Article Per Year (5 Year)
p-Index From 2021 - 2026
9.698
P-Index
This Author published in this journals
All Journal IJCCS (Indonesian Journal of Computing and Cybernetics Systems) Jurnal Civics: Media Kajian Kewarganegaraan Journal of Tropical Life Science : International Journal of Theoretical, Experimental, and Applied Life Sciences JUSIFO : Jurnal Sistem Informasi JURNAL KEPEMIMPINAN DAN PENGURUSAN SEKOLAH Sistemasi: Jurnal Sistem Informasi Jurnal Ilmiah Ekonomi Islam ARISTO Acta Aquatica: Aquatic Sciences Journal AKSIOLOGIYA : Jurnal Pengabdian Kepada Masyarakat Jurnal Moral Kemasyarakatan INOVTEK Polbeng - Seri Informatika Jurnal Biologi Tropis INTECOMS: Journal of Information Technology and Computer Science Jurnal Teknologi Sistem Informasi dan Aplikasi Studi Arab Jurnal Ilmiah Ecosystem JIPI (Jurnal Ilmiah Penelitian dan Pembelajaran Informatika) JOISIE (Journal Of Information Systems And Informatics Engineering) EDUMATIC: Jurnal Pendidikan Informatika Building of Informatics, Technology and Science Journal of Applied Engineering and Technological Science (JAETS) Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat Thariqah Ilmiah ; Jurnal ilmu-ilmu kependidikan & Bahasa Arab Kordinat : Jurnal Komunikasi antar Perguruan Tinggi Agama Islam Jurnal Pengabdian kepada Masyarakat Nusantara Jurnal Teknik Informatika (JUTIF) Al-tsaman : Jurnal Ekonomi dan Keuangan Islam Jurnal Pendidikan dan Teknologi Indonesia Jurnal Pendidikan PKn Indonesian Journal of Intellectual Publication (IJI Publication) Jurnal Ekonomi Jurnal Kapita Selekta Administrasi Publik Journal Of Human And Education (JAHE) BAHTRA: Jurnal Pendidikan Bahasan dan Sastra Jurnal Algoritma Maritime Park: Journal Of Maritime Technology and Socienty Aurelia: Jurnal Penelitian dan Pengabdian Masyarakat Indonesia Indonesian Research Journal on Education Jurnal Pengabdian Inovasi Masyarakat Indonesia Economics Studies and Banking Journal Rhizome: Jurnal Kajian Ilmu Humaniora Journal of Economic Growth and Development Review Proceeding Of International Conference On Education, Society And Humanity Komunitas: International Journal of Indonesian Society and Culture SCIENTIA JOURNAL : Jurnal Ilmiah Mahasiswa Jurnal Edulanguage: Jurnal Pendidikan Bahasa Journal of Supply Chain and Entrepreneurship EL- Hayah Indonesian Journal of Intellectual Publication (IJI Publication)
Syaifullah Syaifullah
Jurusan Sistem Informasi Fakultas Sains Dan Teknologi Universitas Islam Negeri Sultan Syarif Kasim Riau
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Mechanical Engineering Physics Social Sciences Other

Published : 83 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 83 Documents
Search

 4   5   6   7   8 
SOSIALISASI PENCEGAHAN DAN PERLINDUNGAN HUKUM TERHADAP KORBAN KEKERASAN DALAM RUMAH TANGGA (KDRT) Syaifullah, Syaifullah; Guntara, Bima; Dadang, Dadang; Hendra, Rio; Sianipar, Ferry Agus
Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat Vol 2 No 3 (2021): Abdi Laksana : Jurnal Pengabdian Kepada Masyarakat
Publisher : LPPM Universitas Pamulang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.32493/al-jpkm.v2i3.13524

Abstract

Domestic violence is an act of violence against women that is often invisible. Along with cases of domestic violence that are increasing day by day, the government issued a Law on the Elimination of Domestic Violence, with the aim that victims of domestic violence, especially women, are expected to obtain legal protection. The problem that arises then is how to protect the law against victims of Domestic Violence (KDRT) to prevent criminal acts of domestic violence. The existence of Law Number 23 of 2004 concerning the Elimination of Domestic Violence is expected to be able to provide significant legal protection for victims of Domestic Violence (KDRT). The forms of protection regulated in this law are temporary protection from the police, court protection and placement of victims in "safe houses". However, the results of research, both through District Court decisions and informants, show that the form of protection for victims of domestic violence is still dominant through repressive actions (imprisonment sentences) to perpetrators, while temporary protection and permanent protection from the courts are less attention Domestic violence is an act of violence against physical, psychological, sexual and neglect in the family. Law Number 23 of 2004 concerning the Elimination of Domestic Violence (PKDRT) has regulated the protection for victims, but it does not fully fulfill the rights of victims. Criminal action, which is the goal of the Domestic Violence Law, often has a negative impact on victims, including: divorce and domestic disharmony. In addition, the imposition of a criminal offense is also contrary to other objectives to be achieved by the Act, namely: the maintenance of a harmonious and prosperous household. The PKDRT law provides opportunities for the involvement of the government, victims and the community in accordance with the idea of restorative justice which is already known by the Indonesian people as a form of local wisdom, but the protection of victims has not been fulfilled. Meanwhile, if the crime will be used in resolving domestic violence cases, it must be as selective as possible, especially if the consequences of the acts of the perpetrators of domestic violence will threaten and endanger the survival of the victim. Regarding forms of violence, violence is not merely physical in nature such as: beatings, torture or torture which easily leaves visible evidence. In many ways violence always takes many forms as well as many dimensions. Psychological violence such as constant fear, receiving threats, making someone feel humiliated, is another form that is very difficult to prove but leaves a long imprint on everyone's memory.
ANALISA LAYANAN WEBSITE BADAN PUSAT STATISTIKA KOTA PEKANBARU TERHADAP KEPUASAN PENGGUNA MENGGUNAKAN METODE E-S-QUAL Ningsih, Widiah; Ahsyar, Tengku Khairil; Angraini, Angraini; Syaifullah, Syaifullah
JOISIE (Journal Of Information Systems And Informatics Engineering) Vol 8 No 1 (2024)
Publisher : Institut Bisnis dan Teknologi Pelita Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35145/joisie.v8i1.4126

Abstract

Perkembangan teknologi saat ini telah membuat website menjadi komponen yang sangat penting. Penggunaan TI pada website juga banyak digunakan seperti pada instansi pemerintahan. Salah satu penerapan website pada instansi pemerintah diterapkan pada Badan Pusat Statistika (BPS) Kota Pekanbaru. Namun, dalam penginplementasi penggunaan website BPS Kota Pekanbaru ditemukan kendala diantaranya yaitu, Situs website belum sepenuhnya memudahkan untuk menemukan apa yang dibutuhkan pengguna, Informasi di website belum di atur dengan baik, website belum menjawab pertanyaan dalam waktu yang tepat, website belum memungkinkan pengguna untuk mengaksesnya dengan cepat. Dengan demikian, penelitian ini bertujuan untuk menganalisis persepsi atau sudut pandang pengguna yang melihat situs web BPS Kota Pekanbaru. Penelitian ini menggunakan metode E-S-Qual dengan 4 dimensi, yaitu Efficiency, Fulfillment, System Availability, and Privacy dan 23 items. Hasil penelitian menunjukkan bahwa dua variabel hipotesis berpengaruh; variabel privasi memiliki nilai T-statistic 2,027, dan variabel System Availability dengan nilai T-statistic 5,099 dimana kedua variabel tersebut nilai T-Statistic diatas nilai T-tabel > 1.96. Hal ini memberikan pengaruh positif dan signifikan kepuasan pengguna terhadap website BPS Kota Pekanbaru dalam menjaga privacy dan keberlangsungan akses pengguna website.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Protection Bissu right in the Bugis Arajang ritual Hermawati, Hermawati; Khoidir, Muhammad; Syaifullah, Syaifullah; Mahfudz, Asep
Jurnal Civics: Media Kajian Kewarganegaraan Vol. 22 No. 2 (2025)
Publisher : Universitas Negeri Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21831/jc.v22i2.85778

Abstract

The Bissu retain their "marginalised status" for various reasons, the most significant of which is their status as the custodians of the Arajang. This practice is in direct opposition to their religious beliefs. Secondly, they are subjected to discrimination due to their status as indigenous individuals who are members of the queer community. The Bissu's rights have been restricted in the performance of the Arajang ritual in 2022 and 2023, despite the efforts of the state authority, and more specifically, the provincial government, to address the issue. This article employs a qualitative approach with a case study design to comprehensively analyse the lack of performance of the Arajang ritual. In-depth interviews, documentation, and non-participant observation comprise the research methodology. The results suggest that the legal protections are insufficient to adequately safeguard the Bissu during the performance of rituals, as they are sociologically insufficient. Furthermore, the investigation revealed that leadership is a critical element in realising the rights of the Bissu people; however, normative legal guarantees have minimal influence on the capacity to intervene effectively.
Menyenangkan Belajar: Pelatihan Membaca Bahasa Inggris dengan Sentuhan Cerita untuk Siswa Kelas X di SMK Bina Insan Provinsi Riau Herdi, Herdi; Abbas, M Fadhly Farhy; Syaifullah, Syaifullah; Rizky, Ramanda
Journal Of Human And Education (JAHE) Vol. 4 No. 2 (2024): Journal Of Human And Education (JAHE)
Publisher : Universitas Pahlawan Tuanku Tambusai

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31004/jh.v4i2.670

Abstract

Dalam upaya meningkatkan mutu pendidikan di SMK Bina Insan Provinsi Riau, tim pengabdi berinisiatif untuk melibatkan diri dalam kegiatan pengabdian kepada masyarakat di lembaga mitra, yakni SMK Bina Insan Provinsi Riau di Kecamatan Siak Hulu. Fokus utama kegiatan ini adalah memberikan dukungan dalam pengembangan kompetensi pendidik agar mereka dapat memahami dan mengimplementasikan metode pembelajaran yang lebih efektif. Misi utama yang diemban adalah mengatasi celah pemahaman yang masih ada di antara pendidik, sehingga menciptakan lingkungan belajar yang lebih produktif. Dengan pemahaman yang lebih baik tentang metode pembelajaran, diharapkan SMK Bina Insan Provinsi Riau dapat mencapai target pengembangan kompetensi siswa. Analisis situasi yang dilakukan sebelumnya membuktikan bahwa terdapat kekurangan dalam penerapan metode pembelajaran, dan melalui pengabdian ini, siswa dapat memanfaatkan pelatihan yang diberikan untuk meningkatkan kemampuan membaca dalam Bahasa Inggris, membawa mereka ke arah peningkatan kompetensi yang diharapkan. Sebagai hasilnya, dari interpretasi temuan melalui kuisioner diasumsikan bahwa siswa tidak hanya memiliki keterampilan membaca yang lebih baik dalam Bahasa Inggris, tetapi juga dibekali dengan keterampilan berpikir kritis, imajinasi, dan rasa ingin tahu yang akan mendukung keberhasilan mereka dalam menghadapi kompleksitas dunia yang semakin terglobalisasi.
Pengembangan Penilaian Pembelajaran Pendidikan Agama Islam Berbasis Google Form, Goreact dan Emotion AI di SMP Negeri 2 Sumberasih Kabupaten Probolinggo Sofa, Ainur Rofiq; Sukandarman, Sukandarman; Hidayatingsih, Nur; Qomariyah, Nurul; Fausi, Suhud Al; Syaifullah, Syaifullah
Indonesian Research Journal on Education Vol. 5 No. 2 (2025): Irje 2025
Publisher : Fakultas Keguruan dan Ilmu Pendidikan, Universitas Pahlawan Tuanku Tambusai

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31004/irje.v5i2.2377

Abstract

Pendidikan Agama Islam memegang peranan penting dalam membentuk karakter dan akhlak siswa di Indonesia. Di era digital, Google Form, GoReact Dan Emotion AI muncul sebagai alat yang potensial untuk meningkatkan efektivitas penilaian pembelajaran Pendidikan Agama Islam. Penelitian ini bertujuan untuk mengembangkan penilaian berbasis Google Form, GoReact Dan Emotion AI untuk Pendidikan Agama Islam di SMP Negeri 2 Sumberasih dan mengeksplorasi peluang serta tantangan dalam penerapannya. Dengan menggunakan pendekatan deskriptif kualitatif, penelitian ini menyoroti kemampuan Google Form, GoReact Dan Emotion AI untuk menyediakan analisis data yang objektif dan cepat, meningkatkan efisiensi evaluasi, mengurangi waktu penilaian, dan memberikan umpan balik yang dipersonalisasi. Keunggulan ini mendukung kurikulum yang lebih responsif dan adaptif yang disesuaikan dengan kebutuhan siswa dan tuntutan pendidikan yang terus berkembang. Namun, tantangan yang signifikan meliputi masalah etika, masalah privasi data, kesiapan teknologi, dan kemahiran pendidik dalam penggunaan Google Form, GoReact Dan Emotion AI. Untuk mengatasinya diperlukan pelatihan guru yang terarah, kebijakan etika dan privasi yang kuat, serta investasi dalam infrastruktur teknologi yang handal. Strategi yang komprehensif memungkinkan SMP Negeri 2 Sumberasih untuk memanfaatkan Google Form, GoReact Dan Emotion AI, meningkatkan kualitas pendidikan, dan menumbuhkan lingkungan belajar yang efektif dan efisien.
Tri Hita Karana Philosophy in the Awig-awig of the Bali Aga Community towards Ecological Citizenship Tripayana, I Nengah Agus; Bestari, Prayoga; Malihah, Elly; Syaifullah, Syaifullah
Komunitas: International Journal of Indonesian Society and Culture Vol. 16 No. 1 (2024): March 2024
Publisher : Universitas Negeri Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/komunitas.v16i1.6375

Abstract

This research seeks to examine the actualization of the Tri Hita Karana philosophy in the awig-awig of Balinese society in realizing ecological citizenship. The research was conducted in Tenganan Pegringsingan village, Karangasem District, Karangasem Regency, Bali. Using qualitative methods. Data collection was carried out through documentation studies. The research results show that the tri hita karana philosophy states in the rules is contained in awig-awig Bali society. The palemahan aspect, namely realizing harmonious relations between humans and nature in realizing ecological citizenship, is implemented in articles 7, 8, 9, 12, 14, 37, 38, 51, 55, 61 which regulate the prohibition on picking fruit, cutting down trees, changing land functions, settlements, agricultural patterns, spatial planning and environmental conservation. The existence of awig-awig is able to realize ecological citizenship based on Tri Hita Karana.
EVALUATION OF USER EXPERIENCE OF MOBILE BANKING APPLICATIONS USING USER EXPERIENCE METHOD QUESTIONNAIRE (UEQ) AND HEURISTIC EVALUATION (HE) Novianti, Elzy; Ahsyar, Tengku Khairil; Syaifullah, Syaifullah; Fronita, Mona
Jurnal Teknik Informatika (Jutif) Vol. 5 No. 4 (2024): JUTIF Volume 5, Number 4, August 2024 - SENIKO
Publisher : Informatika, Universitas Jenderal Soedirman

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.52436/1.jutif.2024.5.4.2117

Abstract

One of the largest banks in Indonesia managed by the government is Bank Rakyat Indonesia. BRI is one of the banking institutions that implements a mobile banking system. Issues and disruptions in usability of the application, as indicated by survey results from users, have been identified. This research aims to evaluate the capability of the BRImo application to provide a positive user experience. In this research testing, two methods are applied: User Experience Questionnaire and Heuristic Evaluation. The results of the benchmark UEQ questionnaire testing show scores on the attractiveness scale at 1.61, efficiency at 1.76, and stimulation at 1.52, categorized as good, while scores from the perspicuity scale at 1.72, dependability at 1.48, and novelty at 0.75 are considered above average. Issues identified by experts with the BRImo application have the potential to hinder users. Based on the severity level testing results of 10 aspects of the method, Aesthetic and Minimalist Design received a rating of 2 (two), with a score of 1.66, indicating a need for improvement with low priority.
EVALUATION OF USER EXPERIENCE (UX) HNI MOBILE USING THE THINK ALOUD METHOD Revansa, Muhammad Dio; Angraini, Angraini; Ahsyar, Tengku Khairil; Syaifullah, Syaifullah
Jurnal Teknik Informatika (Jutif) Vol. 5 No. 4 (2024): JUTIF Volume 5, Number 4, August 2024 - SENIKO
Publisher : Informatika, Universitas Jenderal Soedirman

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.52436/1.jutif.2024.5.4.2120

Abstract

User experience (UX) evaluation is important to determine the quality of a product or service. This research evaluates the UX of the HNI Mobile application using the think aloud method which asks users to express their thoughts while using the system. Involving 5 respondents who performed 10 task scenarios. The respondents' verbalization data, transcribed, and analyzed with NVIVO 12. The results obtained 5 main codes/themes of problems, namely profile editing, language features, member notifications, feature layout, and feature upgrades, which were visualized in a mind map. A retrospective probing technique was used to understand user difficulties. Although the main features functioned well, some respondents experienced difficulties in using the supporting features such as edit profile, change language, and access notifications. These findings provide input to improve the user experience of the HNI Mobile app in the future.
مشكلات تعليم اللغة العربية في مدرسة Maulidiyah, Khoirun Ni'mah; Syaifullah, Syaifullah
STUDI ARAB Vol 6 No 1 (2015)
Publisher : Universitas Yudharta Pasuruan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35891/studi arab.v6i1.37

Abstract

في إندونسيا، لا يتعلم الطالب اللغة العربية في المؤسسة التربوية الإسلامية غير رسمية كالمعهد الأسلامي فقط، بل يتعلمها في المؤسسة التربوية الإسلامية الرسميةكما في المدرسة الإبتدائية أيضا. و على الرغم من ذلك، فإن نشأة اللغة العربية و اهتمام عليها قليلة، إفترض مجتمع المسلم أن اللغة العربية صعبة. و هذا الحال موؤثر إلى تطبيق تعليم اللغة العربية في المدرسة. فلذلك، تود الباحثة إلى الكشف و البيان كيف تطبيق تعليم اللغة العربية في المدرسة الإبتدائية. و يهدف هذا البحث المتواضع لمعرفة إجراء تعليم اللغة العربية، و لمعرفة مشكلات تعليم اللغة العربية و لمعرفة محاولة معلم اللغة العربية في حلّ المشكلات تعليم اللغة العربية في مدرسة أولاك-ألين الإبتدائية الإسلامية الحكومية و مدرسة والي صاغا الإبتدائية.و النوع من هذا البحث هو بحث الكيفي الوصفي. و يجري جمع البيانات من المراقبة و المقابلة و الموثقة. و يجري تحليل البيانات مع تحويل البيانات ثم تقديم البيانات ثم تحققّ البيانات و القيام بتحسينات عن طريق العثور على البيانات التي تحتاج إلى أن تأخذ الإستنتاجاتو تظهر هذه نتائج البحث أن المشكلة في تعليم اللغة العربية تتكون من المشكلة في علم اللغة و المشكلة في غير علم اللغة. أما المشكلة في علم اللغة هي تعذر الطلاب ترجمة القراءة باللغة العربية، و تعذّر الطلاب ترجمة الكتابة باللغة العربية، و تعذّر الطلاب كتابةالعربية بإملاء، و يشعر الطلاب الصعوبة في الترتيب أو الإتصال الحرف العربية، و نقص المفردات التي يملكها الطالب. أما المشكلة في غير علم اللغة هي ضيق وقت التعليمي، و عدم الإهتمام من أباء و أمهات الطلاب في أنشطة التعلّم للطلاب في المنزل خاصة في اللغة العربية، و نظراً لغياب وسائل ممارسة الأطفال للتحدث أو المحادثة في المجتمع، و عدم الكفاية على المرافق و البنية التحتية. و المحاولة البمذولة لمعالجة مشكلة تعليم اللغة العربية في علم اللغة هي يعطي معلّم اللغة العربية التعيينات لحفظ المفردات، يعطي المعلّم الممارسة لكتابة المفردات بإملاء، توفّر المدرسة مواضيع إضافية، توفّر المعلّم الدروس الإضافية الخاصة في الدينية و اللغة العربية، يستخدم معلّم اللغة العربية الأغنية كمقدمة للتعلم. و المحاولة البمذولة لمعالجة مشكلة تعليم اللغة العربية في غير علم اللغة هي تحديد و تصنيف معلّم اللغة العربية قدرة الطلاب في معرفة اللغة العربية ، يحاول المعلّم اللغة العربية المواد التعليمية القائمة على باوير-بوينت لجعل استخدام الوسائل الموجودة، نشت الحكومة الأنطمة المتعلّقة بالتعييرات لتخصيص ساعة درس اللغة العربية، يعطي المعلم الرسالة للإهتمام تقدّم التعليم من الطلاب، يعطي المدرسة برنامج إضافيّ، يسعى المعلّم الفرصة للطلاب للسؤال و أعطاء الأسئلة حول الموضوع، سواء في أثناء التعليم أو بعدها
Co-Authors - Sapriya Abbas, M Fadhly Farhy Abdul Azis Abdur Rohman Adillah, Suci Nur ahmad yani Aidil, Dyta Rabbani Ainur Rofiq Sofa Ananda, Dhea Angraini Angraini Anofrizen Anofrizen Aprillia, Dhea Dwi Aprillia, Dhea Dwi Aprinastya, Rachell Aqilla, Nabila Fadia Arif Marsal Arifin, Hanifan Arum Setiawan As-Syahri, Hidayatullah Asep Mahfudz, Asep Asful, Ferdhinal Asmaret, Desi Asyraf, Fajri Muhammad Aszareta, Muhammad Andoni Aurora, Dhea Apriano Ayulya, Agisti Mutiara Aziz, M. Abdul Bima Guntara Cahyadi, Deden Cecep Darmawan Dadang Dadang Dahelmi Dahelmi DAMIRAH DAMIRAH, DAMIRAH Dasim Budimansyah Dasim Budimansyah, Prayoga Bestari, Redi Yamanto, Dasim Budimansyah, Dewi Imelda Roesma Diani, Diani Djong Hon Tjong Efrizal Efrizal Eki Saputra Elly Malihah Endang Danial, Endang Farisi, Czar Daffa Al Fausi, Suhud Al Fikri, Nidhal Firdaus, Pipin Fitra, Joni Darma Fitriana, Muhamad Azizan Fitriani Fitriani Hamdi, Fathan Surya Hamzah, Muhammad Lutfhi Hamzah, Muhammad Lutfi Hamzah, Muhammad Luthfi Hari Susanto Harmaniola, Elsa Hendra, Rio Hendri Irawan Henny Herwina Herdi Herdi Herlinawati Herlinawati Herliza, Herliza Hermawati Hermawati, Hermawati hidayanti, hidayanti Hidayatingsih, Nur I Nengah Agus Tripayana . Ilhammi, Windy Tri Indradewa, Rhian Indrajaya, Indrajaya Indriani, Monalisa Irham Irham Jacky, Jacky Janra, Muhammad Nazri Jazman, Muhammad Juirah, Juirah Julhadi, Julhadi Julita, Sandra Juniyati, Rita Kasno Kasno Khasanah Khasanah Khoidir, Muhammad Kyaw, Aung Ye Leni Anggraeni Lestari, Nurrizka Puji Lubis, Amelia Sriwahyuni Mahendra, Ahdiyat Maliza, Rita Mansyurdin MAULANA, BIMA Maulidiyah, Khoirun Ni'mah Megawati - Moh Hasan Firghol Mona Fronita, Mona Muarif, Muarif Muhammad Nanang Qosim Muslim Muslim Naelul Huda, Ade Nanda Nazira Nazhifatunnisa, Nazhifatunnisa Ningsih, Widiah Nofrita Nofrita Noorahim, Wenny Noorahim Nordin, Norhisham Mohamad Novianti, Elzy Novita Sari Nurrokhmatulloh, Nurrokhmatulloh Nurul Qomariyah Oktoriani, Della Pasak, Anas Patandjengi, Aswara A. Permata, Nur Fitria Mita Pratama, Raihan Anugrah Prawira, Furqan Dwiki Lintang Prima, Ari Putra Santoso Putra, Tarekh Febriana Putri, Runi Aulia Putri, Syntia Mai Rahman Mulyawan Rahmawita, Medyantiwi Ramadani, Ela Ramadhan, Rifky Ratna Fitria Revansa, Muhammad Dio Rianda, Rahmad Didho Ridho, Muhammad Syifa'ur Rizky, Ramanda Rosadi, Ariani Safika, Nurul Sakban, Abdul Salis, Viola Mutiara Saputra , Eki Saputri, Aprilia Mayang Selvanus, Selvanus Setiawan, Mursyid Shamsul Arrieya Ariffin Sianipar, Ferry Agus Sinaga, Lina Siregar, Syafril Solihah, Nikmatus Sri Nurhidayati, Sri Sudirman Sudirman Sukandarman, Sukandarman Syafril Syafril Syahdan Syahdan, Syahdan Syaifullah, Agus Syamsiar, Syamsiar Tanshzil, Sri Wahyuni Tengku Khairil Ahsyar Titik Efnita, Titik Trisya, Cintia Putri Tutoq, yulita Wadu, Ludovikus Bomas Wahyudi Wahyudi Wahyuni, Reni wahyuni Waluyo Waluyo Wilson Novarino Yuniar, Sucifa Thita Zaini Zaini