Article Per Year (5 Year)
p-Index From 2021 - 2026
9.465
P-Index
This Author published in this journals
All Journal Bioscience Jurnal Natur Indonesia AL KAUNIYAH BIOTIK: Jurnal Ilmiah Biologi Teknologi dan Kependidikan Media Ilmiah Teknologi Pangan (Scientific Journal of Food Technology) Biology, Medicine, & Natural Product Chemistry Biodidaktika : Jurnal Biologi dan Pembelajarannya BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) JURNAL PENDIDIKAN ROKANIA BIOEDUSCIENCE Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Jurnal Perikanan Universitas Gadjah Mada Martabe : Jurnal Pengabdian Kepada Masyarakat PeTeKa JURNAL PENDIDIKAN TAMBUSAI Mimbar Ilmu Jurnal Ilmu Kedokteran dan Kesehatan Scripta Biologica Atrium Pendidikan Biologi Pelita Eksakta Jurnal Biogenerasi Journal On Teacher Education (Jote) Jurnal Riset Biologi dan Aplikasinya 3BIO: Journal of Biological Science, Technology and Management Budapest International Research in Exact Sciences (BirEx Journal) Jurnal Biosense Journal for Lesson and Learning Studies Halal Research Journal TROPICAL GENETICS MASALIQ: Jurnal Pendidikan dan Sains Al-DYAS : Jurnal Inovasi dan Pengabdian kepada Masyarakat AHKAM : Jurnal Hukum Islam dan Humaniora Gudang Jurnal Multidisiplin Ilmu Asian Journal of Science, Technology, Engineering, and Art Tropical Genetics Jurnal Serambi Biologi Biodik: Jurnal Ilmiah Pendidikan Biologi Jurnal Natur Indonesia
Atifah, Yusni
Unknown Affiliation
Religion Aerospace Engineering Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Physics Public Health Social Sciences Transportation Other

Published : 95 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 95 Documents
Search

 5   6   7   8   9 
Effect of Different Feeding on Uric Acid Levels in Mice (Mus musculus L.) Diana, Okta; atifah, Yusni; Helendra
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i2.212

Abstract

Aim Uric acid is an acid that is formed from purine metabolism in the body. If uric acid levels in the blood exceed normal limits it is called hyperuricemia. Diet plays an important role in increasing or decreasing uric acid levels. Consuming foods high in purines can also increase uric acid levels. The purpose of this study was to determine the effect of different feeds on uric acid levels in mice. Methods This research is an experimental research. The research method used was a completely randomized design (CRD) with 3 treatments and 7 replications for each group. Results There is a difference in the average uric acid levels of mice in the K, P1, and P2 treatment groups. In the K treatment group, the average uric acid level of mice was 3,2 mg/dl. In the P1 treatment group, the average uric acid level of mice was 7,3 mg/dl. In the P2 treatment group, the average uric acid level of mice was 4,2 mg/dl. Main conclusions Differences in mice uric acid levels are influenced by diet, and consumption of foods high in purines. The highest average uric acid levels in mice were in the P1 treatment group of 7,3 mg/dl.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Inventory of Anura in Sarasah Salisikan Waterfall Area, Batang Anai, Padang Pariaman Regency, West Sumatra Saputra, Yogi; Nugraha, Fitra; Satria, Rijal; Atifah, Yusni
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.257

Abstract

The purpose of this study was to collect data on amphibians of the Anura order in the Sarasah Salisikan waterfall area, Batang Anai District, Padang Pariaman Regency, West Sumatra. Because this area will be developed into a tourist area by the local nagari government and also plantation activities around the waterfall which will affect the number of species that inhabit this area. This study used the VES (Visual Encounter Survey) method, which is based on direct encounters with specimens in the field. The research was conducted in November-December 2022, the research results found a total of 9 species consisting of 5 families. This research area will be a place to conduct similar research in the future. Keywords :Inventory, Anura, Sarasah Salisikan Water fall, Batang Anai, West Sumatera
Quality of Quail Eggs (Coturnix joturnix japonica L.) After 15 Days Preservation Using Rambutan Leaves (Naphelium lappaceum L.) Febiola, Cantika Riski; Atifah, Yusni
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.279

Abstract

Eggs are one of the foodstuffs that are easily damaged, if left in the open air (room temperature) the eggs only last 10-14 days, so it is necessary to apply a method to extend the durability of the eggs during storage, in this study the preservation by utilizing natural ingredients, namely rambutan leaves (Naphelim Lappaceum L.) The aims of this study was to determine the effect of rambutan leaf extract on the storage time of quail egg (Coturnix coturnix japonica L.). This study was an experimental study using a completely randomized design (CRD) with 10 treatments and 3 replications. The results of the study were analyzed using the ANOVA test and if it had a significant effect (P<0.05), continue with the DMRT. The results of the research showed that the best treatment for egg weight was 30% concentration and 24 hours of soaking time (A2B1), 45% concentration with 29 hours of soaking time (A3B2) for HU values, 15% concentration and 34 hours of soaking time (A1B3) for IKT, and the setting had no significant effect on the pH value and IPT value.
Artikel Review: Kajian Perilaku Gajah Sumatera (Elephas maximus sumatranus) di Taman Margasatwa Sa'diah, Jihan Natul Sa'diah; Atifah, Yusni
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.326

Abstract

Gajah Sumatera (Elephas maximus sumatranus) merupakan mamalia besar yang tersebar sepanjang Pulau Sumatera. Kajian terhadap perilaku gajah Sumatera yang mencakup perilaku khas individu gajah sangat penting untuk mendukung kegiatan ekowisata. Informasi perilaku gajah diperoleh melalui observasi ilmiah disajikan kepada wisatawan untuk memberikan wawasan dan pengetahuannya selama berkunjung ke Taman Margasatwa. Taman Margasatwa merupakan salah satu lembaga konservasi ek-situ yang memiliki koleksi satwa gajah Sumatera. Pada artikel ini, penulis mengumpulkan informasi tentang perilaku gajah Sumatera berdasarkan jenis kelamin, umur, asal penangkapan, lama pelatihan, serta mengkaji perilaku gajah dalam mendukung kegiatan ekowisata di Taman Margasatwa. Metode yang digunakan dalam artikel ini adalah studi literatur dengan menganalisis atau mereview 10 jurnal dengan menggunakan tiga database yaitu Google Scholar, Science Direct, dan Pubmed. Ulasan ini memberikan informasi yang menunjukkan gajah jantan memiliki respon yang lebih agresif dibandingkan gajah betina. Serta lama pelatihan juga mempengaruhi perilaku gajah. Penulis berharap ulasan ini dapat memberikan pengetahuan dan wawasan terkait perilaku gajah Sumatera di Taman Margasatwa.
Analisis Faktor Penyebab Terjadinya Miopia pada Mahasiswa Fisika Angkatan 2020 Universitas Negeri Padang Yuliati, Netri; Atifah, Yusni
AHKAM Vol 3 No 1 (2024): MARET
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/ahkam.v3i1.2652

Abstract

The organ of sight plays a central role in acquiring necessary information, enabling us to carry out various daily activities normally. The eyes can experience refractive errors, one of which is nearsightedness or myopia. Myopia is a refractive eye disorder with a high prevalence worldwide. There are various factors that can influence the development of myopia. One highly influential factor is the habit of reading and writing at too close a distance. Additionally, other factors include a history of exposure to light from computers or gadgets, age, type of pregnancy, birth history, nutritional status, deficiency of vitamins A and D, as well as genetic factors or family history. This study aims to determine the factors causing myopia among physics students of the 2020 intake at Padang State University. This research employs a descriptive qualitative research method and was conducted in December 2023. Research findings show that the highest percentage of individuals unaware of distant objects' presence is 70%, while 20% are aware, and 10% occasionally notice distant objects. The highest percentage of smartphone usage duration is 100%, with usage exceeding 5 hours, while 0% use it for less than 5 hours. Regarding smartphone lighting, 50% prefer bright illumination, 30% opt for moderate brightness, and 20% prefer dim lighting.
Pengaruh Berat Badan terhadap Siklus Menstruasi pada Mahasiswi Semester Akhir Biologi 2020 Universitas Negeri Padang Kurnia, Aifa; Atifah, Yusni
MASALIQ Vol 4 No 1 (2024): JANUARI
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/masaliq.v4i1.2092

Abstract

Menstruation is a primary sexual sign that marks the period of puberty for a woman. Sooner or later to start the menstrual cycle is closely related to certain circumstances both physical and psychological states are influenced by the physical state of the woman herself, One of the factors that can interfere with the menstrual cycle is weight. The purpose of this study was to determine the relationship between body weight and the regularity of the menstrual cycle. The research method used is correlational research with a cross sectional design approach. Data was collected by distributing questionnaires with a target sample of 30 respondents. The data was analyzed using the Chi-Square test. The results of the study found that there is a relationship between the influence of weight on the menstrual cycle. The conclusion in this study that has been analyzed data tested using chi-square statistics obtained a significant value of x < 0.05 that there is a significant influence between body weight and the menstrual cycle.
Literature Review: Potensi Tanaman Serai (Cymbopogon Citratus) sebagai Antidiabetes Saldi, Andini Putri; Atifah, Yusni
MASALIQ Vol 4 No 2 (2024): MARET
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/masaliq.v4i2.2725

Abstract

The World Health Organization (WHO) explains that more than 220 million people worldwide have diabetes mellitus. Diabetes mellitus is a chronic metabolic disorder caused by not producing enough insulin. Treatment of DM is costly and often has side effects that can be detrimental to the body. Therefore, traditional medicine using herbal plants has begun to be developed at this time. A plant that has the potential as an antidiabetic is lemongrass. This study aims to determine the potential of lemongrass plants as antidiabetics. The method used in writing this article is Literature Review Article (LRA). The database source uses Publis or Perrish. The data used are journal articles published from 2013 to 2023. The results of the literature review that has been carried out know that lemongrass plants have potential as antidiabetics. The antidiabetic ability of lemongrass is due to the presence of secondary metabolite compounds such as flavonoids, tannins, steroids, alkaloids, and triterpenoids contained in lemongrass plants that have the ability to reduce blood glucose levels.
Analysis of Tambau Water Pollution Levels Through Histopathology of Nilem Fish (Osteochilus vittatus) Atifah, Yusni; Arianti, Riri Putri; Vauzia, Vauzia; Satria, Rijal
Jurnal Perikanan Universitas Gadjah Mada Vol 26, No 1 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jfs.85043

Abstract

Tambau Lake is a lake used by the community to cultivate fish. The quality of lake waters can be reflected through animals that live in lake waters such as fish. Fish that have been polluted with pollutant compounds for a long period of time will experience structural and functional abnormalities, as well as changes in histological conditions. This study aims to determine the level of water pollution in Tambau Lake through histopathological studies of Osteochilus Vittatus gills. This type of research is a descriptive analysis using a survey method of Tambau Lake and Osteochilus vittatus. Determination of Osteochilus vittatus and water samples using purposive random sampling method. Preparation using paraffin method and hematoxylin-eosin staining. The results of the study were then analyzed descriptively based on the level of damage to the gill tissue structure with the level of water pollution. The results of histopathological analysis on Osteochilus vittatus gill samples found damage to the presence of (a) edema (cell swelling), (b) hyperplasia which causes other damage, namely (clubbing tissue shaped like a baseball bat and thickening of cartilage) and (c) secondary lamella fusion which continues to become (telangiectasis) which indicates that Tambau Lake water is experiencing moderate - severe pollution. This is also in line with simple water quality results (physical, chemical and biological tests) which showed that the level of pollution was classified as severe.
TRAINING ON DIVERSIFICATION OF FISHERY PRODUCTS FOR FISHING COMMUNITIES IN MUARA SIKABALUAN, MENTAWAI ISLANDS, TO IMPROVE ECONOMIC RESILIENCE Atifah, Yusni; Putri, Irma Leilani Eka; Holinesti, Rahmi; Fadillaturahmah, Fadillaturahmah
Pelita Eksakta Vol 7 No 2 (2024): Pelita Eksakta, Vol. 7, No. 2
Publisher : Fakultas MIPA Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/pelitaeksakta/vol7-iss2/256

Abstract

The community of Sikabaluan Village primarily earns a living as fishermen. The obstacles in selling fishermen's products are related to the geographical location of Sikabaluan village, which has limited transportation between the village and areas outside the island. The issues found in the village of Sikabaluan are 1) The accumulation of fish during the harvest season, causing fish prices to tend to be lower than usual, even resulting in unsold fish that spoil, and 2) A lack of knowledge among the community regarding fish preservation. This relates to how to preserve fish so that it does not spoil quickly and has a longer shelf life, as well as how to utilize and prepare natural materials as natural preservatives. 3) There is a lack of skills among the community to process fishery products into other types of food, so that unsold fish can be transformed into other food types with higher market value. Therefore, it is necessary to provide assistance to the community of Sikabaluan village to enhance their knowledge regarding fish preservation and how to process fish into other types of food with high economic value. The method used in this service involves counseling and training for the community. This activity will be held in August 2024 and will be attended by 20 participants from the fishing community of Muara Sikabaluan village. The results of this activity show that (1) there is an increase in public knowledge about food and nutrition as well as innovations in fish processing. (2) The community has acquired skills in processing fish products into nuggets. (3) This knowledge and skill can serve as a foundation for businesses to meet the community's livelihood needs, thereby enhancing the economic situation of the community
Co-Authors Abdul Razak Abdul Razak Abubakar Abubakar Abubakar Abubakar Achyar, Afifatul Adinda, Diva Afandi, Echa Azkia Afrilliana, Friska Akbar, Imam Qodri Alsya Az Zahra Amalia, Windi Aprila Amanda, Fadillah Amsar Maulana Annisa Khaira Annisa Khaira Ardelia Febriana Ardi Ardi Arianti, Riri Putri Ayesa, Putri Ayuningtyas, Maulia Indah Az Zahra, Alsya Az zahra, Firda Azeli, Saskia Putri Azizah Mutmainah Azzahra Putri Hartono, Olyvia BR Tarigan, Siti Nadiah Zahra Dadang Mulyadi Saleh Des M Dezi Handayani Diana, Okta Dilla Wirmaningsih Dwi Hilda Putri Dwi Hilda Putri Dwi Junita Zega Elsa Badriyya Elsa Yuniarti Elwidani Siregar Fadhil Ramadhan, Bintang Fadika Hayyuni Fadilaturahmah Fadilaturahmah Fadillaturahmah, Fadillaturahmah Fathimah Azzahra Fatma Suryani Harahap Febi Permata Jingga Febiola, Cantika Riski Feby Djumaita Sari Ferix Riskierdi Fevria, Resti Fhuji Winardi Fitra Arya Dwi Nugraha Fitra Nugraha, Fitra Fitri Agustina Lubis Fitri Arsih Fitria, Davina Foarota Harefa Fransisco, Sandi Fuadiyah, Sa’diyatul Fuadiyah, Sa’diatul Fuji Zahara Zahara Gilang Amanda Gilang Amanda Hafizh Alza Afra Hafizh Alza Afra Hasibuan, Iskandar Safri Hayu, Elvira Heffi Alberida Helendra Helendra . Helendra Helendra Helka Yuliati Helsa Rahmatika Hendro Pramono Iqra, Kuntum Nurul Irma Leilani Eka Putri Irma Leilani Eka Putri Iskandar Safri Hasibuan Iskandar Safri Hasibuan Jalilah Azizah Jalilah Azizah Lubis Juita, Salsabila Jumatul Hafsah Keiko Kasy Billah Keiko Kasy Billah Khairunisa Khairunisa Khairunisa Khairunisa Kheniva Diah Anggita Kurnia, Aifa LAILA TUSSIFAH LUBIS Linda Advinda Lufri Lufri Marten, Threo Wanda Marten, Threo Wanda Maulina, Adinda Rizky Mayang Anazalia Meilani Syaiful Meisya, Divia Yuda Mellani Rachma Melvariani Syari Batubara Miftahul Jannah Mita Ariani Mita Ariani Monica, Della Trya Moralita Chatri Mutia, Ravena Mutiara Ghina Mutiara Ghina Mutiara Lubis Nabila Latu Fany Nabilah, Rezi Najib Rahman. G Nella Fauziah Nurmaini Ginting Nurul Fathya NURUL HIDAYAH Nurul Hiza Putri Nurul Ilma Septiani Pasaribu, Surya Elita Pratama, Sandi Fransisco Putri Andriani Putri Qalbina Putri, Aulia Devani Putri, Irma Leilani Putri, Irma Leilani Eka Putri, Isna Aryunita Putri Putri, Nurul Hiza Rahma Amelia, Anisha Chahya Rahmadhani Fitri Rahmawati Darussyamsu Rahmi Holinesti Rahmi Suci Nadira Rani Mauliza Relsas Yogica, Relsas Reza Sapitri Rezi Nabilah Richi, Qori Dwi Rijal Satria Riri Putri Arianti Ristiono Ristiono Ristiono Ristiono S. Syamsurizal Sa&#039;diatul Fuadiyah Sa'diah, Jihan Natul Sa'diah Sa’diyatul Fuadiyah safitri, fira Sahlan Tuah Saldi, Andini Putri Samsiah Samsiah Sari, Windi Yunita Satria, Rijal Sa’diatul Fuadiyah Silvira Ilhami Suci Fajrina Surya Elita Pasaribu Syamsurizal, S. Titisna Gumarni Vauzia Vauzia Vauzia, Vauzia Vauzia, Vauzia Verina, Farhanah Shofwah Violita Violita Violita Violita Violita Violita Widya Gusti Rahmawati D. Wulandari Wulandari Yannita, Defni Yogi Saputra, Yogi Yulia Sistina Yuliati, Netri Yuni Ahda Yuni Ahda Zahra, Fauziah Az Zega, Dwi Junita Zulfahmi Zulfahmi Zulhandri Zulhandri Zulyusri Zulyusri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri, Zulzusri