Article Per Year (5 Year)
p-Index From 2021 - 2026
13.844
P-Index
This Author published in this journals
All Journal JPMS (Jurnal Pendidikan Matematika dan Sains) RADIASI: Jurnal Berkala Pendidikan Fisika Bioeducation Journal Jurnal Pengajaran MIPA EDUSAINS Tadris: Jurnal keguruan dan Ilmu Tarbiyah Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Education Online Techno: Jurnal Penelitian Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Vidya Karya Scientiae Educatia: Jurnal Pendidikan Sains Pedagogi Hayati Journal of Biology Education JPPPF (Jurnal Penelitian dan Pengembangan Pendidikan Fisika) Jurnal Pendidikan Biologi Jurnal Biodjati Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Bioedukatika BIOEDUKASI Journal of Natural Science and Integration Assimilation: Indonesian Journal of Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Lectura : Jurnal Pendidikan Jurnal Tarbiyah : Jurnal Ilmiah Kependidikan Pedagonal : Jurnal Ilmiah Pendidikan Jurnal Biotek BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Pembelajaran Biologi : Kajian Biologi dan Pembelajarannya Jurnal Studi Guru dan Pembelajaran JURNAL PENDIDIKAN MIPA Jurnal Paedagogy Journal of Educational Chemistry (JEC) Journal of Innovation in Educational and Cultural Research Yumary: Jurnal Pengabdian kepada Masyarakat Journal of Tropical Chemistry Research and Education Bioed : Jurnal Pendidikan Biologi Jurnal Kajian Pendidikan IPA ASEAN Journal of Science and Engineering Education (AJSEE) Jurnal Pendidikan Ilmu Pengetahuan Alam (JP-IPA) Jurnal Pijar MIPA JIFP (Jurnal Ilmu Fisika dan Pembelajarannya) JSEP (Journal of Science Education and Practice) Al Jahiz: Journal of Biology Education Research Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Journal of Mathematics Science and Computer Education Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) Journal of Environment and Sustainability Education Jurnal Pengabdian Isola SEARCH: Science Education Research IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Unnes Science Education Journal Journal of Innovative Science Education Jurnal Pendidikan IPA Indonesia U-Teach: Journal of Young Physics Education Teacher Jurnal Pendidikan MIPA Edubiotik : Jurnal Pendidikan, Biologi dan Terapan JIPFRI (Jurnal Inovasi Pendidikan Fisika dan Riset Ilmiah) IJIS Edu : Indonesian Journal of Integrated Science Education Journal Of Biology Education Research (JBER) Indonesian Journal on Learning and Advanced Education (IJOLAE) Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Abmas
Siti Sriyati
Universitas Pendidikan Indonesia
Agriculture, Biological Sciences & Forestry Arts Humanities Astronomy Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Library & Information Science Materials Science & Nanotechnology Mathematics Physics Social Sciences Other

Published : 131 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 131 Documents
Search

 10   11   12   13   14 
Research Progress, Trends, and Updates on STEM Learning-ESD: A Bibliometric Analysis Suci Siti Lathifah; Ari Widodo; Ida Kaniawati; Siti Sriyati
Jurnal Penelitian Pendidikan IPA Vol 10 No 5 (2024): May
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i5.6513

Abstract

The aim of this paper is to analyse research trends and address knowledge gaps in order to improve STEM-ESD learning. Technical terms are explained upon first use, and sentence structure is clear and unambiguous. The bibliometric review examines current research progress, trends, and updates related to STEM-ESD learning. The study used the Scopus database to select documents and VOSviewer software to investigate bibliometrics. STEM-ESD research shows an upward trend based on the analysis of 19 collections of STEM and ESD learning papers from 2010 to 2023. Indonesia leads in conducting STEM-ESD research, with the highest number of publications on this theme in 2022. In 2010, the significance of STEM-ESD research was its application in the STEM curriculum. STEM-ESD research has facilitated the inclusion of various social science topics in the learning process. This fosters 21st-century skills in students through a project-based learning model. Further STEM-ESD research can be advanced by improving pedagogical design capacity, biodiversity, sustainable development goals, formal and initial teacher training, biology education, and sustainable learning. This will lead to more innovative research.
STEM Analysis (Science, Technology, Engineering and Mathematics) of the Agricultural System of the Indigenous People of Urug Village Suci Siti Lathifah; Ari Widodo; Ida Kaniawati; Siti Sriyati
Jurnal Penelitian Pendidikan IPA Vol 10 No 5 (2024): May
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i5.6519

Abstract

This study examines the potential of STEM in the context of indigenous farming systems in Urug Village to improve agricultural sustainability, increase crop yields, and promote environmental conservation through education. Surveys and data collection to identify challenges and opportunities, and to develop solutions that meet the needs of indigenous communities while prioritizing sustainability and environmental conservation are practical steps for this study. Data was collected from the agricultural practices of the Urug indigenous community using the survey method, which included participatory observations, interviews, literature reviews, and documentation. Technical terms are explained upon first mention. The Urug indigenous community follows a series of rice planting procedures. These include babad susukan, seed preparation, seed soaking for two days, stocking, ngabaladah, babad, mingul, ngangler, tandur, ngoyos, ngadares, dibuwat (harvest), lantayan, and ngunjal. The study of science in the community centers around concepts such as astronomy, ecosystems, simple aircraft, pressure, temperature, and heat. Additionally, simple technologies such as terracing, etem, and leuit are employed. Agricultural engineering focuses on environmentally friendly rice farming. Mathematics deals with numbers and operations used in solving numeric problems, as in the calculation of the Pranatamangsa calendar and the Tandur. This agricultural knowledge can be integrated into STEM education.
Integration of Local Potential of Way Kambas National Park in Developing HOTS-Based Assessment Content in Biological Conservation Courses Alma Aliya Jacinda; Siti Sriyati; Rini Solihat
Jurnal Penelitian Pendidikan IPA Vol 10 No 8 (2024): August
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i8.8364

Abstract

The assessment of Higher Order Thinking Skills (HOTS) based on local potential has not been widely used in biological conservation education. Assessments like this aim to encourage students to think critically, analytically, and creatively, as well as familiarize students with solving problems in real contexts, especially in the conservation area of Way Kambas National Park (WKNP) in Lampung. This study aims to identify the local potential of WKNP conservation areas that have the potential to be integrated with the development of HOTS-based assessments in the Biological Conservation Course. The method used in this study is descriptive with a qualitative approach. Interviews were conducted with 6 informants. Triangulation techniques and data interpretation then analyzed the data obtained. The results of this study show that there is a lot of local potential in WKNP conservation area that has the potential to be integrated into the assessment content on 7 biological conservation materials that can be made HOTS-based assessments to hone students' high-level thinking skills.
Ethnoscience Course Program Oriented Towards Education for Sustainable Development (ESD): A Needs Assesment Aldeva Ilhami; Topik Hidayat; Riandi Riandi; Siti Sriyati
SEARCH: Science Education Research Journal Vol. 4 No. 2 (2026): Advancing Science Education Through Local Wisdom
Publisher : IAIN Sorong

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47945/search.v4i2.2813

Abstract

Ethnoscience is one of the compulsory courses in the Science Education program. The implementation of Education for Sustainable Development (ESD) should be integrated into the ethnoscience course to enhance the awareness of prospective science teachers regarding the environment and sustainability. This study aims to analyze the implementation of the ethnoscience course program at a Teacher Training Institution (LPTK) in Riau Province. A case study methodology was employed, involving the analysis of ethnoscience course documents, observation and interviews with lecturers. The data were analyzed using qualitative descriptive methods based on the Miles-Huberman framework. The course implementation plan has met the established standards, and the majority of the learning outcomes align with the qualifications set by the Indonesian National Qualification Framework (KKNI). The ethnoscience course uses a research approach that examines the reconstruction of indigenous knowledge into scientific knowledge, though it has yet to emphasize sustainability literacy. Lecturers face challenges in accommodating the depth of content derived from student projects. Stakeholders should consider policies for collaborative teaching,like citizen science project in ethnoscience to support the optimization of achieving the course’s expected competencies.
Reconstructing Indigenous Knowledge of Kasepuhan Girijaya for High School Biology Learning: An Ethnoscience Approach Nadhifa Rohadatul Aisy; Siti Sriyati; Amprasto; Indriyani Rachman
Jurnal Inovasi Pendidikan IPA Vol. 12 No. 1 (2026): April 2026
Publisher : Faculty of Mathematics and Natural Sciences, Universitas Negeri Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21831/jipi.v12i1.94508

Abstract

Biology learning on ecosystem topics frequently encounters epistemological challenges arising from a disconnect between formal academic science and students' socio-cultural realities, a gap widely recognised in contemporary science education research. The study aimed to reconstruct the Indigenous Knowledge (IK) of Kasepuhan Girijaya into scientifically validated concepts for integration into high school biology curricula. A qualitative approach with an ethnographic design was employed; data were collected through participatory observation, in depth interviews with traditional leaders, and document analysis, and analysed using an interactive model encompassing data condensation, science reconstruction, and pedagogical relevance mapping. The findings suggest that Kasepuhan Girijaya's three tier land zoning system (Leuweung Tutupan, Titipan, and Garapan) demonstrates conceptual alignment with watershed management and soil conservation principles. Twelve IK practices were identified as providing plausible scientific mechanisms, including light intensity regulation, riparian bio engineering, and ecological rest each mappable to Biology Learning Outcomes in the Merdeka Curriculum. These findings are theoretical and analytical in nature; empirical testing of their pedagogical effectiveness remains a direction for future research.
Where Tradition Meets Innovation: Ethnoscience, Creativity, and the Future of Project-Based Learning in Higher Education Muhammad Fuad Sya'ban; Adi Rahmat; Siti Sriyati; Omay Sumarna
Journal of Mathematics Science and Computer Education Vol 6, No 1 (2026): MAY 2026
Publisher : Universitas Lambung Mangkurat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20527/jmscedu.v6i1.18260

Abstract

Indigenous knowledge systems hold untapped potential for fostering creativity in higher education, yet their integration with project-based learning remains systematically unexplored. This study aimed to examine the effectiveness of ethnoscience-integrated project-based learning in developing creativity among higher education students and to map the current research landscape to identify thematic clusters, temporal patterns, and future directions. We employed systematic literature network analysis, combining systematic review with bibliometric analysis. Following PRISMA 2020 guidelines, a total of 49 articles were retrieved and subjected to keyword co-occurrence analysis using VOSviewer, of which six met full inclusion criteria and were systematically reviewed for empirical effectiveness. All six studies demonstrated positive creativity effects (100% directional consistency, p < 0.001) with moderate-to-large effect sizes (d = 0.4–0.6). Three mechanisms emerged: cultural relevance enhancing engagement, traditional knowledge providing novel perspectives, and community connections fostering applied creativity. Bibliometric analysis identified five major research clusters, revealing that ethnoscience integration shows near-complete absence from mainstream literature despite strong empirical support. These findings conclude that ethnoscience-integrated PBL consistently outperforms conventional approaches in both creativity quality and depth of applied problem-solving, suggesting its strong potential as a decolonizing and equity-driven pedagogy for higher education. The implications point toward the urgent need for curriculum redesign that embeds indigenous epistemologies, faculty development in cultural competency, and co-designed, culturally responsive assessment instruments. Looking ahead, the future of ethnoscience, creativity, and PBL in higher education lies in large-scale cross-cultural trials; technology-enhanced ethnoscience learning respecting indigenous data sovereignty; and community-led participatory research that positions indigenous knowledge holders as co-educators and co-researchers.
Development of a critical thinking assessment instrument based on Dieng's local context Fadilah, Solikhah Isti; Sriyati, Siti; Amprasto, Amprasto; Irawan, Tb Moh Irma Ari
Edubiotik : Jurnal Pendidikan, Biologi dan Terapan Vol. 11 No. 01 (2026): May
Publisher : Biology Education Department, Universitas Insan Budi Utomo, Malang, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33503/ebio.v11i01.1622

Abstract

Critical thinking is a crucial core competency in biology education; however, authentic assessments that integrate local wisdom remain limited. This study addresses the need for a valid and reliable critical thinking assessment instrument based on the local context of Dieng. An exploratory sequential mixed-method design was employed, encompassing stages of qualitative exploration, instrument development, expert validation, readability testing, and field trials. The limited trials were conducted on two groups consisting of 31 and 32 students, respectively, followed by a large-scale trial involving 201 senior high school students. Quantitative data were analyzed using the Rasch model with Winsteps version 3.73 to examine item validity, reliability, and unidimensionality. The qualitative findings identified four forms of local wisdom and fifteen local potentials of Dieng that were relevant to biology learning in Phases E and F of the Merdeka Curriculum. The Rasch analysis showed that the developed instrument demonstrated excellent item reliability (0.96) and acceptable unidimensionality (21.7%). In conclusion, this study successfully developed a psychometrically valid critical thinking assessment instrument that integrated Dieng local wisdom as an authentic context in biology learning. The instrument met validity and reliability criteria and was suitable for measuring students’ critical thinking skills in a contextual and meaningful manner.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Eksplorasi Pengetahuan Lokal tentang Rafflesia sp. dalam Persepektif Etnosains dan Potensinya sebagai Sumber Belajar Sains Berbasis Potensi Lokal Bengkulu Yena Harmelayati; Siti Sriyati; Riandi Riandi
Bioed : Jurnal Pendidikan Biologi Vol 14, No 1 (2026): Bioed : Jurnal Pendidikan Biologi
Publisher : Universitas Galuh

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25157/jpb.v14i1.23561

Abstract

Integrasi etnosains dalam pembelajaran biologi berperan penting dalam menghubungkan pengetahuan lokal dengan konsep ilmiah sehingga menghasilkan pembelajaran yang kontekstuall dan bermakna. Penelitin ini bertujuan untuk mengekplorasi pengetahuan lokal masyarakat Bengkulu tentang Rafflesia sp., khususnya Rafflesia arnoldii, dalam perspektif etnosains serta enganalisis potensinya sebagai sumber belajar sains berbasis potensi lokal. Data diperoleh melalui observasi lapangan, wawancara mendalam, serta studi literatur, kemudian dianalisis menggunakan model Miles dan Huberman. Hasil penelitian menunjukkan bahwa masyarakat lokal memiliki pengetahuan spesifik terkait Rafflesia sp., meliputi : (1) karakterisitik habitat yang lembab, teduh, dan berada di hutan hujan tropis; (2) ketergantungan mutlak pada tanaman inang Tetrastigma sp.; (3) fase pertumbuhan; serta (4) interaksi ekosistem dan nilai kesadaran memiliki dalam masyarat lokal. Temuan ini menunjukkan adanya kesesuaian antara pengetahuan lokal dan konsep ilmiah dalam biologi, khususnya pada materi ekologi, parasitisme, pertumbuhan dan perkembangan, serta konservasi keanekaragaman hayati. Integrasi etnosains berpotensi dikembangkan sebagai sumber belajar berbasis potensi lokal yang mampu meningkatkan literasi ilmiah, kesadaran konservasi, dan penguatan identitas budaya khas peserta didik secara berkelanjutan. Kata kunci: Etnosains, rafflesia, pembelajaran biologi, potensi lokal
Integrating Potential and Local Wisdom into Digital Biology Learning: A Study on E-Module Efficacy for Enhancing Students' Critical Thinking Siti Sriyati; Sunarto Sura; Angela Lembang
Jurnal Pendidikan IPA Indonesia Vol. 15 No. 2 (2026): June 2026
Publisher : Universitas Negeri Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/jpii.v15i2.49339

Abstract

Students' low critical thinking skills remain a global educational challenge, often attributed to conventional pedagogy and the lack of contextualized learning resources. This study aims to evaluate a biology e-module integrating the local potential and local wisdom of the Toraja Tribe to improve students' critical thinking skills. A pretest-posttest quasi-experimental design was used to compare a control group (using a commonly used biology textbook) and an experimental group (using an e-module on the local wisdom of Toraja). This study involved 140 grade 10 students. Data were collected using a test instrument based on the Ennis framework, and a statistical test was performed using the Mann-Whitney U test. The results showed that implementing the e-module on biodiversity significantly increased students' critical thinking skills (Sig = 0.000 < 0.05) with a large effect size (1.61), confirming the strong impact of context-based digital learning on cognitive development. Research results show that using e-modules on biodiversity significantly improves students' critical thinking skills (Sig = 0.000 < 0.05) with a large effect size (1.61), confirming the strong impact of context-based digital learning on critical thinking skills. Research results show that using e-modules on biodiversity significantly improves students' critical thinking skills (Sig = 0.000 < 0.05) with a large effect size (1.61), confirming the strong impact of context-based digital learning on critical thinking skills. These findings suggest that digitizing local potential and local wisdom is effective in bridging the gap between abstract scientific concepts and students' socio-cultural reality, thereby boosting critical thinking skills.
Co-Authors Achmad Samsudin Adi Rahmat Adnan Muchsin Agus Kamaludin, Agus Agustin, Rika Rafika Ahmad Aminudin Aidil Adhani Aldeva Ilhami Allyany Hasyaty Alma Aliya Jacinda Almira Ivana Almubarak, Almubarak Amalia Pratiwie Ananda, Gheri Febri Anderias Henukh Angela Lembang Aprilita Ekasari Ari Widodo Ari Widodo Ari Widodo Ari Widodo Ari Widodo Arifin Ahmad Arizaldy, Arizaldy Asmawi Zainul Atiqah Ulya Hayandi Azizah, Cici Nur Baifeto, Ekri Pranata Ferdinand Bariroh, Ghurrotul Ciptro Handrianto, Ciptro Dede Trie Kurniawan Denia Dwi Citra Resmi Devi, Cindy Rantika Diah - Kusumawaty Dian Amirulloh Diana Rochintaniawati Didik Priyandoko Didik Pryandoko Dini Riyani Eka Cahya Prima Ekasari, Aprilita Elah Nurlaelah Eliyawati Eliyawati Fadilah, Solikhah Isti Fajri, Nurullina Febblina Daryanes Findi Septiani Fuadiyah, Sadiatul Gusti, Utari Akhir Harry Firman Harry Firman Havita, Vivit Nurhikmah Hermansyah Hermansyah Hermansyah Hermansyah HERNANI - Ida Hamidah Ida Hamidah Ida Kaniawati Ida Kaniwati Ida Yayu Nurul Hizqiyah Ida Yayu Nurul Hizqiyah Ilham Nur Iman Maulana Ilhami, Aldeva Indriyani Rachman Irawan*, Peri Irawan, Tb Moh Irma Ari Irvani, Asep Irvan Ismail Ismail Isnawati Isnawati Kadek Sera Harlistya Udayani Kasi, Yohanes F Kumalasari, Lita Laelandi, Rahayu Latifah, Suci Siti Laurina Sinurat Lembang, Angela Meirici Lia Lutianasari Lia Lutianasari Lilis Sulistiawati Lilit Rusyati Lulu Desia Mutiani Rahmayuni Mellyzar, Mellyzar Melta, Defrian Misbah Misbah Mr Amprasto Mr Sjaeful Anwar Mrs Yanti Hamdiyati Mu'aziyah, Siti Eneng Sururiyatul Muhammad Fuad Sya&#039;ban Mukhyati Mukhyati, Mukhyati Nabuasa, Desi Aryanti Nadhifa Rohadatul Aisy Nahadi Nahadi , Nahadi Najihah Fakhirah Siregar Nanang Winarno Ninda Eka Ratanasabilla Nur Hamidah Nur Hamidah, Nur Nuraeni, Selvi Nurani Rahmawati, Dini Nurbaiti Nuris Fattahillah Nurul Faizah Siregar Nurullina Fajri Nuryani Rustaman Olsiara, Lairani Omay Sumarna Parlindungan Sinaga Pisca Hana Marsenda Puspita, Gita Nurul Puspitaningrum, Hardini Putra Habib Dhitareka Qamariah, Qamariah R. Riandi, R. Raden Ahmad Hadian Adhy Permana Raden Ahmad Hadian Adhy Permana* Rafifah, Rifa Ragadhita, Risti Rahayu Laelandi Rahman, Nor Farahwahidah Abdul Rahmania - Firda Rahmi, Nisrina Nur Regina P. Octavianda, Regina P. Retnowulan, Sri Rahayu Reyza Arief Taqwa, Muhammad Riandi Riandi Ridwan, Ridwan Ridyah, Surya Warni Rini Solihat Rosamsi, Saiman Rukmana, Putri Enizs Wahyu Saefudin Saefudin Safira Permata Dewi Salastri Rohiat, Salastri Sarah, Lia Laela Sasi Sabila Musakinah Ramadhany Sastra Mulya, Bunga Septina Carolina, Hifni Silaban, Oky Rizkiana Sinaga, Lastama Siswandari, Puti Siti Tahany Rifa Faidah Sri Maryanti Sri Maryanti Sri Redjeki Sri Redjeki Suci Siti Lathifah Sunarto Sura Supriyadi Supriyadi Supriyatin, Titin Sura, Sunarto Arif Syafigha, Annisa Syahfitri, Jayanti Sylva Sagita Titin Supriyatin Tohe, Ansar Tohe, Humairah Ansar Tony Hadibarata, Tony Topik Hidayat Umar, Mohammad Farhan Utari Akhir Gusti Virijai, Febrian Vivit Nurhikmah Havita Wahyu Rimbun Wahyu Sopandi Warliani, Resti Wawan Setiawan Weni Rahmadani Widi Purwianingsih Widyaningsih, Mia Wiji Wiji Winda - Yusefni Winny Liliawati Wulandari, Melyastuti Yasim, Sukmawati Yena Harmelayati Yeni Setyowati* Yuliani, Galuh