p-Index From 2021 - 2026
13.13
P-Index
This Author published in this journals
All Journal JPMS (Jurnal Pendidikan Matematika dan Sains) RADIASI: Jurnal Berkala Pendidikan Fisika Bioeducation Journal Jurnal Pengajaran MIPA EDUSAINS Tadris: Jurnal keguruan dan Ilmu Tarbiyah Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Education Online Techno: Jurnal Penelitian Prosiding KPSDA Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Vidya Karya Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan: Teori, Penelitian, dan Pengembangan Pedagogi Hayati Journal of Biology Education JPPPF (Jurnal Penelitian dan Pengembangan Pendidikan Fisika) Jurnal Pendidikan Biologi Jurnal Biodjati Jurnal Penelitian Pendidikan IPA (JPPIPA) PAEDAGOGIA Jurnal Bioedukatika BIOEDUKASI Momentum: Physics Education Journal Journal of Natural Science and Integration Assimilation: Indonesian Journal of Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Lectura : Jurnal Pendidikan Jurnal Tarbiyah : Jurnal Ilmiah Kependidikan Pedagonal : Jurnal Ilmiah Pendidikan Jurnal Biotek BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Pembelajaran Biologi : Kajian Biologi dan Pembelajarannya Jurnal Studi Guru dan Pembelajaran JURNAL PENDIDIKAN MIPA Jurnal Paedagogy Journal of Educational Chemistry (JEC) Journal of Innovation in Educational and Cultural Research Yumary: Jurnal Pengabdian kepada Masyarakat Journal of Tropical Chemistry Research and Education Proceeding Biology Education Conference Bioed : Jurnal Pendidikan Biologi Jurnal Kajian Pendidikan IPA ASEAN Journal of Science and Engineering Education (AJSEE) Jurnal Pendidikan Ilmu Pengetahuan Alam (JP-IPA) Jurnal Pijar MIPA JIFP (Jurnal Ilmu Fisika dan Pembelajarannya) JSEP (Journal of Science Education and Practice) Al Jahiz: Journal of Biology Education Research Journal of Educational Sciences Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Journal of Mathematics Science and Computer Education Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) Journal of Environment and Sustainability Education Jurnal Pengabdian Isola IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Unnes Science Education Journal Journal of Innovative Science Education U-Teach: Journal of Young Physics Education Teacher Jurnal Pendidikan MIPA JIPFRI (Jurnal Inovasi Pendidikan Fisika dan Riset Ilmiah) IJIS Edu : Indonesian Journal of Integrated Science Education Journal Of Biology Education Research (JBER)
Claim Missing Document
Check
Articles

STEM Analysis (Science, Technology, Engineering and Mathematics) of the Agricultural System of the Indigenous People of Urug Village Lathifah, Suci Siti; Widodo, Ari; Kaniawati, Ida; Sriyati, Siti
Jurnal Penelitian Pendidikan IPA Vol 10 No 5 (2024): May
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i5.6519

Abstract

This study examines the potential of STEM in the context of indigenous farming systems in Urug Village to improve agricultural sustainability, increase crop yields, and promote environmental conservation through education. Surveys and data collection to identify challenges and opportunities, and to develop solutions that meet the needs of indigenous communities while prioritizing sustainability and environmental conservation are practical steps for this study. Data was collected from the agricultural practices of the Urug indigenous community using the survey method, which included participatory observations, interviews, literature reviews, and documentation. Technical terms are explained upon first mention. The Urug indigenous community follows a series of rice planting procedures. These include babad susukan, seed preparation, seed soaking for two days, stocking, ngabaladah, babad, mingul, ngangler, tandur, ngoyos, ngadares, dibuwat (harvest), lantayan, and ngunjal. The study of science in the community centers around concepts such as astronomy, ecosystems, simple aircraft, pressure, temperature, and heat. Additionally, simple technologies such as terracing, etem, and leuit are employed. Agricultural engineering focuses on environmentally friendly rice farming. Mathematics deals with numbers and operations used in solving numeric problems, as in the calculation of the Pranatamangsa calendar and the Tandur. This agricultural knowledge can be integrated into STEM education.
Integration of Local Potential of Way Kambas National Park in Developing HOTS-Based Assessment Content in Biological Conservation Courses Jacinda, Alma Aliya; Sriyati, Siti; Solihat, Rini
Jurnal Penelitian Pendidikan IPA Vol 10 No 8 (2024): August
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i8.8364

Abstract

The assessment of Higher Order Thinking Skills (HOTS) based on local potential has not been widely used in biological conservation education. Assessments like this aim to encourage students to think critically, analytically, and creatively, as well as familiarize students with solving problems in real contexts, especially in the conservation area of Way Kambas National Park (WKNP) in Lampung. This study aims to identify the local potential of WKNP conservation areas that have the potential to be integrated with the development of HOTS-based assessments in the Biological Conservation Course. The method used in this study is descriptive with a qualitative approach. Interviews were conducted with 6 informants. Triangulation techniques and data interpretation then analyzed the data obtained. The results of this study show that there is a lot of local potential in WKNP conservation area that has the potential to be integrated into the assessment content on 7 biological conservation materials that can be made HOTS-based assessments to hone students' high-level thinking skills.
Implementation of Argumentative Driven Inquiry in Science Learning 2009-2023: Bibliometric and Review Analysis Misbah, Misbah; Hamidah, Ida; Sriyati, Siti; Samsudin, Achmad
Tarbiyah : Jurnal Ilmiah Kependidikan Vol. 13 No. 1 (2024): June
Publisher : Universitas Islam Negeri Antasari Banjarmasin, South Kalimantan, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18592/tarbiyah.v13i1.12929

Abstract

This research examines research trends in applying argumentation-driven inquiry (ADI) in science learning and its potential for future research. A literature review is used in this research method through bibliometric analysis. The data source was obtained from the Scopus database, which obtained 72 articles from 549 articles in 2009-2023 with the keyword "Argumentative Driven Inquiry." The results show that publications fluctuate every year, with some years seeing a significant increase in publications, while others show a decline. Articles on this topic mostly come from international journals indexed by Scopus with quartile 1. This is in line with sources that publish many articles on this topic. Similarly, the top authors based on publications also come from international journals indexed by Scopus with quartile 1. The US and Indonesia are the most productive countries on this topic. The visualization results are divided into 6 clusters. It can find specific keywords that have the potential to be further researched in the future.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Resmi, Denia Dwi Citra; Hidayat, Topik; Sriyati, Siti
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Development of Integrated Science E-Learning Modules Based on Bangka Belitung Ethnoscience Subjects in Junior High Schools Fitriyah, Firanita; Sriyati, Siti; Agustin, Rika Rafikah
Journal of Educational Sciences Vol. 10 No. 1 (2026): Journal of Educational Sciences
Publisher : FKIP - Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31258/jes.10.1.p.1162-1173

Abstract

This study aims to integrate science learning with local wisdom in Bangka Belitung into teaching materials in the form of integrated science E-Modules based on ethnoscience to improve science process skills. This development follows the ADDIE development process, which consists of five stages: Analysis, Design, Development, Implementation, and Evaluation. The analysis stage focuses on the needs that are used as information for development. The design stage focuses on developing the content and format of the E- Module in accordance with the concept map and storyboard to produce an initial product. In the development stage, the initial product was validated by experts consisting of expert lecturers and teachers as science learning practitioners. The validation results showed that the developed E-Module was very suitable for use because it received a very valid category with a score of 85.80% from content validation and 86.99% from construct validation. In the implementation stage, the average response of students to the use of E- Modules in learning was 91.84%. Thus, the developed E- Module is considered feasible, practical, and effective in science learning.
Potential of The Citizen Science Project (CSP) to Support Biodiversity Learning in Indonesia Gusti, Utari Akhir; Hidayat, Topik; Sriyati, Siti; Ananda, Gheri Febri
Bioeducation Journal Vol 9 No 2 (2025): Bioeducation Journal
Publisher : Universitas Negeri Padang Address: Biology Education Study Program Faculty Mathematics and Natural Science (FMIPA) Jl. Prof. Dr. Hamka Air Tawar Barat, Padang-West Sumatera-Indonesia Telp. +62751-7057420 - Fax.+62751-7058772 - Ph. +6281363229286

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bioedu.v9i2.527

Abstract

Conservation of biodiversity in Indonesia is very important. This condition is supported by the high diversity owned but very minimal conservation efforts. Collaborative action between local communities and scientists in learning is needed to support conservation through education. Therefore, it is important to analyze the potential of citizen science projects in biodiversity lessons. This study aims to investigate the potential of citizen science projects and the condition of biodiversity learning in schools. This research is classified as descriptive qualitative. The sampling technique used random sampling with data collection using interviews, questionnaire distribution, and literature study. The results obtained show that citizen science projects have great potential in supporting biodiversity learning in Indonesia with local knowledge owned by indigenous peoples. The results are reinforced by data from students and teachers who agree to support citizen science project innovations in conscious, meaningful, and fun learning. This research reveals learning innovations that become alternatives in learning biodiversity in the success of learning outcomes in the form of conservation through education.
EVALUATION OF THE MICROTEACHING COURSE PROGRAM USING THE CIPP MODEL: OPTIMIZING DIGITAL TECHNOLOGY TO ENHANCE PROSPECTIVE PHYSICS TEACHERS’ TEACHING READINESS Sriyati, Siti; Nahadi; Liliawati, Winny; Hamidah, Ida; Warliani, Resti
Jurnal Ilmu Fisika dan Pembelajarannya (JIFP) Vol 9 No 2 (2025): Jurnal Ilmu Fisika dan Pembelajarannya (JIFP)
Publisher : Program Studi Pendidikan Fisika, UIN Raden Fatah Palembang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19109/xn050927

Abstract

This study aims to evaluate the Microteaching course program in the Physics Education Study Program using the CIPP (Context, Input, Process, Product) evaluation model and to analyze the role of digital technology in enhancing prospective teachers’ teaching readiness. Data were collected through questionnaires, interviews, analysis of the course syllabus (RPS), and video documentation of Microteaching practices. Participants consisted of 19 seventh-semester students, one course instructor, and the Head of the Study Program. The Context evaluation showed that all components of the course syllabus were available and that there was a 100% alignment among Program Learning Outcomes (CPL), Course Learning Outcomes (CPMK), and course content. Regarding Input, students demonstrated good academic prerequisites, as indicated by 90% of them obtaining an A in the Physics Lesson Planning course; however, only 21.1% owned relevant textbooks, and facilities such as a dedicated Microteaching room and documentation equipment still require improvement. The Process evaluation revealed that 100% of students used technology in their Microteaching practices, particularly through presentation media, virtual simulations, and instructional videos, and some of them utilized artificial intelligence (AI) tools to support lesson planning. The Product evaluation indicated that most students achieved high final grades in the Microteaching course and reported positive perceptions of its contribution to their teaching readiness. These findings highlight the importance of strengthening students’ digital literacy, providing adequate facilities specifically designed for Microteaching, and systematically training teaching skills that integrate digital technology in order to further optimize the quality of the Microteaching course.
Pengembangan Media Pembelajaran Interaktif Berbasis Etnosains Lamang Tapai Pada Materi IPA Sebagai Upaya Meningkatkan Sustainability Awareness Siswa Atiqah Ulya Hayandi; Siti Sriyati; Diana Rochintaniawati; Sasi Sabila Musakinah Ramadhany
Jurnal Penelitian Pendidikan IPA Vol 11 No 6 (2025): June
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v11i6.11119

Abstract

The purpose of this study was to develop interactive learning media based on Lamang Tapai ethnoscience that is valid to increase students' sustainable awareness compared to PPT media used in schools. The research method used is development with the DDR model. The research sample was grade IX students consisting of 30 control class students and 30 experimental class students. The research instruments were media feasibility questionnaires and sustainable awareness questionnaires. The media feasibility questionnaire consisting of material feasibility, learning design, media design and communication was used to validate the media by 5 validators. Sustainable awareness measures 3 indicators, namely behavioral and attitudinal awareness, emotional awareness and practical awareness, all categories are measured based on three aspects of ESD, namely environmental aspects, social aspects, and economic aspects totaling 22 statements. The results of the study showed that the interactive media developed had an average validity value of > 3.00 which means that the interactive media was feasible and  very valid, while sustainable awareness in the experimental class reached a value of 90.74 higher than the control class, which was 82.08. This shows that interactive media is declared valid and increases students' sustainable awareness better than PPT media commonly used by teachers.
Eksplorasi Pengetahuan Lokal tentang Rafflesia sp. dalam Persepektif Etnosains dan Potensinya sebagai Sumber Belajar Sains Berbasis Potensi Lokal Bengkulu Harmelayati, Yena; Sriyati, Siti; Riandi, Riandi
Bioed : Jurnal Pendidikan Biologi Vol 14, No 1 (2026): Bioed : Jurnal Pendidikan Biologi
Publisher : Universitas Galuh

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25157/jpb.v14i1.23561

Abstract

Integrasi etnosains dalam pembelajaran biologi berperan penting dalam menghubungkan pengetahuan lokal dengan konsep ilmiah sehingga menghasilkan pembelajaran yang kontekstuall dan bermakna. Penelitin ini bertujuan untuk mengekplorasi pengetahuan lokal masyarakat Bengkulu tentang Rafflesia sp., khususnya Rafflesia arnoldii, dalam perspektif etnosains serta enganalisis potensinya sebagai sumber belajar sains berbasis potensi lokal. Data diperoleh melalui observasi lapangan, wawancara mendalam, serta studi literatur, kemudian dianalisis menggunakan model Miles dan Huberman. Hasil penelitian menunjukkan bahwa masyarakat lokal memiliki pengetahuan spesifik terkait Rafflesia sp., meliputi : (1) karakterisitik habitat yang lembab, teduh, dan berada di hutan hujan tropis; (2) ketergantungan mutlak pada tanaman inang Tetrastigma sp.; (3) fase pertumbuhan; serta (4) interaksi ekosistem dan nilai kesadaran memiliki dalam masyarat lokal. Temuan ini menunjukkan adanya kesesuaian antara pengetahuan lokal dan konsep ilmiah dalam biologi, khususnya pada materi ekologi, parasitisme, pertumbuhan dan perkembangan, serta konservasi keanekaragaman hayati. Integrasi etnosains berpotensi dikembangkan sebagai sumber belajar berbasis potensi lokal yang mampu meningkatkan literasi ilmiah, kesadaran konservasi, dan penguatan identitas budaya khas peserta didik secara berkelanjutan. Kata kunci: Etnosains, rafflesia, pembelajaran biologi, potensi lokal
Biodiversity Literacy and Tradition: Development of Student Worksheets Based on the Local Potential of the Indahan Tupporobu Dish for Biology Learning Nurul Faizah Siregar; Amprasto; Siti Sriyati
Al Jahiz Vol 6 No 2 (2025): Al-Jahiz: Journal of Biology Education Research, July-December 2025
Publisher : Fakultas Tarbiyah dan Ilmu Keguruan UIN Jurai Siwo, Lampung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.32332/al-jahiz.v6i2.10901

Abstract

Indonesia is a country with high levels of biodiversity (megabiodiversity), but student literacy related to biodiversity is still relatively low. This study aims to describe the feasibility, practicality, and effectiveness of Student Worksheets based on local potential, which are expected to improve student learning outcomes in biodiversity literacy. This study involved students from SMAN 4 Padangsidimpuan, grade X. This research is a Research and Development (R&D) study that adapts the 4D model from Thiagarajan, Semmel, and Semmel, which consists of the Define, Design, Develop, and Disseminate stages. However, this study was only conducted up to the Development stage due to time constraints. The Student Worksheets developed was verified by subject matter experts, with verification results showing a very high level of validity and no need for revision, namely 84% by subject matter experts and 85% from the analysis of student response test results, categorized as very good. The effectiveness test results showed that the Student Worksheets based on local potential is effective in improving students' biodiversity literacy, with an N-gain value of 0.36 (moderate category). Therefore, this Student Worksheets is suitable for use as a learning tool in biology education, particularly for topics related to biodiversity.
Co-Authors Achmad Samsudin Adi Rahmat Adnan Muchsin Agus Kamaludin, Agus Agustin, Rika Rafika Ahmad Aminudin Aldeva Ilhami Allyany Hasyaty Almira Ivana Almubarak, Almubarak Amalia Pratiwie Ananda, Gheri Febri Anderias Henukh Aprilita Ekasari Ari Widodo Ari Widodo Ari Widodo Ari Widodo Ari Widodo Arifin Ahmad Arizaldy, Arizaldy Asmawi Zainul Atiqah Ulya Hayandi Azizah, Cici Nur Baifeto, Ekri Pranata Ferdinand Bariroh, Ghurrotul Ciptro Handrianto, Ciptro Dede Trie Kurniawan Denia Dwi Citra Resmi Devi, Cindy Rantika Diah - Kusumawaty Dian Amirulloh Diana Rochintaniawati Didik Priyandoko Didik Pryandoko Dini Riyani Eka Cahya Prima Ekasari, Aprilita Elah Nurlaelah Eliyawati Eliyawati Fadilah, Solikhah Isti Faidah, Siti Tahany Rifa Fajri, Nurullina Febblina Daryanes Findi Septiani Fitriyah, Firanita Fuadiyah, Sadiatul Gusti, Utari Akhir Harmelayati, Yena Harry Firman Harry Firman Havita, Vivit Nurhikmah Hermansyah Hermansyah Hermansyah Hermansyah HERNANI - Ida Hamidah Ida Hamidah Ida Kaniawati Ida Kaniwati Ida Yayu Nurul Hizqiyah Ida Yayu Nurul Hizqiyah Ilham Nur Iman Maulana Ilhami, Aldeva Irawan*, Peri Irawan, Tb Moh Irma Ari Irvani, Asep Irvan Ismail Ismail Isnawati Isnawati Jacinda, Alma Aliya Kadek Sera Harlistya Udayani Kasi, Yohanes F Kumalasari, Lita Laelandi, Rahayu Lathifah, Suci Siti Latifah, Suci Siti Laurina Sinurat Lembang, Angela Meirici Lia Lutianasari Lia Lutianasari Lilis Sulistiawati Lilit Rusyati Lulu Desia Mutiani Rahmayuni Mellyzar, Mellyzar Melta, Defrian Misbah Misbah Mr Amprasto Mr Sjaeful Anwar Mrs Yanti Hamdiyati Mu'aziyah, Siti Eneng Sururiyatul Mukhyati Mukhyati, Mukhyati Nabuasa, Desi Aryanti Nahadi Nahadi , Nahadi Nanang Winarno Ninda Eka Ratanasabilla Nur Hamidah Nur Hamidah, Nur Nuraeni, Selvi Nurani Rahmawati, Dini Nurbaiti Nuris Fattahillah Nurul Faizah Siregar Nuryani Rustaman Olsiara, Lairani Parlindungan Sinaga Pisca Hana Marsenda Puspita, Gita Nurul Puspitaningrum, Hardini Putra Habib Dhitareka Qamariah, Qamariah R. Riandi, R. Raden Ahmad Hadian Adhy Permana Raden Ahmad Hadian Adhy Permana* Ragadhita, Risti Rahayu Laelandi Rahman, Nor Farahwahidah Abdul Rahmania - Firda Rahmi, Nisrina Nur Regina P. Octavianda, Regina P. Resmi, Denia Dwi Citra Retnowulan, Sri Rahayu Reyza Arief Taqwa, Muhammad Riandi Riandi Ridwan, Ridwan Ridyah, Surya Warni Rika Rafikah Agustin Rini Solihat Rosamsi, Saiman Rukmana, Putri Enizs Wahyu Safira Permata Dewi Salastri Rohiat, Salastri Sarah, Lia Laela Sasi Sabila Musakinah Ramadhany Sastra Mulya, Bunga Septina Carolina, Hifni Silaban, Oky Rizkiana Sinaga, Lastama Siregar, Najihah Fakhirah Siswandari, Puti Sri Maryanti Sri Maryanti Sri Redjeki Sri Redjeki Supriyadi Supriyadi Supriyatin, Titin Sura, Sunarto Arif Syafigha, Annisa Syahfitri, Jayanti Sylva Sagita Titin Supriyatin Tohe, Ansar Tohe, Humairah Ansar Tony Hadibarata, Tony Topik Hidayat Umar, Mohammad Farhan Utari Akhir Gusti Virijai, Febrian Vivit Nurhikmah Havita Wahyu Rimbun Wahyu Sopandi Warliani, Resti Wawan Setiawan Weni Rahmadani Widi Purwianingsih Widyaningsih, Mia Wiji Wiji Winda - Yusefni Winny Liliawati Wulandari, Melyastuti Yeni Setyowati* Yuliani, Galuh