Claim Missing Document
Check
Articles

Review Artikel: Tanaman Obat yang Berpotensi terhadap Penyembuhan Luka Sayat Kurnia, Aifa; Atifah, Yusni
Al-DYAS Vol 3 No 1 (2024): FEBRUARI
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/aldyas.v3i1.2371

Abstract

A wound is the loss or damage of part of the body's tissues. So far, standard handling of wounds on the skin carried out in the medical world is by giving antiseptics, antibiotics, and anti-inflammatory. Wound healing is a complex process so efforts to find an effective wound healing agent continue. Medical drugs that are constantly used sometimes have unwanted side effects, for that alternative drugs are needed to reduce side effects. Medicinal plants that have the potential to heal incision wounds are torch ginger umbut, binahong leaves, tampala steel stems, yellow turmeric rhizomes, ginger leaves, red ginger rhizomes, and cassava leaves. Various preparations from the plant have the potential to heal incision wounds.
Effect of Different Feeding on Uric Acid Levels in Mice (Mus musculus L.) Diana, Okta; atifah, Yusni; Helendra
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i2.212

Abstract

Aim Uric acid is an acid that is formed from purine metabolism in the body. If uric acid levels in the blood exceed normal limits it is called hyperuricemia. Diet plays an important role in increasing or decreasing uric acid levels. Consuming foods high in purines can also increase uric acid levels. The purpose of this study was to determine the effect of different feeds on uric acid levels in mice. Methods This research is an experimental research. The research method used was a completely randomized design (CRD) with 3 treatments and 7 replications for each group. Results There is a difference in the average uric acid levels of mice in the K, P1, and P2 treatment groups. In the K treatment group, the average uric acid level of mice was 3,2 mg/dl. In the P1 treatment group, the average uric acid level of mice was 7,3 mg/dl. In the P2 treatment group, the average uric acid level of mice was 4,2 mg/dl. Main conclusions Differences in mice uric acid levels are influenced by diet, and consumption of foods high in purines. The highest average uric acid levels in mice were in the P1 treatment group of 7,3 mg/dl.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Inventory of Anura in Sarasah Salisikan Waterfall Area, Batang Anai, Padang Pariaman Regency, West Sumatra Saputra, Yogi; Nugraha, Fitra; Satria, Rijal; Atifah, Yusni
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.257

Abstract

The purpose of this study was to collect data on amphibians of the Anura order in the Sarasah Salisikan waterfall area, Batang Anai District, Padang Pariaman Regency, West Sumatra. Because this area will be developed into a tourist area by the local nagari government and also plantation activities around the waterfall which will affect the number of species that inhabit this area. This study used the VES (Visual Encounter Survey) method, which is based on direct encounters with specimens in the field. The research was conducted in November-December 2022, the research results found a total of 9 species consisting of 5 families. This research area will be a place to conduct similar research in the future. Keywords :Inventory, Anura, Sarasah Salisikan Water fall, Batang Anai, West Sumatera
Quality of Quail Eggs (Coturnix joturnix japonica L.) After 15 Days Preservation Using Rambutan Leaves (Naphelium lappaceum L.) Febiola, Cantika Riski; Atifah, Yusni
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.279

Abstract

Eggs are one of the foodstuffs that are easily damaged, if left in the open air (room temperature) the eggs only last 10-14 days, so it is necessary to apply a method to extend the durability of the eggs during storage, in this study the preservation by utilizing natural ingredients, namely rambutan leaves (Naphelim Lappaceum L.) The aims of this study was to determine the effect of rambutan leaf extract on the storage time of quail egg (Coturnix coturnix japonica L.). This study was an experimental study using a completely randomized design (CRD) with 10 treatments and 3 replications. The results of the study were analyzed using the ANOVA test and if it had a significant effect (P<0.05), continue with the DMRT. The results of the research showed that the best treatment for egg weight was 30% concentration and 24 hours of soaking time (A2B1), 45% concentration with 29 hours of soaking time (A3B2) for HU values, 15% concentration and 34 hours of soaking time (A1B3) for IKT, and the setting had no significant effect on the pH value and IPT value.
Artikel Review: Kajian Perilaku Gajah Sumatera (Elephas maximus sumatranus) di Taman Margasatwa Sa'diah, Jihan Natul Sa'diah; Atifah, Yusni
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.326

Abstract

Gajah Sumatera (Elephas maximus sumatranus) merupakan mamalia besar yang tersebar sepanjang Pulau Sumatera. Kajian terhadap perilaku gajah Sumatera yang mencakup perilaku khas individu gajah sangat penting untuk mendukung kegiatan ekowisata. Informasi perilaku gajah diperoleh melalui observasi ilmiah disajikan kepada wisatawan untuk memberikan wawasan dan pengetahuannya selama berkunjung ke Taman Margasatwa. Taman Margasatwa merupakan salah satu lembaga konservasi ek-situ yang memiliki koleksi satwa gajah Sumatera. Pada artikel ini, penulis mengumpulkan informasi tentang perilaku gajah Sumatera berdasarkan jenis kelamin, umur, asal penangkapan, lama pelatihan, serta mengkaji perilaku gajah dalam mendukung kegiatan ekowisata di Taman Margasatwa. Metode yang digunakan dalam artikel ini adalah studi literatur dengan menganalisis atau mereview 10 jurnal dengan menggunakan tiga database yaitu Google Scholar, Science Direct, dan Pubmed. Ulasan ini memberikan informasi yang menunjukkan gajah jantan memiliki respon yang lebih agresif dibandingkan gajah betina. Serta lama pelatihan juga mempengaruhi perilaku gajah. Penulis berharap ulasan ini dapat memberikan pengetahuan dan wawasan terkait perilaku gajah Sumatera di Taman Margasatwa.
Analisis Faktor Penyebab Terjadinya Miopia pada Mahasiswa Fisika Angkatan 2020 Universitas Negeri Padang Yuliati, Netri; Atifah, Yusni
AHKAM Vol 3 No 1 (2024): MARET
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/ahkam.v3i1.2652

Abstract

The organ of sight plays a central role in acquiring necessary information, enabling us to carry out various daily activities normally. The eyes can experience refractive errors, one of which is nearsightedness or myopia. Myopia is a refractive eye disorder with a high prevalence worldwide. There are various factors that can influence the development of myopia. One highly influential factor is the habit of reading and writing at too close a distance. Additionally, other factors include a history of exposure to light from computers or gadgets, age, type of pregnancy, birth history, nutritional status, deficiency of vitamins A and D, as well as genetic factors or family history. This study aims to determine the factors causing myopia among physics students of the 2020 intake at Padang State University. This research employs a descriptive qualitative research method and was conducted in December 2023. Research findings show that the highest percentage of individuals unaware of distant objects' presence is 70%, while 20% are aware, and 10% occasionally notice distant objects. The highest percentage of smartphone usage duration is 100%, with usage exceeding 5 hours, while 0% use it for less than 5 hours. Regarding smartphone lighting, 50% prefer bright illumination, 30% opt for moderate brightness, and 20% prefer dim lighting.
Review Jurnal: Faktor Keberhasilan Poliploidisasi Pada Ikan Salsabila Juita; Yusni Atifah
Jurnal Pendidikan Tambusai Vol. 8 No. 2 (2024)
Publisher : LPPM Universitas Pahlawan Tuanku Tambusai, Riau, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Poliploidi merupakan salah satu teknik yang memanfaatkan prinsip rekayasa genetik. Penyebab poliploidi pada alam bisa terjadi secara alami ataupun menggunakan campur tangan manusia. Teknik yang digunakan ini menghasilkan sifat yang permanen dan dapat diwariskan nantinya. Biasanya organisme hidup mempunyai sepasang set kromosom untuk sebagian besar tahap hidupnya. Sepasang set kromosom tersebut dinamakan diploid (2n). Oleh karena itu kami melakukan penelitian ini bertujuan untuk mengetahui faktor yang menyebabkan keberhasilan poliploidisasi pada ikan mas (Cyprinus carpio), ikan lele (Clarias gariepinus), ikan wader (Barbodes binotatus) dan ikan serukan (Osteochilus sp.). penelitian ini menggunakan metode studi literatur. metode ini dilakukan dengan mencari sumber atau literatur dalam bentuk data primer berupa artikel maupun jurnal, baik dalam jurnal nasional maupun internasional. Berdasarkan hasil studi literatur didapat suhu kejutan memberikan pengaruh yang berbeda terhadap induksi poliploidisasi tetapi lama kejutan memberikan pengaruh berbeda terhadap induksi polarisasi.
Literature Review: Potensi Tumbuhan Herbal Indonesia sebagai Antidiabetes Mutiara Ghina; Yusni Atifah
Gudang Jurnal Multidisiplin Ilmu Vol. 2 No. 1 (2024): GJMI - JANUARI
Publisher : PT. Gudang Pustaka Cendekia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59435/gjmi.v2i1.264

Abstract

Makanan yang dikonsumsi saat ini banyak mengandung zat-zat berbahaya bagi kesehatan dan dapat menyebabkan berbagai penyakit, salah satunya adalah diabetes melitus. Diabetes melitus adalah salah satu penyakit metabolik yang ditandai dengan tingginya kadar glukosa di dalam darah di atas batas normal. Masyarakat umumnya memanfaatkan tumbuhan herbal sebagai pengobatan tradisional dalam mengatasi penyakit DM. Penelitian ini bertujuan untuk mengetahui jenis tanaman herbal yang memiliki potensi sebagai antidiabetes sehingga dapat dimanfaatkan sebagai obat alternatif. Metode yang digunakan dalam penulisan artikel ini berupa Literature Review Article (LRA). Sumber database menggunakan Publis or Perrish. Data yang digunakan berupa artikel jurnal yang dipublikasikan dari rentang tahun 2010 sampai 2023. Hasil literature review yang telah dilakukan terdapat 10 spesies tumbuhan yang berpotensi sebagai antidiabetes diantaranya adalah salam, sambiloto, insulin, mengkudu, mahkota dewa, pepaya, kelor, jahe, ciplukan dan rosella. Kemampuan antidiabetes tumbuhan-tumbuhan tersebut disebabkan karena adanya senyawa metabolit seperti flavonoid, tanin, saponin, alkaloid, dan terpenoid yang terdapat dalam tumbuhan mampu menurunkan kadar glukosa di dalam darah.
Analisis Faktor Penyebab Terjadinya Miopia Pada Mahasiswa Biologi Angkatan 2022 Universitas Negeri Padang Dwi Junita Zega; Yusni Atifah
Gudang Jurnal Multidisiplin Ilmu Vol. 2 No. 1 (2024): GJMI - JANUARI
Publisher : PT. Gudang Pustaka Cendekia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59435/gjmi.v2i1.268

Abstract

Miopia merupakan keadaan di mana mata memiliki kemampuan pembiasan sinar yang berlebihan, sehingga sinar sejajar yang mencapai mata dibiaskan di depan retina, yakni di area bintik kuning. Penelitian ini bertujuan untuk menganalisis faktor-faktor penyebab terjadinya miopia pada mahasiswa Biologi angkatan 2022 di Universitas Negeri Padang. Miopia, atau mata minus, merupakan masalah kesehatan mata yang semakin umum terjadi di kalangan mahasiswa. Penelitian dilakukan dengan menggunakan metode survei dan kuesioner terhadap mahasiswa Biologi angkatan 2022. Hasil analisis menunjukkan bahwa terdapat beberapa faktor yang berkontribusi terhadap peningkatan kasus miopia pada mahasiswa tersebut. Faktor-faktor tersebut melibatkan faktor keturunan, lama penggunaan alat elektronik, jarak membaca dan kondisi penerangan ketika membaca. Namun, faktor yang dominan mempengaruhi myopia pada mahasiswa biologi Angkatan 2022 yaitu faktor keturunan, lama penggunaan alat elektronik dan jarak membaca.
Co-Authors Abdul Razak Abdul Razak Abubakar Abubakar Achyar, Afifatul Adinda, Diva Afrilliana, Friska Akbar, Imam Qodri Alsya Az Zahra Amalia, Windi Aprila Amsar Maulana Annisa Khaira Annisa Khaira Ardelia Febriana Ardi Ardi Arianti, Riri Putri Ayesa, Putri Az Zahra, Alsya Az zahra, Firda Azeli, Saskia Putri Azizah Mutmainah BR Tarigan, Siti Nadiah Zahra Dadang Mulyadi Saleh Des M Dezi Handayani Diana, Okta Dilla Wirmaningsih Dwi Hilda Putri Dwi Hilda Putri Dwi Junita Zega Elsa Badriyya Elsa Yuniarti Elwidani Siregar Fadhil Ramadhan, Bintang Fadika Hayyuni Fadillaturahmah, Fadillaturahmah Fathimah Azzahra Fatma Suryani Harahap Febi Permata Jingga Febiola, Cantika Riski Feby Djumaita Sari Ferix Riskierdi Fevria, Resti Fitra Arya Dwi Nugraha Fitra Nugraha, Fitra Fitri Agustina Lubis Fitri Arsih Fitria, Davina Foarota Harefa Fuadiyah, Sa’diyatul Fuji Zahara Zahara Gilang Amanda Gilang Amanda Hafizh Alza Afra Hafizh Alza Afra Hayu, Elvira Heffi Alberida Helendra Helendra . Helendra Helendra Helka Yuliati Helsa Rahmatika Hendro Pramono Iqra, Kuntum Nurul Irma Leilani Eka Putri Irma Leilani Eka Putri Iskandar Safri Hasibuan Iskandar Safri Hasibuan Jalilah Azizah Jalilah Azizah Lubis Jumatul Hafsah Keiko Kasy Billah Keiko Kasy Billah Khairunisa Khairunisa Kurnia, Aifa LAILA TUSSIFAH LUBIS Linda Advinda Lufri Lufri Marten, Threo Wanda Maulina, Adinda Rizky Mayang Anazalia Meilani Syaiful Meisya, Divia Yuda Melvariani Syari Batubara Miftahul Jannah Mita Ariani Monica, Della Trya Moralita Chatri Mutia, Ravena Mutiara Ghina Mutiara Lubis Nabila Latu Fany Najib Rahman. G Nella Fauziah Nurmaini Ginting Nurul Fathya NURUL HIDAYAH Nurul Hiza Putri Nurul Ilma Septiani Pasaribu, Surya Elita Putri Andriani Putri, Irma Leilani Eka Putri, Isna Aryunita Putri Putri, Nurul Hiza Rahma Amelia, Anisha Chahya Rahmadhani Fitri Rahmawati Darussyamsu Rahmi Holinesti Rahmi Suci Nadira Rani Mauliza Relsas Yogica, Relsas Reza Sapitri Rezi Nabilah Richi, Qori Dwi Rijal Satria Riri Putri Arianti Ristiono Ristiono Ristiono Ristiono S. Syamsurizal Sa&#039;diatul Fuadiyah Sa'diah, Jihan Natul Sa'diah Sa’diyatul Fuadiyah safitri, fira Sahlan Tuah Saldi, Andini Putri Salsabila Juita Samsiah Samsiah Sandi Fransisco Satria, Rijal Sa’diatul Fuadiyah Silvira Ilhami Suci Fajrina Surya Elita Pasaribu Syamsurizal, S. Titisna Gumarni Vauzia Vauzia Vauzia, Vauzia Vauzia, Vauzia Verina, Farhanah Shofwah Violita Violita Violita Violita Violita Violita Widya Gusti Rahmawati D. Wulandari Wulandari Yogi Saputra, Yogi Yulia Sistina Yuliati, Netri Yuni Ahda Yuni Ahda Zahra, Fauziah Az Zega, Dwi Junita Zulfahmi Zulfahmi Zulhandri Zulhandri Zulyusri Zulyusri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri, Zulzusri