Article Per Year (5 Year)
p-Index From 2020 - 2025
7.955
P-Index
This Author published in this journals
All Journal IJCCS (Indonesian Journal of Computing and Cybernetics Systems) Journal of Tropical Life Science : International Journal of Theoretical, Experimental, and Applied Life Sciences JUSIFO : Jurnal Sistem Informasi JURNAL KEPEMIMPINAN DAN PENGURUSAN SEKOLAH Sistemasi: Jurnal Sistem Informasi Jurnal Ilmiah Ekonomi Islam AKSIOLOGIYA : Jurnal Pengabdian Kepada Masyarakat Jurnal Moral Kemasyarakatan INOVTEK Polbeng - Seri Informatika Jurnal Biologi Tropis INTECOMS: Journal of Information Technology and Computer Science Al Mi’yar: Jurnal Ilmiah Pembelajaran Bahasa Arab dan Kebahasaaraban Studi Arab Jurnal Ilmiah Ecosystem JIPI (Jurnal Ilmiah Penelitian dan Pembelajaran Informatika) JOISIE (Journal Of Information Systems And Informatics Engineering) EDUMATIC: Jurnal Pendidikan Informatika Building of Informatics, Technology and Science Jurnal Sistem informasi dan informatika (SIMIKA) Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat Thariqah Ilmiah ; Jurnal ilmu-ilmu kependidikan & Bahasa Arab Jurnal Pengabdian kepada Masyarakat Nusantara ASANKA: Journal of Social Science And Education Jurnal Teknik Informatika (JUTIF) Al-tsaman : Jurnal Ekonomi dan Keuangan Islam Jurnal Pendidikan dan Teknologi Indonesia Jurnal Pendidikan PKn Journal Evaluation in Education (JEE) Jurnal Al-Fawa'id : Jurnal Agama dan Bahasa Jurnal Kapita Selekta Administrasi Publik Edu Sociata : Jurnal Pendidikan Sosiologi Jurnal Algoritma Maritime Park: Journal Of Maritime Technology and Socienty Aurelia: Jurnal Penelitian dan Pengabdian Masyarakat Indonesia Finger : Jurnal Ilmiah Teknologi Pendidikan De Cive : Jurnal Penelitian Pendidikan Pancasila dan Kewarganegaraan Jurnal Pembelajaran Bahasa dan Sastra Economics Studies and Banking Journal Rhizome: Jurnal Kajian Ilmu Humaniora Journal of Economic Growth and Development Review Society CARONG: Jurnal Pendidikan, Sosial dan Humaniora SCIENTIA JOURNAL : Jurnal Ilmiah Mahasiswa Journal of Supply Chain and Entrepreneurship EL-HAYAH
Syaifullah Syaifullah
Jurusan Sistem Informasi Fakultas Sains Dan Teknologi Universitas Islam Negeri Sultan Syarif Kasim Riau
Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Mechanical Engineering Social Sciences Other

Published : 69 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 69 Documents
Search

 3   4   5   6   7 
Optimalisasi Penguasaan Mufradāt Bahasa Arab Melalui Voice Method dan Drill pada Siswa Madrasah Tsanawiyyah Dar al-Taqwā 1 Pasuruan Junaihil, Junaihil; Syaifullah, Syaifullah; Hasyim, Mochamad
Jurnal Al-Fawa'id : Jurnal Agama dan Bahasa Vol 15 No 2 (2025): September
Publisher : STAI Ali bin Abi Thalib Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.54214/alfawaid.Vol15.Iss2.862

Abstract

This study aims to examine the effectiveness of applying the voice method and drill in improving students’ mastery of Arabic vocabulary. The research employed a quantitative approach with a pre-experimental design using a one-group pretest–posttest model. Data were collected through a pretest, treatment, and posttest. The background of this study is based on the importance of creating a pleasant, interactive, and non-monotonous learning atmosphere so that students are more motivated to participate actively and are better able to comprehend the material. In practice, many madrasah tsanawiyah students face difficulties in mastering vocabulary due to limited prior knowledge, low self-confidence, and conventional teaching methods that tend to be less engaging. The findings revealed a significant improvement in vocabulary mastery following the application of the voice method and drill. Students’ average scores increased by 38.94 points, from 43.24 on the pretest to 79.12 on the posttest. The t-test yielded a t-value of 15.17, exceeding the t-table value of 2.120, indicating a significant difference between pretest and posttest results. The novelty of this study lies in integrating the voice method with drill exercises in the context of Arabic vocabulary learning at the madrasah tsanawiyah level. While previous studies emphasized each method separately, this research introduces a combined approach that has rarely been explored. The findings demonstrate that the collaboration of the voice method and drill not only significantly enhances vocabulary mastery but also contributes to increased learning motivation, creates a more enjoyable classroom environment, and challenges the perception of Arabic learning as rigid and monotonous.
Potensi Normalisasi Perilaku Negatif Pemain Game Online MLBB Terhadap Digital Ethics Mahasiswa UPI Cahyadi, Deden; Danial, Endang; Syaifullah, Syaifullah
AURELIA: Jurnal Penelitian dan Pengabdian Masyarakat Indonesia Vol 4, No 2 (2025): July 2025
Publisher : CV. Rayyan Dwi Bharata

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.57235/aurelia.v4i2.6848

Abstract

Penelitian ini bertujuan untuk menganalisis potensi terjadinya normalisasi perilaku negatif dalam game online Mobile Legends: Bang Bang (MLBB) di kalangan mahasiswa Universitas Pendidikan Indonesia (UPI) dan dampaknya terhadap kesadaran serta praktik etika digital. Menggunakan pendekatan kualitatif deskriptif, data dikumpulkan melalui wawancara mendalam terhadap lima mahasiswa pemain aktif MLBB, Ketua UKM Esports UPI, dan seorang dosen ahli Pendidikan Kewarganegaraan, serta melalui observasi dan dokumentasi interaksi pemain di media sosial dan komunitas game. Hasil penelitian menunjukkan bahwa perilaku seperti ujaran kebencian, provokasi verbal, trolling, hingga tindakan tidak sportif telah menjadi bagian dari kebiasaan komunikasi dalam game dan mulai dianggap wajar. Proses ini mencerminkan gejala normalisasi deviansi yang mengarah pada desensitisasi nilai-nilai etika digital. Temuan juga menunjukkan bahwa stres akademik, anonimitas digital, dan lingkungan sosial kompetitif memperkuat kecenderungan perilaku menyimpang ini. Penelitian ini menyimpulkan bahwa tanpa adanya intervensi dalam bentuk edukasi etika digital, pembinaan karakter, dan pembentukan budaya digital yang sehat, perilaku negatif dalam ruang game online berpotensi melemahkan integritas moral mahasiswa sebagai warga negara digital. Rekomendasi penelitian meliputi integrasi literasi digital etis dalam kurikulum dan penguatan pengawasan komunitas game kampus.
Harnessing NLP and Big Data to Solve Linguistic Challenges in Indonesian Humanoid Robots: Pathways to Innovation and Entrepreneurship Syaifullah, Syaifullah; Noorahim, Wenny Noorahim
Journal of Supply Chain and Entrepreneurship Vol. 1 No. 2 (2025): Journal of Supply Chain and Entrepreneurship
Publisher : CV. SPDFHarmony

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.64268/josce.v1i2.35

Abstract

Aim: Indonesian, as a national language, contains intricate linguistic features such as agglutinative morphology, idioms, and numerous dialectal variations. These characteristics present significant challenges in developing humanoid robots capable of natural interaction through Natural Language Processing (NLP). This study aims to address these linguistic complexities while exploring the entrepreneurial potential of localized NLP applications in Indonesia. Methods: The research employs a qualitative literature review method, focusing on existing studies related to Indonesian NLP datasets, transformer-based language models, and speech technologies. Key sources include IndoNLI for inference, IndoSentiment for sentiment analysis, and case studies of humanoid robots like Lumen. The analysis also includes approaches utilizing Big Data, multi-pass decoders, and contextual language modeling to optimize performance in Indonesian linguistic settings. Findings: Findings indicate that the successful development of Indonesian-speaking humanoid robots relies on context-aware NLP models trained on representative, culturally relevant datasets. Integrating multimodal systems and Big Data enables enhanced comprehension of idiomatic, regional, and informal expressions. The research also reveals that NLP-based innovations can be commercialized through AI-powered assistants, educational bots, and digital customer service, opening new opportunities for tech-driven entrepreneurship. Significance: This study contributes to both technological advancement and business innovation by linking linguistic AI research with entrepreneurial applications. It underscores the importance of building a robust local data ecosystem and designing language models that reflect Indonesia’s linguistic diversity. These insights are vital not only for improving human-robot interaction but also for fostering sustainable digital entrepreneurship within emerging markets like Indonesia.
ANALISIS TINGKAT KESAMAAN DALAM HASIL CEK TURNITIN SKRIPSI PROGRAM STUDI BAHASA DAN SASTRA ARAB UIN RADEN MAS SAID SURAKARTA Qosim, Muhammad Nanang; Syaifullah, Syaifullah
El-Hayah Vol. 13 No. 2 (2023): Desember 2023
Publisher : Pascasarjana UIN Raden Mas Said Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22515/elha.v13i2.8825

Abstract

Penelitian ini dilakukan untuk mengungkap tingkat kemiripan naskah skripsi-skripsi Program Studi Bahasa dan Sastra Arab di UIN Raden Mas Said Surakarta. Dalam mengumpulkan data dilakukan dengan cara membaca hasil laporan pemeriksaan cek turnitin skripsi mahasiswa program studi bahasa dan sastra arab untuk dilihat frekuensi besaran kesamaan dan memeriksa rata-rata sumber kesamaan. Analisis data dilakukan dengan cara analisis deskriptif melalui pendekatan kuantitatif. Rumusan masalah penelitian adalah sejauh mana tingkat kemiripan dalam skripsi-skripsi tersebut dan bagaimana penggunaan Turnitin memengaruhi tingkat kemiripan tersebut. Hasil penelitian menunjukkan variasi dalam tingkat kemiripan, dengan frekuensi kesamaan berkisar antara 0% hingga 32% dan rata-rata kesamaan sekitar 6%. Ditemukan perbedaan antara skripsi berbahasa Arab dan yang telah diterjemahkan ke dalam bahasa Indonesia, mengindikasikan pengaruh proses penerjemahan. Temuan dari penelitian ini merekomendasikan pada pihak prodi bahasa dan sastra arab untuk melakukan cek turnitin berbahasa indonesia terlebih dahulu untuk mengantisipasi kesamaan sumber karena pada aplikasi turnitin belum dapat membaca kesamaan pada teks-teks arab.
Fostering Nationalist-Religious Character through Religious Extracurricular Activities: A Case Study of Mosque Youth Associations in Indonesian High Schools Anggyana, Rifa; Komalasari, Kokom; Bestari, Prayoga; Syaifullah, Syaifullah
Journal Evaluation in Education (JEE) Vol 6 No 4 (2025): October
Publisher : Cahaya Ilmu Cendekia Publisher

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37251/jee.v6i4.2167

Abstract

Purpose of the study: Character education is a strategic agenda in Indonesia’s nation-building, particularly in responding to globalization, moral degradation, and youth intolerance. Within secondary education, religious extracurricular organizations such as the Mosque Youth Association (Ikatan Remaja Masjid) play a vital role in fostering religiosity while strengthening nationalism. This study investigates the role of the Mosque Youth Association in cultivating nationalist-religious character among students in three schools in Bandung: SMAN 18, SMKN 12, and MA Nurul Iman. Methodology: Using a qualitative case study approach, data were collected through in-depth interviews, participant observation, document analysis, and field notes. Seventeen respondents were selected purposively: school principals, association mentors, leaders, members, government officials, and academic experts. Data analysis employed Miles and Huberman’s interactive model—data reduction, data display, and conclusion drawing—validated through triangulation of sources, techniques, and time. Main Findings: The findings indicate that the Mosque Youth Association functions as a behavioral laboratory, shaping students’ nationalist-religious character through regular activities such as religious studies, congregational prayers, social service, and leadership training. Consistent habit formation occurs through positive reinforcement (recognition, trust, leadership opportunities) and negative reinforcement (warnings, social sanctions). Key challenges include fluctuating participation, limited resources, repetitive content, and digital demands addressed through program innovation, collaboration, and technology use. Novelty/Originality of this study: The study concludes that character development through the Mosque Youth Association aligns with behavioristic learning theory and provides insights for reinforcement-based character education compatible with the Merdeka Curriculum and the Pancasila Student Profile
SOSIALISASI PENCEGAHAN DAN PERLINDUNGAN HUKUM TERHADAP KORBAN KEKERASAN DALAM RUMAH TANGGA (KDRT) Syaifullah, Syaifullah; Guntara, Bima; Dadang, Dadang; Hendra, Rio; Sianipar, Ferry Agus
Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat Vol 2 No 3 (2021): Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat
Publisher : LPPM Universitas Pamulang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.32493/al-jpkm.v2i3.13524

Abstract

Domestic violence is an act of violence against women that is often invisible. Along with cases of domestic violence that are increasing day by day, the government issued a Law on the Elimination of Domestic Violence, with the aim that victims of domestic violence, especially women, are expected to obtain legal protection. The problem that arises then is how to protect the law against victims of Domestic Violence (KDRT) to prevent criminal acts of domestic violence. The existence of Law Number 23 of 2004 concerning the Elimination of Domestic Violence is expected to be able to provide significant legal protection for victims of Domestic Violence (KDRT). The forms of protection regulated in this law are temporary protection from the police, court protection and placement of victims in "safe houses". However, the results of research, both through District Court decisions and informants, show that the form of protection for victims of domestic violence is still dominant through repressive actions (imprisonment sentences) to perpetrators, while temporary protection and permanent protection from the courts are less attention Domestic violence is an act of violence against physical, psychological, sexual and neglect in the family. Law Number 23 of 2004 concerning the Elimination of Domestic Violence (PKDRT) has regulated the protection for victims, but it does not fully fulfill the rights of victims. Criminal action, which is the goal of the Domestic Violence Law, often has a negative impact on victims, including: divorce and domestic disharmony. In addition, the imposition of a criminal offense is also contrary to other objectives to be achieved by the Act, namely: the maintenance of a harmonious and prosperous household. The PKDRT law provides opportunities for the involvement of the government, victims and the community in accordance with the idea of restorative justice which is already known by the Indonesian people as a form of local wisdom, but the protection of victims has not been fulfilled. Meanwhile, if the crime will be used in resolving domestic violence cases, it must be as selective as possible, especially if the consequences of the acts of the perpetrators of domestic violence will threaten and endanger the survival of the victim. Regarding forms of violence, violence is not merely physical in nature such as: beatings, torture or torture which easily leaves visible evidence. In many ways violence always takes many forms as well as many dimensions. Psychological violence such as constant fear, receiving threats, making someone feel humiliated, is another form that is very difficult to prove but leaves a long imprint on everyone's memory.
ANALISA LAYANAN WEBSITE BADAN PUSAT STATISTIKA KOTA PEKANBARU TERHADAP KEPUASAN PENGGUNA MENGGUNAKAN METODE E-S-QUAL Ningsih, Widiah; Ahsyar, Tengku Khairil; Angraini, Angraini; Syaifullah, Syaifullah
JOISIE (Journal Of Information Systems And Informatics Engineering) Vol 8 No 1 (2024)
Publisher : Institut Bisnis dan Teknologi Pelita Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35145/joisie.v8i1.4126

Abstract

Perkembangan teknologi saat ini telah membuat website menjadi komponen yang sangat penting. Penggunaan TI pada website juga banyak digunakan seperti pada instansi pemerintahan. Salah satu penerapan website pada instansi pemerintah diterapkan pada Badan Pusat Statistika (BPS) Kota Pekanbaru. Namun, dalam penginplementasi penggunaan website BPS Kota Pekanbaru ditemukan kendala diantaranya yaitu, Situs website belum sepenuhnya memudahkan untuk menemukan apa yang dibutuhkan pengguna, Informasi di website belum di atur dengan baik, website belum menjawab pertanyaan dalam waktu yang tepat, website belum memungkinkan pengguna untuk mengaksesnya dengan cepat. Dengan demikian, penelitian ini bertujuan untuk menganalisis persepsi atau sudut pandang pengguna yang melihat situs web BPS Kota Pekanbaru. Penelitian ini menggunakan metode E-S-Qual dengan 4 dimensi, yaitu Efficiency, Fulfillment, System Availability, and Privacy dan 23 items. Hasil penelitian menunjukkan bahwa dua variabel hipotesis berpengaruh; variabel privasi memiliki nilai T-statistic 2,027, dan variabel System Availability dengan nilai T-statistic 5,099 dimana kedua variabel tersebut nilai T-Statistic diatas nilai T-tabel > 1.96. Hal ini memberikan pengaruh positif dan signifikan kepuasan pengguna terhadap website BPS Kota Pekanbaru dalam menjaga privacy dan keberlangsungan akses pengguna website.
Optimalisasi Manajemen Kasus untuk Perlindungan Perempuan dan Anak di Kota Bima Nurnazmi, Nurnazmi; Tasrif, Tasrif; Ramadan, Syahru; Syaifullah, Syaifullah; Waluyati, Ida
EDU SOCIATA ( JURNAL PENDIDIKAN SOSIOLOGI ) Vol 8 No 1 (2025): Edu Sociata : Jurnal Pendidikan Sosiologi
Publisher : EDU SOCIATA ( JURNAL PENDIDIKAN SOSIOLOGI )

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33627/es.v8i1.3389

Abstract

Kasus perempuan dan anak dalam berbagai kasus, seperti kasus kekerasan terhadap perempaun dan anak (KTP/KTA), Tindakan Pidana Perdagangan Orang (TPPO), Anak Berhadapan dengan Hukum (ABH), dan Pernikahan Usia Anak di Indonesia yang kasusnya belum terselesaikan beberapa kasus, muncul lagi kasus yang baru. Data kasus tiga tahun terakhir, tahun 2021 terdapat 36 kasus, mengalami kenaikan signifikan pada tahun 2022 terdapat 71 kasus sedangkan tahun 2023 mengalami menurunan menjadi 54 kasus. Pendekatan penelitian kualitatif dengan jenis fenomenologi. Informan terdiri dari 20 informan dengan teknik purposive sampling. Teknik pengumpulan data yakni wawancara, observasi, dan dokumentasi. Teknik analisis data menggunakan analisi spirat John Creswell dan keabsahan data menggunakan triangulasi sumber data dan triangulasi teknik pengumpulan data. Alur manajemen kasus untuk perlindungan perempuan dan anak antara lain: perjalinan relasi (engagement), penilaian (assessment), rencana (planning), intervensi (intervetion), pemantauan (monitoring), evaluasi (evaluation), terminasi (termination), dan tindak lanjut (follow-up).
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Co-Authors - Sapriya . Mansyurdin Abdul Azis Abdul Basit Abdur Rohman Adhari, Nursanda Rizki Adillah, Suci Nur Ahsyar, Tengku Khairil Aidil, Dyta Rabbani Anggyana, Rifa Angraini Angraini Anofrizen Anofrizen Aprillia, Dhea Dwi Aprillia, Dhea Dwi Aprinastya, Rachell Aqilla, Nabila Fadia Arif Marsal Arum Setiawan Asful, Ferdhinal Asmaret, Desi Asriyana, . Asyraf, Fajri Muhammad Aszareta, Muhammad Andoni Aurora, Dhea Apriano Ayulya, Agisti Mutiara Aziz, M. Abdul Cahyadi, Deden Cecep Darmawan, Cecep DADANG DADANG Dadang Sundawa, Dadang Dahelmi Dahelmi DAMIRAH DAMIRAH, DAMIRAH Dasim Budimansyah Dasim Budimansyah, Prayoga Bestari, Redi Yamanto, Dasim Budimansyah, Dewi Imelda Roesma Diani, Diani Djong Hon Tjong Efrizal Efrizal Eki Saputra Endang Danial, Endang Farisi, Czar Daffa Al Febi Nur Salisah Firdaus, Pipin Fitra, Joni Darma FITRIAH ARTINA, FITRIAH Fitriani Fitriani Guntara, Bima Hamzah, Muhammad Lutfhi Hamzah, Muhammad Lutfi Hamzah, Muhammad Luthfi Harmaniola, Elsa Hendra, Rio Hendri Irawan Henny Herwina Herliza, Herliza hidayanti, hidayanti Ida Waluyati Indah Lestari, Indah Indrajaya, Indrajaya Indriani, Monalisa Ingrid Shintia Arsy Jacky, Jacky Janra, Muhammad Nazri Jazman, Muhammad Juirah, Juirah Julhadi, Julhadi Julita, Sandra Junaihil, Junaihil Juniyati, Rita Juwandi, Ronni Karim Suryadi Karim Suryadi Kasno Kasno Kokom Komalasari Kosasih, Hengky Kyaw, Aung Ye Leni Anggraeni Lestari, Nurrizka Puji M Afdal Maliza, Rita Masyitoh, Iim Siti MAULANA, BIMA Maulidiyah, Khoirun Ni'mah Megawati - Mochamad Hasyim Mona Fronita, Mona Muarif, Muarif Muhammad Amin Muhammad Nanang Qosim Muslim Muslim Nanda Nazira Naufal, Misbahuddin Nazhifatunnisa, Nazhifatunnisa Ningsih, Widiah Nofrita Nofrita Noorahim, Wenny Noorahim Novita Sari Nugraha Nugraha Nurnazmi, Nurnazmi Nurrokhmatulloh, Nurrokhmatulloh Oktoriani, Della Pebri, Prianda Prananda, Yaldri Oktra Pratama, Raihan Anugrah Prawira, Furqan Dwiki Lintang Prima, Ari Putra Santoso Putra, Tarekh Febriana Putri, Runi Aulia Putri, Syntia Mai Rahman Mulyawan Rahmawita, Medyantiwi Ramadani, Ela Ramadhan, Rifky Ratna Fitria Rianda, Rahmad Didho Ridho, Muhammad Syifa'ur Safika, Nurul Sakban, Abdul Salis, Viola Mutiara Saputri, Aprilia Mayang Sianipar, Ferry Agus Sinaga, Lina Siregar, Syafril Solihah, Nikmatus Sri Nurhidayati, Sri Subakja, Triyawan Bagus Sulistiono Supriyono Supriyono Susanto Susanto Syahru Ramadan, Syahru Tasrif Tasrif Titik Efnita, Titik Tutoq, yulita Wahyuni, Reni wahyuni Waluyo Waluyo Wenny Noorahim Wilson Novarino Wily Julitawaty, Wily Yuniar, Sucifa Thita Zaini Zaini