatim, Heni Sukma