p-Index From 2021 - 2026
13.656
P-Index
This Author published in this journals
All Journal JPMS (Jurnal Pendidikan Matematika dan Sains) RADIASI: Jurnal Berkala Pendidikan Fisika Bioeducation Journal Jurnal Pengajaran MIPA EDUSAINS Tadris: Jurnal keguruan dan Ilmu Tarbiyah Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Education Online Techno: Jurnal Penelitian Prosiding KPSDA Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Vidya Karya Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan: Teori, Penelitian, dan Pengembangan Pedagogi Hayati Journal of Biology Education JPPPF (Jurnal Penelitian dan Pengembangan Pendidikan Fisika) Jurnal Pendidikan Biologi Jurnal Biodjati Jurnal Penelitian Pendidikan IPA (JPPIPA) PAEDAGOGIA Jurnal Bioedukatika BIOEDUKASI Momentum: Physics Education Journal Journal of Natural Science and Integration Assimilation: Indonesian Journal of Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Lectura : Jurnal Pendidikan Jurnal Tarbiyah : Jurnal Ilmiah Kependidikan Pedagonal : Jurnal Ilmiah Pendidikan JPBIO (Jurnal Pendidikan Biologi) Jurnal Biotek BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Pembelajaran Biologi : Kajian Biologi dan Pembelajarannya Jurnal Studi Guru dan Pembelajaran JURNAL PENDIDIKAN MIPA Jurnal Paedagogy Journal of Educational Chemistry (JEC) Journal of Innovation in Educational and Cultural Research Yumary: Jurnal Pengabdian kepada Masyarakat Journal of Tropical Chemistry Research and Education Proceeding Biology Education Conference Bioed : Jurnal Pendidikan Biologi Jurnal Kajian Pendidikan IPA ASEAN Journal of Science and Engineering Education (AJSEE) Jurnal Pendidikan Ilmu Pengetahuan Alam (JP-IPA) Jurnal Pijar MIPA JIFP (Jurnal Ilmu Fisika dan Pembelajarannya) JSEP (Journal of Science Education and Practice) Al Jahiz: Journal of Biology Education Research Journal of Educational Sciences Prosiding SNPBS (Seminar Nasional Pendidikan Biologi dan Saintek) Journal of Mathematics Science and Computer Education Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) Journal of Environment and Sustainability Education Jurnal Pengabdian Isola SEARCH: Science Education Research IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Unnes Science Education Journal Journal of Innovative Science Education U-Teach: Journal of Young Physics Education Teacher Jurnal Pendidikan MIPA JIPFRI (Jurnal Inovasi Pendidikan Fisika dan Riset Ilmiah) IJIS Edu : Indonesian Journal of Integrated Science Education Journal Of Biology Education Research (JBER) Indonesian Journal on Learning and Advanced Education (IJOLAE) Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Abmas
Claim Missing Document
Check
Articles

PENINGKATAN PROFESIONALISME GURU DAN KUALITAS PEMBELAJARAN BIOLOGI DI SEKOLAH MELALUI LESSON STUDY Sriyati, Siti
Jurnal Pengajaran MIPA Vol 8, No 1 (2006): JPMIPA: Volume 8, Issue 1, 2006
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v8i1.35367

Abstract

This research was done to investigate impact of lesson study in order to improve teachers professionalism and the quality of teaching learning process in Biology. Although lesson study has been conducted since the year of 2005 at numerous schools in Bandung, information on how far such activity does give impact to teacher as instructor and teacher as observer has not been uncovered. The research was undertaken by spreading questions to the instructor as well as the observer. Furthermore, quality of teaching learning process in the school was observed at SMP Lab. School and SMA Lab. School UPI. The research resulted in insight that through lesson study, teachers both served as instructor and observer can improve such competency as pedagogy, professional, personality, social as clearly indicated in “ UU Guru dan Dosen No. 14 Tahun 2005”. However, for those teachers as observers, competency of pedagogy has not been significantly explored. Both the instructors and observers have not entirely user their KBM (teaching learning process) to conduct PTK (classroom action research). In addition, the KBM conducted in lesson study can improve quality of teaching learning process in the classroom based upon good interaction between students and teachers as well as among students (in or out the groups) during discussion and percentage of students who actively learned. Through model teaching learning process developed in lesson study, students are trained to improve their ability in scientific work and to connect biology concept to its application in daily life using local materials.
BAGAIMANA IMPLEMENTASI PENELITIAN TINDAKAN KELAS DALAM AKTIFITAS LESSONS STUDY? Sriyati, Siti
Jurnal Pengajaran MIPA Vol 19, No 1 (2014): JPMIPA: Volume 19, Issue 1, 2014
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v19i1.36153

Abstract

ABSTRAKKesamaan istilah dalam tahap-tahap Penelitian Tindakan Kelas (PTK) yaitu Perencanaan, Pelaksanaan tindakan, Pengamatan dan Refleksi dengan tahap-tahap kegiatan dalam lesson study yaitu : Plan, Do dan See membuat orang yang belum begitu mengenal lesson study secara mendalam akan mempertanyakan hal ini. Samakan PTK yang lebih dikenal dengan Classroom Action Research (CAR) dengan Lesson Study? Apakah tujuan dari kedua kegiatan ini sama? Memang tujuan utama dari kedua kegiatan ini adalah sama yaitu meningkatkan mutu pembelajaran. Akan tetapi ada aspek lain yang membedakan PTK dan Lesson study yaitu Lesson study merupakan suatu strategi untuk meningkatkan profesionalisme guru melalui kegiatan belajar dari pembelajaran orang lain. Sebenarnya perbedaan prinsip antara PTK dan Lesson study adalah : PTK berbasis penelitian, sedangkan lesson study tidak selalu berbasis penelitian dan lesson study mempunyai cakupan yang lebih luas dari pada PTK, bahkan tidak hanya PTK yang dapat dilaksanakan dalam kegiatan lesson study, akan tetapi jenis penelitian lain juga bisa dilaksanakan dengan persiapan instrumen yang lebih terencana, agar mendapatkan data yang diharapkan. ABSTRACTSimilar term in CAR (Classroom Action Research) steps are planning, acting, observing and reflecting with an activity steps in lesson study are plan, do and see make people that don’t know much about lesson study will keep asking. Are the CAR and lesson study the same? Is the purpose of this two are the same? Although the main purpose of this two activities are the same that is to improve the quality of the teaching, but there’s another aspect that differentiate the CAR and lesson study. The lesson study is a strategy to improve professionalism of the teachers, through teaching activity from other people’s teaching. Actually the main difference between the CAR and lesson study is that CAR is research basis while the lesson study is not always research basis. The lesson study has more coverage than CAR. Even more is not only the CAR that can be done in lesson study but also other researchs are can be done with good planned instrument preparation to get the expected data.
PENGGUNAAN MULTIMEDIA PADA PEMBELAJARAN TEORI BOTANI PHANEROGAMAE DALAM UPAYA MENINGKATKAN HASIL BELAJAR MAHASISWA Sriyati, Siti
Jurnal Pengajaran MIPA Vol 4, No 1 (2003): JPMIPA: Volume 4, Issue 1, 2003
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v4i1.35620

Abstract

Penelitian ini bertujuan untuk meningkatkan hasil belajar mahasiswa pada mata kuliah teori Botani Phanerogamae dan memberikan alternatif lain pembelajaran teori Botani Phanerogamae sehingga lebih bervariasi. Hipotesis penelitian ini adalah: penggunaan multimedia pada pembelajaran teori Botani Phanerogamae dapat meningkatkan hasil belajar bila 75% mahasiswa memperoleh nilai di atas 60. Subjek penelitian adalah mahasiswa program studi Biologi angkatan 2003 yang sedang mengikuti mata kuliah Botani Phanerogamae. Metode penelitian yang digunakan adalah metode pra eksperimental dengan desain one shot case study. Instrumen penelitian yang digunakan adalah soal ujian akhir semester (UAS) yang terdiri dari soal-soal pilihan ganda yang melatih berpikir tingkat tinggi. Berdasarkan analisis uji z dengan kriteria belajar tuntas, ternyata penggunaan multimedia pada pembelajaran Botani Phanerogamae belum dapat meningkatkan hasil belajar mahasiswa, karena mahasiswa yang mendapat nilai di atas 60 kurang dari 75%. Tetapi apabila dilihat dari nilai rata-rata ujian tengah semester (UTS) sebelum diterapkan multimedia dan nilai rata-rata UAS, terjadi peningkatan hasil belajar yaitu dari 53,1 menjadi 62,7. Hal ini menunjukkan bahwa penggunaan multimedia meningkatkan hasil belajar mahasiswa walaupun belum memenuhi kriteria belajar tuntas.
PERANAN PEMBELAJARAN BERBASIS KERJA ILMIAH UNTUK MENINGKATKAN KPS SISWA PADA KONSEP EKOSISTEM MELALUI KEGIATAN “PILOTING” DI SMA Sriyati, Siti
Jurnal Pengajaran MIPA Vol 5, No 2 (2004): JPMIPA: Volume 5, Issue 2, 2004
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v5i2.35653

Abstract

Penelitian ini bertujuan untuk meningkatkan kemampuan keterampilan proses sains (KPS) siswa melalui pembelajaran berbasis kerja ilmiah pada konsep Ekosistem yang dilaksanakan pada kegiatan piloting di SMA. Kegiatan piloting adalah kegiatan kerjasama antara FPMIPA UPI dengan pihak JICA melalui  Project IMSTEP JICA yang bertujuan untuk meningkatkan kualitas pembelajaran MIPA di sekolah. Penelitian dilaksanakan di dua sekolah yang berlokasi di Kota Bandung dan Lembang masing-masing satu kelas. Metode penelitian yang digunakan adalah metode deskriptif. Adapun materi Ekosistem yang pilih pada penelitian ini terdiri dari materi Aksi Interaksi dan Pencemaran Air. Instrumen penelitian meliputi: lembar observasi kinerja siswa pada waktu praktikum, soal-soal KPS dan angket siswa. Hasil penelitian menunjukkan bahwa pada praktikum aksi interaksi dan pencemaran air kemampuan siswa dalam melaksanakan semua tahapan percobaan secara umum sudah baik, kelemahan masih terjadi pada kemampuan mengendalikan variabel penentu keberhasilan percobaan. Akan tetapi pada percobaan Pencemaran air kemampuan mengendalikan variabel ini mengalami peningkatan. Kemampuan KPS siswa secara umum menunjukkan perbedaan secara signifikan dari pretest ke posttest. Dari angket siswa diketahui bahwa telah terjadi perubahan metode guru mengajar dari yang biasa ceramah dan demonstrasi menjadi sering praktikum pada semester ini. Dan siswa merasa bahwa metode praktikum berpengaruh baik terhadap pemahaman konsep dan motivasi belajar siswa.
STUDENT’S PERCEPTION ABOUT ASSESSMENT RELATED WITH IMPLEMENTATION OF 2013 CURRICULUM Octavianda, Regina P.; Rustaman, Nuryani; Sriyati, Siti
Jurnal Pengajaran MIPA Vol 20, No 2 (2015): JPMIPA: Volume 20, Issue 2, 2015
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v20i2.36244

Abstract

ABSTRACTThe main focus of assessment is student, and how assessments are used will contribute to students’ perception. Students’ perception of assessment can be influenced by various types assessment, and Curriculum 2013 facilitate a variety of assessment for learning. Research about perception that involves 36 boys and 46 girls was conducted for identify students’ perception of assessment and the reconciliation with the demands of curriculum assessment in 2013. Data collected through the use of a questionnaire that was developed from perception indicators, i.e. reproducing knowledge, rehearsing, accountability, improving learning, problem solving, and critical judgement. This study placed improving learning perception in the first position and the rehearsing perception at the sixth position.About 85% of students consider that assessment can develop their knowledge, but only 52% of students consider that the assessment made them practice before the exam. Even though 2013 curriculum demands assessment which strongly supports six perceptions of students, in this study only few assessments criteria have been addressed. Research finding shows that only a few demands of the assessment has been completed. Therefore, high level of improving learning perception in this study is closely related to the reconciliation with the demands of Curriculum assessment in 2013 that involved types of assessments during the learning. ABSTRAKPengguna utama asesmen adalah siswa, dan penggunaan asesmen secara tidak langsung akan membentuk suatu persepsi. Persepsi siswa terhadap asesmen didukung oleh berbagai variasi asesmen, dan Kurikulum 2013 memfasilitasi penggunaan beragam asesmen dalam pembelajaran. Penelitian tentang persepsi ini melibatkan 36 siswa dan 46 siswi bertujuan untuk mengidentifikasi persepsi siswa terhadap asesmen dan kaitannya dengan tuntutan penilaian pada Kurikulum 2013. Data dikumpulkan melalui kuesioner yang telah dikembangkan dari indikator persepsi siswa yaitu reproducing knowledge, rehearsing, accountability, improving learning, dan critical judgment. Penelitian ini menempatkan improving learning pada posisi pertama dan rehearsing pada posisi terakhir. Sebanyak 85% siswa menyatakan bahwa asesmen dapat mengembangkan pengetahuan mereka, namun hanya 52% siswa yang sepakat bahwa asesmen membuatnya menjadi rajin berlatih sebelum menghadapi ujian. Walaupun tuntutan penilaian Kurikulum 2013 memfasilitasi keenam persepsi siswa terhadap asesmen, namun alam penelitian ini hanya beberapa jenis asesmen saja yang terlaksana. Hasil temuan membuktikan bahwa hanya beberapa tuntutan asesmen yang dilakukan. Oleh karena itu, tingginya persepsi improving learning dalam penelitian ini sangat dekat kaitannya dengan tuntutan penilaian pada Kurikulum 2013 yang digunakan selama pembelajaran.
KONTRIBUSI ASESMEN FORMATIF TERHADAP HABITS OF MIND MAHASISWA BIOLOGI Sriyati, Siti; Rustaman, Nuryani Y.; Zainul, Asmawi
Jurnal Pengajaran MIPA Vol 15, No 2 (2010): JPMIPA: Volume 15, Issue 2, 2010
Publisher : Faculty of Mathematics and Science Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.18269/jpmipa.v15i2.35996

Abstract

Study about formative assessment contribution to habits of mind of the Biology students purposes to describe weather there is a formative assessment contribution (feedback, self assessment and peer assessment) to the forming of student habits of mind. The research was carried out in Biology Education Departement to students who took Botany Phanerogamae instruction on 2009/2010. Many of formative assessment strategies were applied on theory and practical study, such as group presentation task, concept diagram, to observe practical and presentation activity, drawing book task and practical report. And some of the instrument used on this study were habits of mind tracing questionnaire, work observation sheet on the theoty and practical study, concept diagram, task and rubric for drawing book task, practical report and student questionnaire. The result of the research shows that there is an contribution of formative assessment to the habits of mind, with medium classified with the R value of 0,654. While determination coefficient value is 0.372 which means that 37.2% variation of habits of mind was influenced by formative assessment. Through the path analysis know that the direct influence on feedback, self assessment and peer assessment to habits of mind is 16,7%, 11.1% and 2.6%.
The Aanalysis of Students’ Reasoning Ability in Palembang Dewi, Safira Permata; Rustaman, Nuryani; Sriyati, Siti
Journal of Biology Education Vol 6 No 3 (2017)
Publisher : FMIPA UNNES

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/jbe.v6i3.17021

Abstract

This study aims to get a picture of class VIII students' reasoning in an A accredited school in Palembang City through method of survey. A number (n = 151) of grade VIII students came from four schools. TIMSS Biology Problems used are a matter of reasoning type both in the form of multiple choice and constructive response. The results showed that the reasoning of the students of class VIII had a good performance and showed normal distribution. The achievement of students in solving the problem of multiple choice is better than the matter of constructive response. Students find it difficult to solve a demanding problem for designing an experiment. The results of this research can be used in order to train students to develop the skills of deployment and improvement of quality of Biology learning process in school. Keyword: Reasoning, TIMSS 2011, Palembang City
Penerapan representasi visual menggunakan komik sebagai upaya meningkatkan kemampuan berpikir kritis dan penguasaan konsep siswa pada materi sistem saraf Rahmi, Nisrina Nur; Purwianingsih, Widi; Sriyati, Siti
Assimilation: Indonesian Journal of Biology Education Vol 4, No 2 (2021): September 2021
Publisher : Department of Biology Education, Universitas Pendidikan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17509/aijbe.v4i2.41484

Abstract

The purposes of this research were to analyze the application of visual representations using comics as an effort to improve student’s critical thinking skills and mastery of concepts in nervous system material. The subject of this study is second grade-students in Senior High School. The method used in this research is Quasi experimental. The results of student’s critical thinking skills have increased higher in the experimental class, although the results of the critical thinking skills of the two classes are in the moderate category, the results of critical thinking in the experimental class showed that the increase in N-Gain was higher with N-Gain = 0.64 (medium category) while N-Gain in the control class = 0.53 (medium category). The results mastery of concepts in experimental class have n-gain is higher the n-gain control class with n-gain is 0.71 (high category), and the control class n-gain is 0.53 (medium category). The results of student responses showed that the majority of students were interested in using comic visual representations of 83.33%. Therefore it can be concluded that the use of comics can improve thinking skills and mastery of concepts better.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
PEMBELAJARAN IPA TERPADU MENGGUNAKAN PENDEKATAN SCIENCE WRITING HEURISTIC UNTUK MENINGKATKAN KEMAMPUAN KOMUNIKASI TULISAN SISWA SMP Winda - Yusefni; Siti Sriyati
EDUSAINS Vol 8, No 1 (2016): Edusains
Publisher : Faculty of Education and Teacher Training, UIN (State Islamic University) Syarif Hidayatul

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (499.848 KB) | DOI: 10.15408/es.v8i1.1562

Abstract

Abstract This study investigated the effect of integrated science learning using Science Writing Heuristic (SWH) approach to enhance students’ ability in written communication. Participated by 46 students of grade 8 of a junior high school in West Sumatra whose purposively sampled, the study used a quasi-experiment with static group pretest-posttest design. Data were gathered from written communication test developed for pretest and posttes. The result of data analysis showed that there were significant effect of implementing the integrated science learning using SWH approach in enhancing the ability of students’ written communication. The mean gain of experimental group is 0,8, which is higher than the control group (0,6). Abstrak Penelitian ini menyelidiki pengaruh pembelajaran IPA terpadu menggunakan pendekatam Science Writing Heuristic (SWH) untuk meningkatkan kemampuan komunikasi tulisan siswa. Penelitian dilakukan pada 46 siswa kelas VIII salah satu SMPN di Sumatera Barat yang dipilih dengan teknik purposive, metode yang digunakan dalam penelitian ini adalah kuasi eksperimen dengan desain nonequivalent pretest and posttest control group design. Data didapatkan dari tes kemampuan komunikasi tulisan yang dikembangkan untuk pretes dan postes. Hasil analaisis data menunjukkan bahwa terdapat pengaruh yang signifikan dari penerapan pembelajaran IPA terpadu menggunakan pendekatan SWH berpengaruh dalam meningkatkan kemampuan komunikasi tulisan siswa. Rata-rata n-gain yang dimiliki kelas eksperimen 0,8, yang lebih tinggi dibandingkan kelas kontrol (0,6). Permalink/DOI: http://dx.doi.org/10.15408/es.v8i1.1562
Co-Authors Achmad Samsudin Adi Rahmat Adnan Muchsin Agus Kamaludin, Agus Agustin, Rika Rafika Ahmad Aminudin Aidil Adhani Aldeva Ilhami Allyany Hasyaty Almira Ivana Almubarak, Almubarak Amalia Pratiwie Ananda, Gheri Febri Anderias Henukh Aprilita Ekasari Ari Widodo Ari Widodo Ari Widodo Ari Widodo Ari Widodo Arifin Ahmad Arizaldy, Arizaldy Asmawi Zainul Atiqah Ulya Hayandi Azizah, Cici Nur Baifeto, Ekri Pranata Ferdinand Bariroh, Ghurrotul Ciptro Handrianto, Ciptro Dede Trie Kurniawan Denia Dwi Citra Resmi Devi, Cindy Rantika Diah - Kusumawaty Dian Amirulloh Diana Rochintaniawati Didik Priyandoko Didik Pryandoko Dini Riyani Eka Cahya Prima Ekasari, Aprilita Elah Nurlaelah Eliyawati Eliyawati Fadilah, Solikhah Isti Faidah, Siti Tahany Rifa Fajri, Nurullina Febblina Daryanes Findi Septiani Fitriyah, Firanita Fuadiyah, Sadiatul Gusti, Utari Akhir Harmelayati, Yena Harry Firman Harry Firman Hasni Hasni Havita, Vivit Nurhikmah Hermansyah Hermansyah Hermansyah Hermansyah HERNANI - Ida Hamidah Ida Hamidah Ida Kaniawati Ida Kaniwati Ida Yayu Nurul Hizqiyah Ida Yayu Nurul Hizqiyah Ilham Nur Iman Maulana Ilhami, Aldeva Irawan*, Peri Irawan, Tb Moh Irma Ari Irvani, Asep Irvan Ismail Ismail Isnawati Isnawati Jacinda, Alma Aliya Kadek Sera Harlistya Udayani Kasi, Yohanes F Kumalasari, Lita Laelandi, Rahayu Lathifah, Suci Siti Latifah, Suci Siti Laurina Sinurat Lembang, Angela Meirici Lia Lutianasari Lia Lutianasari Lilis Sulistiawati Lilit Rusyati Lulu Desia Mutiani Rahmayuni Mellyzar, Mellyzar Melta, Defrian Misbah Misbah Mr Amprasto Mr Sjaeful Anwar Mrs Yanti Hamdiyati Mu'aziyah, Siti Eneng Sururiyatul Mukhyati Mukhyati, Mukhyati Nabuasa, Desi Aryanti Nahadi Nahadi , Nahadi Nanang Winarno Ninda Eka Ratanasabilla Nur Hamidah Nur Hamidah, Nur Nuraeni, Selvi Nurani Rahmawati, Dini Nurbaiti Nuris Fattahillah Nurul Faizah Siregar Nuryani Rustaman Olsiara, Lairani Parlindungan Sinaga Pisca Hana Marsenda Puspita, Gita Nurul Puspitaningrum, Hardini Putra Habib Dhitareka Qamariah, Qamariah R. Riandi, R. Raden Ahmad Hadian Adhy Permana Raden Ahmad Hadian Adhy Permana* Ragadhita, Risti Rahayu Laelandi Rahman, Nor Farahwahidah Abdul Rahmania - Firda Rahmi, Nisrina Nur Regina P. Octavianda, Regina P. Resmi, Denia Dwi Citra Retnowulan, Sri Rahayu Reyza Arief Taqwa, Muhammad Riandi Riandi Ridwan, Ridwan Ridyah, Surya Warni Rika Rafikah Agustin Rini Solihat Rosamsi, Saiman Rukmana, Putri Enizs Wahyu Safira Permata Dewi Salastri Rohiat, Salastri Sarah, Lia Laela Sasi Sabila Musakinah Ramadhany Sastra Mulya, Bunga Septina Carolina, Hifni Silaban, Oky Rizkiana Sinaga, Lastama Siregar, Najihah Fakhirah Siswandari, Puti Sri Maryanti Sri Maryanti Sri Redjeki Sri Redjeki Supriyadi Supriyadi Supriyatin, Titin Sura, Sunarto Arif Syafigha, Annisa Syahfitri, Jayanti Sylva Sagita Titin Supriyatin Tohe, Ansar Tohe, Humairah Ansar Tony Hadibarata, Tony Topik Hidayat Umar, Mohammad Farhan Utari Akhir Gusti Virijai, Febrian Vivit Nurhikmah Havita Wahyu Rimbun Wahyu Sopandi Warliani, Resti Wawan Setiawan Weni Rahmadani Widi Purwianingsih Widyaningsih, Mia Wiji Wiji Winda - Yusefni Winny Liliawati Wulandari, Melyastuti Yasim, Sukmawati Yeni Setyowati* Yuliani, Galuh