Article Per Year (5 Year)
p-Index From 2021 - 2026
10.454
P-Index
This Author published in this journals
All Journal Jurnal Ilmiah Farmasi JURNAL KIMIA SAINS DAN APLIKASI Pharmaciana: Jurnal Kefarmasian Media Farmasi : Jurnal Ilmu Farmasi (Journal Of Pharmaceutical Science) Biogenesis: Jurnal Ilmiah Biologi Journal of Biomedicine and Translational Research The Journal of Pure and Applied Chemistry Research Jurnal Riset Kimia Global Medical and Health Communication Pharmacon Pharmascience JURNAL FARMASI DAN ILMU KEFARMASIAN INDONESIA Jurnal Farmasi Galenika (Galenika Journal of Pharmacy) Jurnal Biodjati ALCHEMY Jurnal Penelitian Kimia BIOEDUSCIENCE JRST (Jurnal Riset Sains dan Teknologi) Majalah Farmasi dan Farmakologi (Trends in Pharmacy and Pharmaceutical Sciences) Pharmacology and Clinical Pharmacy Research JSFK (Jurnal Sains Farmasi & Klinis) Jurnal Inovasi Hasil Pengabdian Masyarakat (JIPEMAS) Molekul: Jurnal Ilmiah Kimia Jurnal Mandala Pharmacon Indonesia Jurnal Ilmiah Farmasi Farmasyifa Jurnal Ilmiah Farmako Bahari Poltekita: Jurnal Pengabdian Masyarakat Jurnal Riset Farmasi Pharmaceutical Sciences and Research (PSR) Makara Journal of Science Bandung Conference Series: Pharmacy Borneo Journal of Pharmacy al Kimiya : Jurnal Ilmu Kimia dan Terapan Indonesian Journal of Chemical Science Journal of Tropical Pharmacy and Chemistry Jurnal Sains dan Kesehatan Jurnal Info Kesehatan
Taufik Muhammad Fakih
Prodi Farmasi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Islam Bandung
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Dentistry Earth & Planetary Sciences Education Energy Engineering Environmental Science Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Nursing Physics Public Health Other

Published : 98 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 98 Documents
Search

 6   7   8   9   10 
Simulasi Dinamika Molekuler Senyawa Asam Ferulat dan Turunannya dari Kulit Buah Nanas (Ananas comosus) sebagai Inhibitor Enzim Tirosinase Fakih, Taufik Muhammad; Wisnuwardhani, Hilda Aprilia; Dewi, Mentari Luthfika; Ramadhan, Dwi Syah Fitra; Hidayat, Aulia Fikri; Prayitno, Robby
JSFK (Jurnal Sains Farmasi & Klinis) Vol 8 No 2 (2021): J Sains Farm Klin 8(2), Agustus 2021
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.8.2.208-220.2021

Abstract

Enzim tirosinase merupakan enzim utama pada proses pembentukan pigmen melanin. Penghambatan aktivitas enzim tirosinase secara kompetitif maupun non-kompetitif menjadi kunci utama pengembangan agen pencerah kulit. Asam ferulat merupakan salah satu senyawa antioksidan yang kuat dan mampu melindungi kulit dari dampak buruk sinar UV yang menginduksi stress oksidatif. Penelitian ini bertujuan untuk mengidentifikasi interaksi molekuler antara senyawa asam ferulat dari kulit buah nanas (Ananas comosus) dan turunannya dengan enzim tirosinase menggunakan motode dinamika molekuler. Molekul senyawa uji dimodelkan menggunakan perangkat lunak Quantum ESPRESSO v.6.6. Model terbaik dipilih untuk dilakukan studi interaksi menggunakan perangkat lunak MGLTools 1.5.6 yang dilengkapi dengan AutoDock 4.2. Konformasi terbaik hasil penambatan molekuler kemudian dikonfirmasi stabilitasnya dengan simulasi dinamika molekuler menggunakan perangkat lunak Gromacs 2016.3. Berdasarkan hasil dari penambatan molekuler, senyawa asam iso-ferulat memiliki afinitas yang paling baik, yaitu dengan nilai energi bebas ikatan −25,06 kJ/mol dan memilki ikatan dengan logam seng (Zn) pada sisi aktif enzim tirosinase. Kemudian senyawa tersebut memiki stabilitas interaksi yang baik berdasarkan grafik RMSD, RMSF, Rg, SASA, RDF, dan H-Bond. Dengan demikian, senyawa asam iso-ferulat diprediksi dapat digunakan sebagai kandidat inhibitor kompetitif dan non-kompetitif enzim tirosinase
Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk Fakih, Taufik Muhammad; Wijaya, Salsabilla; Priani, Sani Ega
JSFK (Jurnal Sains Farmasi & Klinis) Vol 8 No 3 (2021): J Sains Farm Klin 8(3), Desember 2021
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.8.3.316-322.2021

Abstract

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.
PENILAIAN SIFAT ANTIOKSIDAN DAN STANDARISASI HERBA Centella asiatica L. Urb DARI BERBAGAI DAERAH DI JAWA BARAT Fajarwati, Kania; Budiana, Wempi; Kusriani, Herni; Mardiana, Neng Dian; Fakih, Taufik Muhammad
Jurnal Ilmiah Farmako Bahari Vol 15 No 2 (2024): Jurnal Ilmiah Farmako Bahari
Publisher : Faculty of Mathematic and Natural Science, Garut University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.52434/jifb.v15i2.2520

Abstract

Herba pegagan (Centella asiatica L.Urb) merupakan tanaman yang memiliki khasiat dan salah satunya adalah sebagai antioksidan yang berperan dalam menetralkan radikal bebas dan mencegah kerusakan sel yang disebabkan oleh radikal bebas. Radikal bebas diketahui terlibat dalam timbulnya berbagai penyakit. Senyawa yang terkandung dalam herba pegagan yang berpotensi sebagai antioksidan yaitu tanin, flavonoid, dan terpenoid. Tujuan dari penelitian yaitu untuk menentukan parameter standarisasi herba pegagan dan untuk mengetahui aktivitas antioksidan dari kelima daerah herba pegagan (Centella asiatica L.Urb). Pada hasil standarisasi parameter spesifik dan non spesifik hasil yang diperoleh telah memenuhi persyaratan sesuai dengan Farmakope Herbal Indonesia. Sampel diekstraksi dengan cara maserasi menggunakan pelarut etanol 96%. Ekstrak kemudian dipantau dan diuji aktivitaas antioksidannya secara kualitatif menggunakan kromatorafi lapis tipis dan secara kuantitatif menggunakan spektrofotometer sinar tampak. Uji aktivitas antioksidan dengan metode DPPH (1,1-difenil-2-pikrihidrazil) diperoleh rentang nilai IC50 67,61-89,32 μg/mL, dimana ekstrak yang paling aktif memiliki aktivitas antioksidan adalah ekstrak pegagan dari daerah pangandaran dengan nilai 67,61 μg/mL dibandingkan terhadap pembanding asam askorbat dengan nilai 4,22 μg/mL. kelima ekstrak herba pegagan berpotensi sebagai antioksidan.
Antioxidant Properties Of N-Hexane Extract From Tobacco Leaves (Nicotiana tabacum L.) Using 2,2-Diphenyl-1-Picrylhydrazil (DPPH) Method Patricia, Vinda Maharani; Az-zahra, Dhea Khairunnisa; Fakih, Taufik Muhammad; Suarantika, Farendina
Pharmacology and Clinical Pharmacy Research Vol 10, No 2 (2025)
Publisher : Universitas Padjadjaran, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15416/pcpr.v10i2.59372

Abstract

Tobacco (Nicotiana tabacum L.) is a commercial plant that often used for making cigarettes. In 2012, the government issued regulations for the diversification of tobacco products besides cigarettes. Some of these diversified tobacco products include organic pesticides, anesthetics, cosmetic ingredients, and biochar as an alternative to coal. Therefore, in order to further to diversification of tobacco product, this study aimed to determine the antioxidant activity from n-hexane extract from leaves using the Soxhlet extraction method. Antioxidant activity was assessed by the DPPH (2,2-diphenyl-1-picrylhydrazyl) method, while the total phenolic content was determined using the Folin-Ciocalteu method that allowed quantification of phenolic compounds in the extract, which possesses the role of antioxidant. The IC50 value obtained from the antioxidant activity assay of the n-hexane extract of tobacco leaves was 426.042 μg/mL, classified as very weak. Meanwhile, the total phenolic content was 51.93 mg GAE/g. These results suggest that the high total phenol content may have other potential activities that can be tested, such as antibacterial activity.
Pemodelan Molekuler Peptida Bioaktif Laut sebagai Antikoagulan Alami terhadap Enzim Sitokrom P450 (CYP) 2C9: Molecular Modelling of Marine Bioactive Peptides as Natural Anticoagulants against Cytochrome P450 (CYP) 2C9 Enzymes Fakih, Taufik Muhammad; Dewi, Mentari Luthfika
Jurnal Farmasi Galenika (Galenika Journal of Pharmacy) (e-Journal) Vol. 6 No. 2 (2020): (October 2020)
Publisher : Universitas Tadulako

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22487/j24428744.2020.v6.i2.15041

Abstract

Anticoagulants are very important for the treatment and prevention of thrombotic disorders. The use of conventional anticoagulants like heparin and warfarin can cause bleeding complications. To find safer anticoagulant therapy agents, the development of isolation of new anticoagulant compounds has shifted towards natural sources. Bioactive peptides can be considered a better alternative because of their therapeutic potential in the treatment of various diseases. Several peptide molecules have been shown to inhibit the cytochrome P450 (CYP) 2C9 enzyme as a natural anticoagulant, such as bioactive peptides produced by yellowfin sole (Limanda aspera) and bioactive peptides in blue mussel (Mytilus edulis). This study aims to identify and evaluate the interactions that occur between peptide molecules with the cytochrome P450 (CYP) 2C9 enzyme using protein-peptide docking methods. Bioactive peptide sequencing was modeled using the PEP-FOLD software. The best conformation was chosen for an interaction study against the macromolecule of cytochrome P450 (CYP) 2C9 enzyme using PatchDock software. Further observations were made of interactions formed using BIOVIA Discovery Studio 2020 software. Based on the results of protein-peptide docking, the yellowfin sole peptide molecule has a good affinity against the macromolecule of cytochrome P450 (CYP) 2C9 enzyme, with an ACE score of −2527.01 kJ / mol. Therefore, the bioactive peptide is predicted to be used as a candidate for the cytochrome P450 (CYP) 2C9 enzyme inhibitor.
INTERAKSI MOLEKULER INHIBITOR DIPEPTIDYL PEPTIDASE-IV (DPP-IV) DARI PROTEIN SUSU KAMBING SECARA IN SILICO SEBAGAI KANDIDAT ANTIDIABETES Fakih, Taufik Muhammad; Dewi, Mentari Luthfika
Media Farmasi: Jurnal Ilmu Farmasi Vol. 17 No. 1: Maret 2020
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.12928/mf.v17i1.16249

Abstract

Dipeptidyl peptidase-IV (DPP-IV) merupakan salah satu target dalam pengobatan diabetes tipe-2. Beberapa obat golongan gliptin yang tersedia secara komersial seperti sitagliptin, anagliptin, linagliptin, saxagliptin, dan alogliptin secara khusus digunakan sebagai inhibitor DPP-IV untuk pasien diabetes. Saat ini, penggunaan peptida pada protein susu kambing untuk mengobati diabetes telah dilaporkan dalam berbagai percobaan in vitro. Namun, pemahaman tentang interaksi molekuler penghambatan peptida tersebut terhadap DPP-IV masih kurang. Penelitian ini bertujuan untuk melakukan identifikasi, evaluasi, dan eksplorasi mengenai afinitas beberapa molekul peptida tersebut, yaitu MHQPPQPL, SPTVMFPPQSVL, VMFPPQSVL, INNQFLPYPY, dan AWPQYL terhadap makromolekul DPP-IV dengan menggunakan simulasi penambatan molekuler berbasis protein-peptida. Sekuensing peptida terlebih dahulu dilakukan pemodelan dengan menggunakan server PEP-FOLD. Konformasi terbaik dipilih untuk dilakukan studi interaksi terhadap makromolekul DPP-IV dengan menggunakan software HPEPDock. Identifikasi lebih lanjut dilakukan terhadap interaksi molekuler yang terbentuk dengan menggunakan software BIOVIA Discovery Studio 2020.  Berdasarkan hasil dari penambatan molekuler berbasis protein-peptida diperoleh bahwa molekul peptida INNQFLPYPY memiliki afinitas yang paling baik terhadap makromolekul DPP-IV, yaitu dengan nilai energi bebas ikatan 923,46 kJ/mol. Dengan demikian, peptida tersebut diprediksi dapat digunakan sebagai kandidat inhibitor DPP-IV.
Identifikasi Metabolit Bioaktif pada Asam Jawa (Tamarindus indica L.) menggunakan Komputasi Dinamika Molekuler untuk Penargetan HER-2 Kanker Payudara Ramadhan, Dwi Syah Fitra; Indraswari, Ni Luh Astri; Hakim, Supartina; Rusli, Rusli; Nurisyah, Nurisyah; Asikin, Asyhari; Fakih, Taufik Muhammad; Aksar, M
Jurnal Mandala Pharmacon Indonesia Vol. 10 No. 1 (2024): Jurnal Mandala Pharmacon Indonesia
Publisher : Program Studi Farmasi Universitas Mandala Waluya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35311/jmpi.v10i1.520

Abstract

The HER-2 (Human EGF Receptor-2) receptor is a receptor known to be strongly correlated with carcinogenesis and a worse prognosis in breast cancer patients. One of the native Indonesian plants that has been reported to inhibit breast cancer growth is tamarind (Tamarindus indica L.) which is known to contain various active metabolites. However, until now, the molecular activity of each of these metabolites has not been known. and one of the highly accurate simulation methods commonly used is molecular dynamics simulation. This study aims to understand the binding stability of active metabolites in tamarind computationally using molecular dynamics. The simulation begins with the preparation of 3D structures of ligands and receptors. The ligand of active metabolite from tamarind tree was obtained from KnapSack natural compound database, and the 3D structure of HER-2 receptor was obtained from PDB site with code 3PP0 and resolution of 2.25 Å. Furthermore, molecular tethering was performed using Autodock4 software. A high-performance computer was used for molecular dynamics simulation with Gromacs 2016 software for 100 nanoseconds (ns). Afterwards, molecular affinity analysis was performed, including RMSD (Root Mean Square Deviation) and RMSF (Root Mean Square Fluctuation). The analysis results showed that of the 6 compounds found in tamarind plants, the orientin compound showed the most favorable molecular Tethering activity with a value of -8.41 Kcal/mol. Although still higher than the natural ligand, the value is close to the value of the natural ligand with a difference of 1.8 Kcal/mol, which is -10.21 Kcal/mol. Furthermore, orientin showed very similar stability to the native ligand, as observed from the RMSD and RMSF analysis. In conclusion, the compound orientin found in tamarind has the potential to be a lead compound for inhibiting HER-2 in breast cancer.
Analisis, pengembangan, dan sertifikasi produk madu trigona hasil budidaya masyarakat Fakih, Taufik Muhammad; Hidayat, Aulia Fikri; Soewondo, Budi Prabowo; Darma, Gita Cahya Eka; Nuzulfikri, Rizki; Radina, Faqih; Prayitno, Robby
Jurnal Inovasi Hasil Pengabdian Masyarakat (JIPEMAS) Vol 6 No 3 (2023)
Publisher : University of Islam Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33474/jipemas.v6i3.19680

Abstract

Permasalahan pokok yang dihadapi oleh Desa Tenjolaya, yang menjadi mitra dalam Program Pengembangan Produk Unggulan Mitra (P3UM), melibatkan tantangan terkait praktik budi daya lebah madu serta mendapatkan Sertifikat Produksi Pangan Industri Rumah Tangga (SPP-PIRT) dan Sertifikat Halal dari Kementerian Agama Republik Indonesia. Dalam rangka mencapai hasil yang diharapkan, rencana kegiatan P3UM telah dirancang dan melibatkan beberapa tahap penting, yaitu tahap persiapan, tahap pelaksanaan, tahap pengajuan produk yang telah bersertifikat, tahap pemantauan dan evaluasi aktivitas, serta tahap pelaporan. Berdasarkan pelaksanaan kegiatan tersebut, sejumlah pencapaian signifikan telah berhasil diperoleh. Pertama, melalui proses identifikasi lebah madu, spesies lebah tersebut diidentifikasi sebagai Tetragonula drescheri. Selanjutnya, dalam analisis kualitas madu dari sampel Madu Trigona, hasil menunjukkan bahwa produk ini memenuhi standar kualitas madu budidaya sesuai dengan ketentuan SNI 8664:2018. Selain itu, pelatihan dalam rangka membangun pengetahuan tentang Budidaya Lebah Madu Trigona diadakan, dengan fokus pada potensi wirausaha di bidang ini. Terakhir, produk Madu Trigona dinamai MAZALI dan telah melewati proses pengemasan serta berhasil mendapatkan SPP-PIRT dengan nomor pendaftaran P-IRT 1073204010491-27. Semua pencapaian ini mendukung aspirasi agar produk MAZALI mampu menjadi salah satu produk unggulan yang mewakili Desa Tenjolaya.
In Silico Coformer Screening for Mefenamic Acid Cocrystallization Hidayat, Aulia Fikri; Fakih, Taufik Muhammad; Darma, Gita Cahya Eka; Choesrina, Ratu
JURNAL INFO KESEHATAN Vol 22 No 1 (2024): JURNAL INFO KESEHATAN
Publisher : Research and Community Service Unit, Poltekkes Kemenkes Kupang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31965/infokes.Vol22.Iss1.1375

Abstract

Cocrystallization is a widely used approach to enhance the solubility and dissolution characteristics of poorly soluble drugs. A pharmaceutical cocrystal is a multicomponent system composed of a solid active pharmaceutical ingredient (API) and a coformer, governed by non-covalent interactions. Screening for suitable coformers is essential to obtain an optimal cocrystal for specific drugs. This study aims to determine the drug-coformer interactions to select the most suitable coformer for cocrystal formation using the molecular docking method. Mefenamic acid, classified as a class II drug in the biopharmaceutical classification system (BCS), was used as the model drug. Two-dimensional structures of mefenamic acid (PubChem CID: 4044) and potential coformers were sourced from PubChem. Geometric optimization of all compounds was performed using GaussView 5.0.8 and Gaussian09 with the 3-21G basis set and Density Functional Theory (DFT) B3LYP method. The optimized compounds were prepared by adding hydrogen atoms and calculating Kollman partial charges using AutoDock 4.2. A grid box of size 40 Å × 40 Å × 40 Å was generated, with a maximum radius of 0.375 Å set as the surface distance in each simulation. A hundred conformations were run using the Lamarckian Genetic Algorithm. Interaction types and binding energies were analyzed using VMD 1.9.2 and BIOVIA Discovery Studio 2020 to compare interactions between mefenamic acid and each coformer. The results revealed that most coformer compounds formed interactions with mefenamic acid via hydrogen bonding and π–interactions. Saccharin demonstrated the most optimal interaction with mefenamic acid, with a binding free energy of –3.1 kcal/mol. Saccharin was identified as the most suitable coformer for mefenamic acid cocrystal formation based on the molecular docking study. Further experimental validation of saccharin is recommended to confirm its effectiveness in cocrystallization with mefenamic acid.               
Structure-Based Identification of Sanketan Heliotropium indicum as a RANK-RANKL Inhibitor: A Bioinformatics Approach for Osteoporosis Therapy rizkita, aden; Sintia Ayu Dewi; Taufik Muhammad Fakih; Candra Hermawan; Vivi Amalia Dwi Pratiwi
Indonesian Journal of Chemical Science Vol. 14 No. 3 (2025): Indonesian Journal of Chemical Science
Publisher : Prodi Kimia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/ijcs.v14i3.25933

Abstract

Heliotropium indicum, a traditional medicinal plant, contains a variety of bioactive compounds with potential therapeutic effects. This study employed a structure-based virtual screening approach to evaluate the inhibitory potential of selected compounds from H. indicum against RANKL (Receptor Activator of Nuclear Factor κB Ligand), a key regulator in osteoclastogenesis and osteoporosis. Molecular docking simulations were performed using AutoDockTools integrated with PyRx, targeting the RANKL crystal structure (PDB ID: 3QBQ). The binding free energy (ΔG) values were used to assess ligand affinity, with Indicine (–5.6 kcal/mol), Heliotrine (–6.0 kcal/mol), and 24-Methylenecholesterol (–6.6 kcal/mol) demonstrating the strongest binding affinities. Interaction analyses revealed stable hydrogen bonding and hydrophobic contacts with key residues such as SER296, ARG222, and GLY96. Further ADME-Tox profiling and Lipinski’s Rule of Five filtration indicated that most compounds possess favorable pharmacokinetic properties, including high gastrointestinal absorption, non-substrate behavior toward P-glycoprotein, minimal CYP450 inhibition, and low toxicity risks. Notably, Indicine and Heliotrine exhibited superior drug-likeness and safety profiles, while 24-Methylenecholesterol also emerged as a promising lead despite slightly lower binding affinity. These findings suggest that specific bioactive constituents of H. indicum could serve as potential RANKL inhibitors for osteoporosis therapy. The combined computational evaluations provide a strong foundation for future in vitro and in vivo validation, supporting the development of novel phytopharmaceuticals targeting bone resorption pathways
Co-Authors Abdillah, Nur Islami Vikri Adryan Fristiohady Akbar, Nabila Hadiah Akmal Syihabuddin Aksar, M Aldhiya Nurshafa Huwaida Alivia Dyanira Andita, Felia Rahma Cahya Anggi Arumsari Annisa Fitriyani Suryana Annisa Meilani Annisa Meilani Annisa Rahmah Furqaani Arfan Arfan Arfan, Aulia Rhamadani Arfan, Aulia Rhamdani Arini Nabila Putri Asikin, Asyhari Aulia Fikri Hidayat Az-zahra, Dhea Khairunnisa Bambang Tri Laksono Bertha Rusdi Budi P Soewondo Budi Prabowo Soewondo Budiana, Wempi Buih, Putri Helena Junjung Cahyani, Aura Lintang Ayu Candra Hermawan Choesrina, Ratu Dewi, Mentari Luthfika Dewi, Mentari Luthfika Diar Herawati Dina Mulyanti Dina Mulyanti Dita Anggun Novianta Dwi Syah Fitra Ramadhan Eky Syahroni Engrid Juni Astuti Fajarwati, Kania Faqih Radina Farendina Suarantika Fetri Lestari Fetri Lestari Firda Aulia Jannati Firliani Dwiputri Fitrianti Darusman Galand Febrial Akbar Ghifari, Tegar Asandra Gina Fuji Nurfarida Gita Cahya Eka Darma Hakim, Supartina Hamdan Ramdani Hilal Faturohman Hilda Aprilia, Hilda Inayah, Aghnia Fuadatul Indraswari, Ni Luh Astri Ingka Mardiana Putri Ismet Muchtar Nur Izdihar Arief, Imtiyaz Jilan Salsabila Auliya Putri Julia Hartati Khoirunnisa Muslimawati Latifa Hana Silfadani Lina Jamilah Liza Dzulhijjah Mardiana, Neng Dian Marillia, Viola Meike Rachmawati Mentari Luthfika Dewi Mentari Luthfika Dewi Meta Maulida Damayanti Muchlisin, M. Artabah Muhamad Akbar Dirgana Muhammad Fillah Nabila Shofura Mahardhika Nadhifah Mauludia Rinaldie Nandhy Agustian Luca Pratama Nawang Wulan Rachmatillah Prastowo Putri Nazhipah Isnani Nisa Neli Aunillah Nisa Qotrunida Afwa Nurfadillah Hazar Nurisyah, Nurisyah Nuzulfikri, Rizki Prayitno, Robby Putra, Aditya Maulana Perdana Putri, Nawang Wulan Rachmatillah Prastowo R. Rusli Radina, Faqih Rasjava, Achmad Ramadhanna’il Ratu Choesrina Resty Imfyani Sofyan Ridwan Wijaya RISA NURRAHWANI Rizki Nuzulfikri rizkita, aden Rizkita, Aden Dhana Robby Prayitno Robby Prayitno Rohayah Rohayah Rusli Rusli Salsabilla Wijaya Sani Ega Priani Sari, Ajeng Kartika Sellygani Budi Vaelani Siddiq, Tita Barriah Sintia Ayu Dewi Sintya Suherlan Siti Ainun Rohaniah Siti Hardianti Siti Nurlita Permana Sonia alivia putri Syahrizal Nazala Syahroni, Eky Sylvie Kurniasih Tanisa Maghfira Syarza Tegar Achsendo Yuniarta Tegar Achsendo Yuniarta Tegar Achsendo Yuniarta Teti Sofia Yanti Thias Najminuri Trully Nouval Larasati Vinda Maharani Patricia Viola Marillia Vivi Amalia Dwi Pratiwi Wardani, Dyah Ayu Pramoda Wijaya, Salsabilla Wisesa, Sulthan Waliid Anggara Wisnuwardhani, Hilda Aprilia