Article Per Year (5 Year)
p-Index From 2021 - 2026
2.487
P-Index
This Author published in this journals
All Journal Jurnal Ilmu Pertanian Indonesia BALI MEDICAL JOURNAL (BMJ) Jurnal Ilmu dan Kesehatan Hewan METAMORFOSA Journal of Biological Sciences Buletin Veteriner Udayana Buletin Udayana Mengabdi INDONESIAN JOURNAL OF BIOMEDICAL SCIENCES Jurnal Veteriner Indonesia Medicus Veterinus Jurnal Biologi Udayana Bumi Lestari Medical Journal of Indonesia Jurnal Ilmu Ternak Veteriner Journal of Global Pharma Technology Jurnal Kedokteran Hewan Neurona Jurnal Medika Veterinaria
I Gusti Ngurah Kade Mahardika
Fakultas Kedokteran Hewan Universitas Udayana
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemistry Earth & Planetary Sciences Education Energy Environmental Science Health Professions Immunology & microbiology Medicine & Pharmacology Neuroscience Public Health Veterinary

Published : 76 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 76 Documents
Search

 4   5   6   7   8 
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

Abstract

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
PHYLOGENETIC ANALYSIS OF NUCLEOTIDE SEQUENCE OF HIPERVARIABLE FRAGMENT OF VP2 OF INFECTIOUS BURSAL DISEASE VIRUS ISOLATED IN INDONESIA I Gusti Ngurah Kade Mahardika; Lies Parede
Jurnal Veteriner Vol 9 No 2 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (127.098 KB)

Abstract

Nucleotide sequence of hypervariable fragment of VP2 of infectious bursal disease virus (IBDV) isolated in Bali and Indonesia were compared to standard virulent (svIBDV’s) and very virulent (vvIBDV’s) viruses accessed in GeneBank. The comparation were done using the multiple sequence alignment program of Mega 3.1. The sequence were aligned by the ClustalW Method (Mega 3.1), that is grouping the sequences into clusters by examining the distance between all pairs. The sequences were aligned pair wise, then as groups. Phylogenetic tree were constructed using Neighbor-Joining and Bootstrap-tested. The analysis showed that IBDV can be clustered into 2 major groups, i.e. America-Europe and Australia clusters. The America-Europe cluster is further divided into two sub-clusters, i.e. classic IBD and vv-IBD. Classic-IBD is represented by standard STC, Cu-1, Variant A, F52-70, and PBG98 viruses. Two IBDV’s isolated in Bali and the most of other Indonesian isolates belong to sub-cluster vv-IBD and share a common cluster with IBDV that were recently reported as very virulent strains. One exceptional isolate is Indo 13, which is groupped into classic IBD, and closely related to classical American standard virus, STC.
Non Coding Region dan Amino Terminus Gen Polimerase Asidik Virus Avian Influenza Subtipe H5N1 Asal Hewan Indonesia Gusti Ayu Yuniati Kencana; Widya Asmara; Charles Rangga Tabbu; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 11 No 3 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (155.062 KB)

Abstract

The knowledge on the species adaptation factor of avian influenza virus of H5N1 subtype (AIV H5N1)is very important as a signal for the emergence of a new strain with pandemic potential. This research wasconducted to find out the sequence variation of the Non-Coding Region (NCR) and Coding Region (CR) of 5’-terminal cRNA of the polymerase acidic (PA). Total RNA from twenty six (26) avian influenza virussubtype H5N1 isolates were amplified using reverse-transcriptase-polymerase chain reaction (RT-PCR)with a universal forward primer for influenza virus and specifically designed backward primers. Nineteen(19) gene fragments of PA could be amplified. RT-PCR products were sequenced and analyzed using Mega4 software. The length of NCR of PA gene was found to be 24 bases and conserved. A/T composition of PANCR was 58.3%. Species and geographical specificity could not be found in the genetic distance, the aminoacid polymorphism, as well as the phylogenetic analysis of the CR. RNA sequencing is discussed andrecomended to be studied further.
VARIATION OF NON-CODING REGION AND CODING REGION OF 5’-TERMINAL CRNA OF POLYMERASE BASIC 1 OF AVIAN INFLUENZA VIRUS SUBTYPE H5N1 Gusti Ayu Yuniati Kencana; Widya Asmara; Charles Rangga Tabbu; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 10 No 1 (2009)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (161.977 KB)

Abstract

The sequence of the Non-Coding Region (NCR) and Coding Region (CR) of 5’-terminal cRNA of thepolymerase basic 1 (PB1) gene as a major factor for the species adaptation of avian influenza virussubtype H5N1 (AIV H5N1) has been analysed. The information could be a virological signal for theemergence of a new strain with pandemic potential. Total RNA from twenty six (26) avian influenzasubtype H5N1 isolates were amplified using reverse-transcriptase-polymerase chain reaction (RT-PCR)with a universal forward primer for influenza virus and specifically designed backward primers. Fifteen(15) PB1 gene fragments could be amplified. RT-PCR products were sequenced and analyzed using Mega4software. The length of NCR of PB1 gene was found to be 24 bases and mostly shows conserved sequence,with an exception of Dk/Badung/2006 isolate which has C-7T substitution. A/T composition of PB1 NCRwas 54,2%, while the Dk/Badung/2006 isolate was 58,3%. Species and geographical specificity could not befound in the genetic distance, the amino acid polymorphism, as well as the phylogenetic analysis of t
Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION) Gusti Ayu Yuniati Kencana; I Gusti Ngurah Kade Mahardika; Ida Bagus Kade Suardana; I Nyoman Mantik Astawa; Ni Made Krisna Dewi; Gusti Ngurah Narendra Putra
Jurnal Veteriner Vol 13 No 3 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (131.81 KB)

Abstract

Avian Influenza (AI) or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI) virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA) and Haemaglutination Inhibition(HI) assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR). All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Deteksi Anaplasma sp. pada Anjing di Bali secara Klinis, Serologis, dan Molekuler (THE DETECTIONS OF ANAPLASMA SP. IN DOGS IN BALI WITH CLINICAL, SEROLOGICAL AND MOLECULAR) Anak Agung Sagung Istri Pradnyantari; I Nyoman Suartha; I Gusti Made Krisna Erawan; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 20 No 4 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.703 KB) | DOI: 10.19087/jveteriner.2019.20.4.479

Abstract

This study aims to determine the infection of Anaplasma sp. in dogs in Bali with clinical, serological and molecular detections. This research method uses Cross Sectional. The samples were collected from June 2017 to July 2018. The total number of samples obtained was 109 dogs from 3.563 samples from seven veterinarian clinics in Bali. Clinical examinations and blood tests are method of clinical detection. Serological detection is using a rapid test kit E. canis & Anaplasma spp. BioNote© production. Molecular detection have been using with the Polymerase Chain Reaction technique. PCR products were sequenced at 1st BASE Laboratories Sdn Bhd, Malaysia. Data were analyzed using the MEGA 4 program. The results showed that Anaplasma sp. are present in dogs in Bali and can be detected by clinically (3,05%), serologically (55,04% base on clinically positive) and molecularly (42,20% base on clinically positive) detection. Thus, detected species Anaplasma sp. In Bali from this study can be identified as A. platys.
IDENTIFIKASI BAKTERI DARI IKAN TONGKOL (Euthynnus affinis) YANG DIPERDAGANGKAN DI PASAR IKAN KEDONGANAN BALI Gusti Ayu Dianti Violentina; Yan Ramona; I Gusti Ngurah Kade Mahardika
Jurnal Biologi Udayana Vol 19 No 2 (2015): JURNAL BIOLOGI
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (372.853 KB)

Abstract

Ikan tongkol (Euthynnus affinis) merupakan ikan konsumsi yang disukai masyarakat.Pengetahuan tentang bakteri yang ditemukan pada tubuh ikan ini sangat penting untuk tujuan kesehatan masyarakat dan kajian biologi ikan.  Penelitian ini bertujuan untuk mengidentifikasi bakteri yang berasosiasi dengan ikan tersebut.Bakteri dari usus ikan diambil secara aseptis dan ditumbuhkan pada Blood Agar dan Nutrient Broth. DNA total dari kultur agar cair diisolasi dengan chelax, gen 16S RNA diamplifikasi dengan PCR menggunakan primer universal dengan produk sekitar 1300 bp. Produk PCR dirunut dengan metode Big-Dye termination. Hasilnya disepadankan dan dianalisis dengan MEGA 6.0. Pada penelitian ini, 14 spesies bakteri yang memiliki > 99% kesamaan dengan data GenBankteridentifikasi, yaitu Photobacterium leiognathi, Uruburuella testudinis, Aeromonas molluscorum, Psychrobacter celer, Psychrobacer faecalis, Acinetobacter johnsonii, Vibrio gallicus, Bacillus megaterium, Vagococcus fessus, Shewanella baltica, Shewanella algae, Rothia nasimurium, Myroides phaeus dan Yersinia ruckeri. Peran bakteribakteri tersebut dalam biologi ikan dan kesehatan masyarakat perlu dikaji lebih lanjut.
IDENTIFIKASI MOLEKULER BAKTERI STREPTOCOCCUS YANG BERASOSIASI DENGAN IKAN KERAPU YANG DIPERJUALBELIKAN DI PASAR-PASAR IKAN DI BALI I.B. Oka Suyasa; I.G.N.K. Mahardika; Yan Ramona
Jurnal Biologi Udayana Vol 18 No 1 (2014): Jurnal Biologi
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (231.948 KB)

Abstract

Penelitian ini bertujuan untuk mengidentifikasi bakteri Streptococcus sp. yang berasosiasi pada ikan Kerapu dengan menggunakan teknik-teknik molekuler Polymerase Chain Reaction (PCR) agar diperoleh identitas definitive bakteri tersebut. Dalam penelitian ini, sekuen 16S RNA marker dari bakteri-bakteri tersebut dijadikan target untuk diamplifikasi dengan metode PCR. Sekuensing produk PCR dilakukan di Berkeley Sequencing Facility, USA. Hasil sekuen nukleotida yang diperoleh selanjutnya di aligned dan di BLAST dengan menggunakan software MEGA 5.0. Hasil penelitian menunjukkan bahwa teridentifikasi sebanyak dua spesies bakteri Streptococcus (sementara diberi nama Streptococcus sp. isolat A dan B). Streptococcus sp. isolat A ditemukan pada semua lokasi pengambilan sampel ikan, sementara itu isolat B hanya ditemukan pada ikan yang diambil dari pasar ikan Karangasem. Berdasarkan nilai Haplotype Diversity (HD) nya, variasi genetik bakteri Streptococcus sp. pada ikan Kerapu tergolong sangat rendah.
GENETIC DIVERSITY OF SKIPJACK TUNA (Katsuwonus pelamis) FROM JEMBRANA AND KARANGASEM REGENCIES, BALI Fakhrurrasi Fakhri; Inna Narayani; I G. Ngurah Kade Mahardika
Jurnal Biologi Udayana Vol 19 No 1 (2015): JURNAL BIOLOGI
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1258.91 KB)

Abstract

Penelitian ini bertujuan untuk mengetahui keragaman genetik ikan cakalang (Katsuwonus pelamis) yang ada di Kabupaten Jembrana dan Karangasem, Bali. Sampel DNA diambil dari 30 ekor di kabupaten Jembrana dan 30 ekor di kabupaten Karangasem. Ekstraksi DNA dilakukan dengan menggunakan chelex 10% dan amplifikasi menggunakan metode PCR dengan konfigurasi HotStart pada control region DNA mitokondria, menggunakan primer forward CRK dan primer reverse CRE. Analisis filogenetika dilakukan dengan menggunakan metode Neighbor Joining dengan model Kimura 2-parameter. Variasi dari setiap sekuen diperoleh dengan menghitung jumlah, persentase dari tiap haplotipe, keragaman haplotipe (hd) dan keragaman nukleotida (?) menggunakan program DnaSP 5.10. Analisis Fst (Fixation Index) berdasarkan frekuensi haplotipe menggunakan Arlequin 3.1. Haplotipe pada sampel Jembrana berjumlah 28 haplotipe dan sampel Karangasem berjumlah 15 haplotipe dengannilai hd secara keseluruhan yaitu 0,997±0,006 dan untuk keragaman nukleotida (?) sebesar 0,04694. Nilai Fst yang diperoleh yaitu -0,00334 dan Fst P sebesar 0,90918±0,0100, menunjukkan bahwa populasi ikan cakalang di Kabupaten Jembrana dan Karangasem berasal dari populasi induk yang sama.
OPTIMASI AMPLIFIKASI DNA MENGGUNAKAN METODE PCR (Polymerase Chain Reaction) PADA IKAN KARANG ANGGOTA FAMILI Pseudochromidae (DOTTYBACK) UNTUK IDENTIFIKASI SPESIES SECARA MOLEKULAR Ni Putu Dian Pertiwi; i G.N.K Mahardika; Ni Luh Watiniasih
Jurnal Biologi Udayana Vol 19 No 2 (2015): JURNAL BIOLOGI
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (350.886 KB)

Abstract

Polymerase Chain Reaction (PCR) merupakan salah satu metode yang digunakan dalam identifikasi suatu organisme. Identifikasi secara molekular menggunakan metode berbasis PCR perlu dilakukan pada ikan karang Famili Pseudochromidae karena ikan ini mempunyai variasi morfologi warna yang sangat tinggi dan menyulitkan identifikasi morfologi. Metode amplifikasi DNA untuk seluruh spesies ikan anggota famili ini belum banyak dilakukan. Penelitian ini bertujuan untuk mengetahui kondisi optimal untuk amplifikasi DNA menggunakan metode PCR (Polymerase Chain Reaction) pada 25 spesies ikan karang anggota famili Pseudochromidae, yang sebelumnya telah diidentifikasi secara morfologi.Amplifikasi dilakukan pada tiga loki DNA mitokondria, yaitu 16S rRNA, control region dan cytochrome oxidase I (COI). Hasil penelitian menunjukkan kondisi optimum amplifikasi tidak berhubungan dengan perbedaan spesies. Modifikasi amplifikasi dapat dilakukan dengan penambahan volume template DNA dan BSA 1X serta penggantiantemperatur annealing; sedangkan pergantian reagen tidak memberikan pengaruh yang signifikan. Penggunaan primer depan CRK untuk amplifikasi lokus control region juga memberikan hasil yang lebih baik.
Co-Authors Agik Suprayogi Agus Eka Darwinata Amelia, Ni Kadek Shita Anak Agung Ayu Mirah Adi Anak Agung Gde Oka Dharmayudha Anak Agung Gde Putra ANAK AGUNG NGURAH GEDE DWINA WISESA ANAK AGUNG NGURAH OKA PUJAWAN Anak Agung Sagung Istri Pradnyantari Anak Agung Sagung Kendran Andi Bahtiar Batti Anita Dwi Handayani Bambang Sumiarto Bhaskara, Audrey Febiannya Putri Brigita Galilea Adu Charles Rangga Tabbu Daud Steven Triyomi Hariyanto Dewi, Putu Bulan Sasmita DWI SURYANTO Estry Gusnita Damanik F. S. Wignall Fakhrurrasi Fakhri Fedri Rell G.A.M.K. Dewi Ghina Monita Pramudhita Gusti Ayu Dianti Violentina Gusti Ayu Mayani Kristina Dewi Gusti Ayu Yuniati Kencana Gusti Ngurah Narendra Putra Helen Scott-Orr Herawati Sudoyo Heru Susetya I Dewa Made Sukrama I GBA Purwanda I Gede Eka Chandrawan I Gusti Agung Ayu Suartini I Gusti Kamasan Nyoman Arijana I Gusti Ketut Suarjana I Gusti Ketut Suarjana I Gusti Made Krisna Erawan I Gusti Ngurah Badiwangsa Temaja I GUSTI NGURAH DIBYA PRASETYA I Gusti Ngurah Narendra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra1, I K. Suata I KADEK SAKA WIRYANA I Ketut Berata I Made Bagus Arya Permana Ardiana Putra I Made Kardena I Made Sara Wijana I Made Sukada I MADE SUMA ANTARA I Made Suma Anthara I Nengah Kerta Besung I Nengah Kerta Besung i Nengah Wandia I NYOMAN ADI SURATMA I Nyoman Dibia I NYOMAN MANTIK ASTAWA I Nyoman Suartha I Putu Sudiarta I Wayan Bebas I Wayan Gorda I Wayan Masa Tenaya I wayan Teguh Wibawan I Wayan Wirata I-W.T Wibawan I. B. P. Dwija I. K. Suastika I.A.P. Apsari I.B. Oka Suyasa I.B.K. Suardana Ida Ayu Pasti Apsari Ida Ayu Sri Candra Dewi Ida Ayu Sri Chandra Dewi Ida Bagus Kade Suardana Ida Bagus Komang Ardana Ida Bagus Oka Winaya Indrawati Sendow Inna Narayani K. Subrata K. Wirasandhi Kadek Karang Agustina Kadek Satria Adi Marhendra Ketut Tuti Parwati Merati Ketut Wella Mellisandy Lies Parede Luh Made Sudimartini Lusiana Lasmari Siahaan M.T Suhartono MADE PHARMAWATI MADE RATNA SARASWATI . Made Suma Anthara Maggy Thenawidjaja Suhartono Martien Herna Susanti Melkias Oagay Melkias Oagay Messy Saputri Boru Sembiring N. K. Susilarini N. Sri Budiyanti Nareswari, Ayu Widya Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Komang Eka Agustiani Ni Luh Made Ika Yulita Sari Hadiprata Ni Luh Putu Agustini Ni Luh Watiniasih Ni Luh Wayan Yulia Mirayanti Ni Made Adi Tarini Ni Made Krisna Dewi Ni Made Rita Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi2 Ni Made Susilawathi Ni Nengah Dwi Fatmawati Ni Nyoman Sri Budayanti Ni Putu Dian Pertiwi Ni Putu Sriwidyani Nyoman Anandiya Ramaditya Oktryna Hodesi Sibarani Pieter Mbolo Maranata Pipit Dwi Pramesti Pramitasuri, Tjokorda Istri Putri Wiliantari Putu Mei Purnama Dewi R Susanti R.D Soejoedono Raka-Sudewi A. A. Rd Soejoedono Retno Damajanti Soejoedono S Murtini S.K. Widyastuti Safarina G. Malik Sayu Raka Padma Wulan Sari, Sayu Raka Padma Wulan Sri Kayati Widyastuti sri murtini . Sukma Oktavianthi Susilawathi, Ni Made Tania Ria Gunawan TJOK GEDE OKA PEMAYUN Tjokorda Sari Nindhia TRI KOMALA SARI Wibawan IWT Widya Asmara Yan Ramona Yosaphat L.S Kote