Claim Missing Document
Check
Articles

Botulismus pada Manusia (BOTULISM IN HUMAN) I Wayan Suardana
Jurnal Veteriner Vol 2 No 1 (2001)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5379.061 KB)

Abstract

Botulismus pada Manusia   (BOTULISM IN HUMAN)
Studi Epidemiologi Agen Zoonosis Escherichia coli O157:H7 melalui Analisis Random Amplification of Polymorphic DNA (RAPD) I Wayan Suardana; Wayan Tunas Artama; Widya Asmara; Budi Setiadi Daryono
Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (264.692 KB)

Abstract

Epidemiological studies of zoonotic agent Escherichia coli O157:H7 have been analyzed pheneticallyand or phylogenetically. In a phenetic classification, micoorganisms are arranged into groups (phena) onthe basis of high overall similarity using both phenotypic and genotypic methods without judgementaspect of its ancestry or evolutionary. Due to its importance to epidemiological aspect, the study of geneticvariation of isolates origin from some sources need to be conducted in order to trace the routes of infection.A total of 20 samples obtained from some sources i.e clinically human feces, non-clinically human feces,cattle feces, chicken feces, and beef feces were used in this study. The study was started by confirming allof the isolates using O157 latex agglutination test and H7 antiserum test, followed by genomic DNAanalysis by random amplification of polymorphic DNA /RAPD methods. RAPD results were analyzed using a simple matching coeficient (Ssm) and alogorhythm unweighted pair group method using arithmeticaverages (UPGMA) programe. Results showed there were range of genetic DNA from local isolates (75.1–99,6%) which was almost similar to ATCC 43894 control isolate. The highest similarity (99.6%) to ATCC43894 control was showed by SM-7(1) isolate obtained from cattle fecal and KL-68(1), isolate obtainedfrom clinically human fecal. In addition, KL-52(7) obtained from clinically human fecal had high similarity(99.6%) to MK-35 isolate obtained from chicken fecal. On the other hand, DS-21(4) and DS-16(2) isolatesthat were obtained from beef had high similarity (84.9%) to other isolates including ATCC 43894 controlisolate. The highest similarity of E. coli O157:H7 isolates that were obtained from cattle feces, beef, andchicken feces to human feces isolate indicated that there were both cattle and chicken were potentialreservoirs of the zoonotic agen which can be transmitted to human.
Faktor-faktor Risiko Penyebaran Escherichia coli O157:H7 pada Sapi Bali di Kuta Selatan, Badung, Bali (RISK FACTORS FOR DISSEMINATION OF ESCHERICHIA COLI O157:H7 IN BALIN CATTLE IN SOUTH KUTA, BADUNG, BALI) Korbinianus Feribertus Rinca; Tjokorda Sari Nindhia; I Wayan Suardana
Jurnal Veteriner Vol 17 No 3 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (141.911 KB)

Abstract

Escherichia coli O157:H7 is a strain of E.coli which has ability to produce toxin known as shiga-liketoxin. Shiga like toxin can cause colitis haemorrhagic and hemolytic uremic syndrome in human. However,in calves, it can cause diarrhea, while in adult cattle can be career. Cattle are primary reservoir of E. coliO157:H7. Study of dissemination pattern of E.coli O157:H7 was carried out using 60 samples of cattlefeces. This is a cross sectional study and samples were collected using purposive sampling technique.Based on statistic calculation using chi-square and Odds ratio tests, it was found some risk factorsaffected the dissemination of E.coli O157:H7 infection in South Kuta District, Badung, Bali. Some of thosewere the altitude of sea level that showed the cattle which were maintained in highland showed more riskthan cattle that was in the lowland, with odds ratio value 1.12. The management animal husbandryshowed cattle that maintained in captive management were in higher risk than cattle that was notmanaged in captive system, with odds ratio value 2.50. The type of captive floor, which made from cementwas higher risk than cattle that was raised in captive floor which were made from non cement with oddsratio value 6.22. The chi-square test result did not show a significant difference to the dissemination of E.coli O157:H7 in the South Kuta-district.
ISOLASI DAN IDENTIFIKASI ESCHERICHIA COLI O157:H7 PADA DAGING SAPI DI KABUPATEN BADUNG PROVINSI BALI. ISOLATION AND IDENTIFICATION ESCHERICHIA COLI O157:H7 ON BEEF AT BADUNG REGENCY PROVINCE OF BALI I Wayan Suardana; Bambang Sumiarto; Denny Widaya Lukman
Jurnal Veteriner Vol 8 No 1 (2007)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Keamanan bahan pangan merupakan masalah yang amat penting bagi konsumen dan industri pangan. Cemaran bakteri Escherichia coli dan Coliform dianggap sebagai indikator sanitasi dalam proses pengolahan bahan pangan. Pelacakan bakteri patogen dalam pangan juga telah dilakukan secara rutin, termasuk yang bersifat zoonosis seperti Escherichia coli O157:H7. Bakteri ini menghasilkan toksin yang dikenal dengan Shiga toxin. Toksin ini dapat menimbulkan diare berdarah, colitis haemorrhagi dan hemolytic uremic syndrome (HUS) pada manusia. Dalam penelitian ini dipelajari hubungan antara tingkat cemaran dan insidensi Coliform, E.coli, E.coli O157 dan E.coli O157:H7 pada daging sapi. Bakteri pertama ditumbuhkan pada media EMBA, selanjutnya dipupuk pada media SMAC dan diakhiri dengan uji aglutinasi lateks untuk memastikan keberadaan bakteri E.coli O157 dan uji antiserum H7 untuk memastikan isolat yang diisolasi merupakan isolat E.coli O157:H7. Hasil isolasi dan identifikasi terhadap 89 sampel daging sapi diperoleh hasil rata-rata tingkat cemran coliform dan E.coli sebesar 93,01+ 2,64x103 cfu/g dan
An Amino Acids on Bali Cattle and Wagyu Beef Based on Different Function of Muscle (ASAM-ASAM AMINO SAPI BALI DAN DAGING SAPI WAGYU BERDASARKAN FUNGSI OTOT YANG BERBEDA) I Nengah Kerta Besung; Rasdianah Rasdianah; I Wayan Suardana; Ni Ketut Suwiti
Jurnal Veteriner Vol 20 No 2 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (70.077 KB) | DOI: 10.19087/jveteriner.2019.20.2.228

Abstract

Beef is an essential source of protein and several functional compounds that are very important for human. The quality of beef depends on both genetic and environmental factors like feed, age, sex, and others. This research aimed to determine the composition of amino acids both Bali and Wagyu beef on the different activity of muscle, i.e. active and passive. As many as 5 g of each sample was used in this study. The active beef samples were presented by Biceps femoris, and passive beef samples were presented by Longissimus dorsi. High-Performance Liquid Chromatography (HPLC) method was used in order to an identification of amino acids according to the standard procedure. Results of the study showed that the essential amino acids content both bali cattle and wagyu were higher than non-essential, and amino acids content originated from active muscle was higher than passive muscle. Methionine, phenylalanine, and serine on bali beef cattle were lower than wagyu beef. Overall, the content of amino acids essential was lower than non-essential. In conclusion, there is no significant difference of amino acids content both bali cattle and wagyu beef, but the function of muscle (active or passive) were known contribute to the difference of amino acids content.
Isolasi dan Identifikasi Spesies Bakteri Asam Laktat Penghasil Senyawa Antimikrob Asal Kolon Sapi Bali (ISOLATION AND IDENTIFICATION OF LACTIC ACID BACTERIA SPECIES PRODUCING ANTI-MICROBIAL SUBSTANCE ISOLATED FROM COLON OF BALI CATTLE) Sri Anggreni Lindawati; I Wayan Suardana
Jurnal Veteriner Vol 17 No 4 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (104.756 KB)

Abstract

Bali cattle as one of the local cattle are known have uniquely genetic characteristics. They are easy toadapt at a less favorable environment, so that they are known as a pioneer cattle. According to theiruniquely, it may allow for the discovery of specific types of acid lactic bacteria compared with others. Thishypothesis is based on the assumption that the types of bacteria as a normal flora in the intestine tract ofcattle are highly dependent on several factors, and one of which is a feed factor. Based on the abovebackground, this study was conducted. The aim of study was to isolate and identify of a specific species oflactic acid bacteria that has anti-microbial substances. The study began by isolation of acid lacticbacteria originated from 20 fecal samples of colon of bali cattle through the growth on selective medium i.e.deMann, Rogosa, Sharpe (MRS) medium followed by Gram staining and catalase test. The screening ofantimicrobial activity of each isolate was performed by culturing of isolates again indicator bacterial on blood agar medium. The selected isolates were continuously tested on medium contains 15% NaCl ,medium with ph 9.6, and medium with temperature 10°C, respectively in order to identification genus ofbacteria. The final stage of identification in order to know the specific isolate, which has antimicrobialsubstances, was confirmated by using the API 50 CHL kit. The results of study showed that one of theisolates that known have widely antimicrobial activities was isolate with 3A code. This isolate hasinhibitory zone to indicator bacterial i.e. Staphylococcus aureus ATCC 29213 and Escherichia coli ATCC25922. This isolate is known as Lactococcus lactis ssp lactis 1 with its similarity value 65.7%. This isolateis potentially to continuously study in order to know the potency of isolate as a probiotic candidate and oras a food preservative.
Sekuen Nukleotida Gene Shiga like toxin-2 dari Isolat Lokal Escherichia coli O157:H7 asal Hewan dan Manusia (NUCLEOTIDES SQUENCES OF SHIGA-LIKE TOXIN 2 GENES OF ESCHERICHIA COLI O157:H7 LOCAL ISOLATES ORIGINATED FROM ANIMALS AND HUMAN) I Wayan Suardana; Dyah Ayu Widiasih; Komang Januartha Putra Pinatih
Jurnal Veteriner Vol 18 No 1 (2017)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (364.77 KB) | DOI: 10.19087/jveteriner.2017.18.1.83

Abstract

Animals/livestock, especially cattle, are known as the main reservoir of Escherichia coli O157: H7. As the only one of zoonotic E. coli, the pathogenicity of these bacteria is determined by its ability to produce one or more very potent cytotoxin known as Shiga-like toxin (Stx) or verocytotoxin, particularly of the Stx2 type that is closely related to the incidence of hemolytic uremic syndrome (HUS) in humans. This study analyzed the nucleotide sequences of stx2 gene between isolates from animals and humans in an effort to assess the potential zoonoses of the agent. The research activity was initiated by cultivating 20 isolates of E. coli O157:H7 collection based on result in the previous study i.e. 2 isolates originated from cattle feces, 2 isolates originated from beef, 2 isolates originated from chicken feces, 2 isolates originated from human feces, and 12 non-clinical isolates originated from human fecal who were suffering with renal failure. All isolates were confirmed on selective medium Sorbitol MacConkey Agar (SMAC) followed by testing on aglutination O157 latex test, and H7 antisera. Molecular analysis of stx2 gene covering open reading frame (ORF) of the stx2 gene was performed using the primer which was designed by researcher i.e. Stx2 (F)/Stx2 (R). The results showed, there were 2 isolates i.e. KL-48 (2) originated from human feces and SM-25 (1) originated from cattle feces were positive for carrying a stx2 gene, which was marked by the 1587 bp PCR product. Analysis of sequencing showed both isolates had identical to stx2 nucleotide squences with E. phaga 933 as well as E. coli ATCC 933. These results indicate the both local isolates are potential as zoonotic agents with clinical effects similar to E. phaga 933 and E. coli ATCC 43894. ABSTRAK Hewan ternak khususnya sapi, dikenal sebagai reservoir utama Escherichia coli O157:H7. Sebagai satu-satunya serotipe E. coli yang bersifat zoonosis, patogenitas bakteri ini ditentukan oleh kemampuannya untuk menghasilkan satu atau lebih cytotoxin yang sangat potensial yang dikenal dengan nama Shiga-like toxin (Stx) atau verocytotoxin, khususnya dari jenis Stx2 yang terkait erat dengan kejadian hemolytic uremic syndrome (HUS) pada manusia. Studi ini bertujuan menganalisis susunan nukleotida dari gen stx2 antara isolat asal hewan dan manusia dalam upaya mengkaji potensi zoonosis yang ditimbulkannya. Kegiatan penelitian diawali dengan kultivasi 20 isolat E. coli O157:H7 koleksi hasil penelitian sebelumnya dengan rincian dua isolat asal tinja sapi, dua isolat asal daging sapi, dua isolat asal tinja ayam, dua isolat asal tinja manusia non-klinis, dan 12 isolat asal tinja manusia klinis (asal penderita gagal ginjal). Isolat sebanyak 20 tersebut dikonfirmasi pada media selektif sorbitol MacConkey agar (SMAC) yang dilanjutkan dengan uji latex O157 aglutination test serta uji antiserum H7. Analisis molekuler komplit gen stx2 yang meliputi open reading frame (ORF) dari gen stx2 dilakukan menggunakan primer rancangan peneliti yaitu Stx2(F)/Stx2(R). Hasil penelitian menunjukkan bahwa ada dua isolat yaitu KL-48 (2) asal tinja manusia dan SM-25 (1) asal tinja sapi positif membawa gene stx2 yang ditandai dengan produk PCR 1587 bp. Analisis hasil sekuensing menunjukkan kedua isolat memiliki susunan gene stx2 yang identik dengan E. phaga 933 dan E. coli ATCC 43894. Hasil ini mengindikasikan kedua isolat lokal berpotensi sebagai agen zoonosis dengan efek klinis yang serupa dengan E. phaga 933 dan E. coli ATCC 43894.
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
Deteksi Produksi Toksin Stx-1 dan Stx-2 dari Escherichia coli O157:H7 Isolat Lokal Hasil Isolasi Feses dan Daging Sapi I Wayan Suardana; I Gusti Made Krisna Erawan; Bambang Sumiarto; Denny Widaya Lukman
Jurnal Veteriner Vol 10 No 4 (2009)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (116.501 KB)

Abstract

Shiga toxin produced by Escherichia coli O157:H7 can cause outbreaks and sporadic cases of serioushuman diseases. The diseases are indicated by hemorrhagic colitis and hemolytic uremic syndrome. Meatand meat products have been identified as vehicles of food borne disease caused by E.coli O157:H7. Themain aim of this research was to identify the correlation between the level of E.coli O157:H7 contaminationand the presence of Shiga toxin (Stx1 and Stx2) by applying method of Vero toxin Escherichia coli-ReversePassive Agglutination Test (VTEC-RPLA). The results showed that 3 of 7 isolates and 1 of 4 isolatesisolated from feces of cattle and beef, respectively produced Stx 1 (VT1). In the detection of Stx 2 (VT2), 4of 7 isolates and 1 of 4 isolates, isolated from the same samples were found to produce this toxin.According to all isolates, in this research showed, 1 isolate was found to produce VT2, 4 isolates to produceboth VT1 and VT2, while 6 isolates showed negative results either to VT1 or VT2.
IndonesiaDeteksi Escherichia coli O157 pada air minum di Kelurahan Sekaran Gunungpati Semarang Devi Dwi Jayanti; R Susanti; Ari Yuniastuti; I Wayan Suardana
Jurnal Biologi Udayana Vol 24 No 2 (2020): JURNAL BIOLOGI UDAYANA
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24843/JBIOUNUD.2020.v24.i02.p01

Abstract

Penelitian bertujuan untuk mendeteksi adanya bakteri Escherichia coli O157 pada air minum kemasan, air minum isi ulang, dan air sumur di Kelurahan Sekaran Gunungpati Semarang. Sampel yang diambil sebanyak 20 sampel yang terdiri atas 4 merk air minum kemasan, 8 sampel air minum isi ulang, dan 8 sampel air sumur. Penelitian diawali dengan tahap isolasi E.coli pada medium Eosin Methylen Blue Agar (EMBA), yang dilanjutkan ke medium Sorbitol MacConkey Agar (SMAC) untuk identifikasi E.coli O157 dilanjutkan uji lateks aglutinasi (OXOID) dan diakhiri dengan uji konfirmasi gen rfbE menggunakan teknik Polymerase Chain Reaction (PCR). Hasil penelitian menunjukkan 8 sampel yang positif E.coli pada medium SMAC menunjukkan positif E.coli O157 (colorless). Uji lateks aglutinasi juga menunjukkan 8 sampel positif E.coli O157 seperti kontrol ATCC 43894. E.coli ATCC 43894 dan 8 sampel E.coli dari berbagai air minum di Kelurahan Sekaran Gunungpati Semarang menunjukkan positif E.coli O157.
Co-Authors Abdul Manan Achjar, Komang Ayu Henny Adirinata, I Komang Pasek Agus Sri Lestari Amrulloh, Muhammad Faqih Anak Agung Gde Bagus Udayana Anderson Ngelambong Andi Isma Lestari Amin, Andi Isma Anom Hery Suasapha Ardika, I Gusti Ngurah Putu Ari Yuniastuti Aribaten, Ni Nengah Zinnia Arimbawa, I Gede Artayani, Ida Ayu Gede Asyauqi Ilham Perdana, Asyauqi Ilham Aungsuroch, Yupin Bambang Sumiarto Bangun Mulia, Victor Bq Nurlita Anugrah BUDI SETIADI DARYONO Budi Setiadi Dayono Chandra Yowani D. A. Widiasih Denny Widaya Lukman Devi Dwi Jayanti Dewa Gede Agung Widyadnyana Dewa Putu Oka Prasiasa Dewi, Ni Nyoman Astika Dewi, Ni Putu Diah Trisna Dewintasari, Ni Nyoman Paramitha Dwi Lestari Dyah Ayu Widiasih Dyah Ayu Widiasih Dyah Ayu Widiasih Eka Putri Suryantari Emmanuella Felice’anna Dije Karisoh Febri Diana Putri, Ni Putu Febrianti, Andri Nurdiana Franciska, Juliana Gama, I Ketut Gama, Ketut Gede Ngurah, I Gusti Ketut Gejir, I Nyoman Gusti Ayu Marhaeni Hana Kristal Alamanda Septiara Harini, I Gusti Ayu Hartati, Ni Nyoman Henny Achjar, Komang Ayu Hikam, Ahdan Sayid I Dewa Made Sukrama I G. Wijana I Gusti Agung Ayu Suartini I Gusti Made Krisna Erawan I Gusti Putu Bagus Sasrawan Mananda I Ketut Adi Sugita I Ketut Mangku Budiasa I Ketut Muka I Ketut Suada I Ketut Suardana I Ketut Suatha I Komang Gede Wiryawan I Made Adikampana, I Made I Made Kardena I Made Mertanadi I Made Sukada I Made Sukarja I Made Walesa Putra I Nengah Kerta Besung I Nengah Sujaya I Nengah Wirakesuma, I Nengah I Nyoman Ariana I Nyoman Suarsana I Nyoman Sudiarta I Nyoman Sukma Arida I Nyoman Sunarta I Nyoman, suardina I Putu Sampurna I Putu Sudiarta I Wayan Adnyana I Wayan Mustika I Wayan Seriyoga Parta I. H. U Utama Ida Bagus Ngurah Swacita Iga Prassetyo Adji, Iga Prassetyo Ignatius Cahyanto INDAYATI LANYA Iwan Harjono Utama Karuni, Ni Kadek Khamid Yusuf Baehaqi, Khamid Yusuf Komang Januartha Putra Pinatih Kondra, I Wayan Korbinianus Feribertus Rinca Kumalasari, Ni Putu Putri Kusumajaya, Anak Agung Ngurah Laba, I Nyoman MAS DJOKO RUDYANTO Meitisrilatifatulain Fitriadewi Mariana Michael Haryadi Wibowo Mita Ekamelinda Mochamad Choirul Hadi Ngurah, I Gusti Ketut Gede Ngurah, IGK Gede Ni Kadek Ari Divania Widia Artha Ni Kadek Lyming Lestari Ni Ketut Suwiti Ni Luh Sustiawati Ni Luh Watiniasih Ni Made Ayu Aryati Dinarini Ni Made Inna Dariwardani Ni Made Ruastiti Ni Putu Ratna Sari Nur Habibah Nuria Fitrianti Putri Nyoman Dewi Pebryani NYOMAN SEMADI ANTARA Oktivia Chandra Mustika, Oktivia Chandra P. Sampurna Padmi, Luh Sri Anggayoni Julia Pitriyantini, Putu Eka Prabhadewi, Ni Putu Sriarta Pramesti, Kadek Diah Pratiwi, Ida Ayu Windhari Kusuma Putra, I Kadek Aldi Margareta Perdana Putu Agus Wikanatha Sagita Putu Ayu Sisyawati Putriningsih Putu Cahaya Semesta Putu Januari Ratna Apsari Putri Putu Sucita Yanthy R Susanti Raharjo, Anis Rahmasari, Ni Nyoman Putri Asri Rasdianah Rasdianah Remawa, Anak Agung Gede Rai Reny Navtalia Sinlae Rian Ka Praja Ribek, Nyoman Richard Christian Daud Ruspawan, Dewa Made Ruta, I Made Satriawati, Ni Nyoman Ayu Sipahutar, Ida Erni Siti Helmyati Sri Anggreni Lindawati Sri Wahyuni Suarya Putra, I Nyoman Agus Sudiantara, I Ketut Sudiantara, Ketut Suharsono, Hamong Sukoco, Hendro Sulisnadewi, Ni Luh Kompyang Sunatha Putra, Agus Surasak Jamnongsarn, Surasak Surya, I Kadek Adi Syamsul Alam Paturusi Tjokorda Sari Nindhia Totton, Mary Louise Victor Bangun Mulia Wahyu Hananto, Wahyu Wayan Tunas Artama Wayan Tunas Artama Wedri, Ni Made Widya Asmara Wilantari, Ni Nyoman Ayu Wulandari, Andi Dewi Wulandari, Kadek Dina Yan Ramona Yohanes Kristianto Yuli Darmawan, Yuli Yunita Sri Hastuti, Yunita Sri