Claim Missing Document
Check
Articles

Bentuk dan Sebaran Lesi Demodekosis pada Sapi Bali (THE SHAPE AND DISTRIBUTION OF DEMODECOSIS LESIONS ON BALI CATTLE) I Nyoman Suartha; Reny Septyawati; I Ketut Gunata
Jurnal Veteriner Vol 15 No 3 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (197.184 KB)

Abstract

Demodicosisis a skin diseasecaused byDemodexsp., that inhabits animal hair folliclesandcandamageskintissue. This study aims to reveal the form and distribution of demodicosis lesions in Bali cattle in thecenter of breeding bali cattle Sobangan. The sample was recorded based on the present of skin lesions.Skin scraps were collected, and examined for Demodex sp. The shape of the lesions was documented byobserving existing lesions on the body of bali cattle. The size of the lesions was measured using calipers.The distribution of the lesions was done by dividing the body area of head, neck, back, and abdomen region.We found that the prevalence of demodicosis was 12.66% (38/300). The shape of demodicosis lesions werenodular, scab, and dollar plaque. Distribution of demodicosis lesions was mostly at the neck (36.8%), atthe back (34.21%), and neck to back (23.68%). In conclusion, the prevalence of demodicosis was mild, andthe greatest distribution was on neck. In order to reduce the incidence rate in bali cattle should be keptproperly and sanitation is carried out at a good standard.
Perbandingan Sekuens Konsensus Gen Hemaglutinin Virus Avian Influenza Subtipe H5N1 Asal Unggas di Indonesia dengan Subtipe H5N2 dan H5N9 I Gusti Ngurah Kade Mahardika; I Nyoman Suartha; Ida Bagus Kade Suardana; I Gusti Ayu Yuniati Kencana; I Wayan Teguh Wibawan
Jurnal Veteriner Vol 10 No 1 (2009)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (136.143 KB)

Abstract

Consensus sequence of hemagglutinin (HA) gene of avian influenza viruses of H5N1 subtype isolatedfrom fowl in Indonesia – hereafter named as H5N1_Indonesia – is compared with that of H5N2 and H5N9viruses. Sequence information were downloaded from the public database GeneBank. The genetic distancesand nucleotide as well as its deduced amino-acid sequence alignment were analysed. At nucleotide level,genetic distances of HA between H5N1_Indonesia to H5N2 and H5N9 are 16.2% and 9.6%, respectively.At amino-acid level, the distances are 9.7% and 6.8%. The genetic distances of HA1 fragments are 19.0%(H5N1_Indonesia – H5N2) and 10.9% (H5N1_Indonesia – H5N9). At amino-acid, level the genetic distancesof HA1 are 13.1% (H5N1_Indonesia-H5N2) and 8.8% (H5N1_Indonesia – H5N9). All three subtypes havedifferent glycosilation motive and variation of amino-acid sequence of four antigenic sites. The consequenceof those facts is discussed.
teknik diagnostik Teknik Diagnosis Demodekosis pada Anjing I Nyoman Suartha; Willy Moris Nainggolan; Yekhonya Rehuel Sidjabat; Ni Made Restiati
Jurnal Veteriner Vol 19 No 1 (2018)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (148.528 KB) | DOI: 10.19087/jveteriner.2018.19.1.85

Abstract

Demodicosis is a parasitic disease which is predilected in skin. Demodicosis in dogs may present local or general clinical symptoms. The success of demodicosis treatment is highly dependent on dog immune conditions, nutritional status, disease status, and routine treatment. The success of the treatment is also affected by the accuracy in the diagnostic technique used. The purpose of this study was to compare the three diagnostic skin examination techniques namely scraping, trichogram, and taping to diagnose cases of demodicosis. A total of 20 dog samples was taken from dog patients that came to Bali Veterinary Clinic, at Prerenan, Badung, Bali, with symptoms of itching, hair loss, skin redness, scale, and hyperpigmentation. Sampling was done by technique of scraping, trichogram, and taping. Scraping technique was done by scraping the skin, trichogram technique was done by pulling hair, and taping technique was done by attaching the tape. The result of Demodex mite isolation from the three diagnostic techniques performed showed scraping technique 5.45 ± 1.05; trichogram technique 1.10 ± 0.91; and taping technique 3.50 ± 0.83 dogs. Its Concluded that scraping technique provides the best diagnostic value for the isolation of Demodex mites compared to the other two.
Variasi Respon Pembentukan IgY terhadap Toxoid Tetanus dalam Serum dan Kuning Telur pada Individu Ayam Petelur I Wayan Teguh Wibawan; Iman Bayu Prakoso Darmono; I Nyoman Suartha
Jurnal Veteriner Vol 11 No 3 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (148.229 KB)

Abstract

The variation of response on the production of specific IgY to tetanus toxoid among chickenin serum and egg yolk was observed in this study. Chicken showed relatively late response inproducing specific IgY in serum, around 59 days were needed to have a positive precipitationreaction of complex IgY-tetanus toxoid in the immunodiffusion test (agar gel precipitation test/AGPT). The presence of IgY in egg yolk could be detected one week after positive reations inserum was observed. The positive reaction in AGPT mostly related with the positive reaction inELISA, eventhough the variation of titer values were observed among chicken sera and egg yolk.This response variation might be related with the different of physiological status of the chicken.
Penggunaan Antibodi Anti-idiotipe sebagai Vaksin terhadap Streptokokosis (THE USING OF ANTI-IDIOTYPE ANTIBODY AS VACCINE AGAINST STREPTOCOCCOSIS) I Nyoman Suartha; Iwan Harjono Utama; Bambang Pontjo Priyosoeryanto; I Wayan Teguh Wibawan
Jurnal Veteriner Vol 2 No 4 (2001)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3457.972 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Vaksin Kombinasi Newcastle Disease dengan Avian Influenza Memicu Imunitas Protektif pada Ayam Petelur terhadap Penyakit Tetelo dan Flu Burung (COMBINED NEWCASTLE DISEASE (ND) AND AVIAN INFLUENZA (AI) VACCINES INDUCE PROTECTIVE IMMUNE RESPONSE IN COMMERCIA Gusti Ayu Yuniati Kencana; I Nyoman Suartha; Ni Made Ayu Sintya Paramita; Arini Nur Handayani
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (109.72 KB)

Abstract

Newcastle disease (ND) and Avian Influenza (AI) are infectious diseases and still endemic in Indonesia.Prevention of the disease is conducted by vaccination of birds as the source of the infection. The use ofcombined ND-AI vaccine is expected to be able to prevent both diseases simultaneously. This study aimwas to determine the potency of combined ND-AI vaccine in field condition. Field trial vaccination wasconducted in commercial layer chickens in Tabanan Bali, and the HI test was conducted at the Faculty ofVeterinary Medicine Udayana University, Denpasar. Field trial in commercial layer chickens showed thatthe average HI titer of ND sera from pre-vaccinated chickens was 22.7HI units and AI titer was 21.27 HIunits. The ND titers increased to 25.47 HI Unit, 27.0 HI units, and to 28.73 HI units, whereas AI titersincreased to 27.93 HI Unit, 28.53 HI units, and 28.47 HI units in two, three and four weeks post-vaccinationwith the ND-AI combined vaccine, respectively. Statistically, based on ND and AI antibody pre and postvaccination,it is indicated that the combined ND-AI vaccine was able to induce immune response higherthan the protective titer level (>24). Period of collecting the sera samples also affected the titer of NDVand AI antibodies (P<0.01). Therefore it is recommended that vaccination should be conducted at antibodytiter of < 4 HI Unit.
Karaterisasi Virus Avian Influenza Subtipe H5N1 Isolat Lapang Asal Bali Untuk Kandidat Vaksin Gusti Ayu Yuniati Kencana; I Nyoman Suartha; I Made Kardena; Arini Nurhandayani
Jurnal Veteriner Vol 21 No 4 (2020)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (155.103 KB) | DOI: 10.19087/jveteriner.2020.21.4.530

Abstract

A research on the isolation and characterization of the Avian Influenza H5N1 subtype field isolate has been carried out at the BSL-3 Laboratory of PT Sanbio Laboratories, Bogor. The aim of the study was to prepare a candidate for the H5N1 subtype Avian Influenza virus vaccine. Virus isolates were taken from field isolates from Bali. A total of seven field H5N1 AI subtypes from Bali were characterized in Bogor. The isolates were: isolate 3A, isolate 4A, isolate 9C, isolate 10 A, isolate 10 C, isolate P65, isolate P67. The passage of isolates was carried out on 9-day-old embryonic Specific Pathogenic (SPF) chicken eggs by injecting 0.1 mL of SPF isolates/eggs through the allantoic cavity. Each isolate was placed in five SPF eggs and then incubated in an incubator at 37 C and candled every day. Since day 2-4 post inoculation, embryo death has occurred. The eggs are harvested by their allantoic fluid and tested for haemagglutination test(HA/HI). The HI test results were confirmed by Reverse Transcriptase Polymerase Chain Reaction(RT-PCR) using the front primer FPHA232_13 (ATTGGTTAYCATGCAAAYAACTCG) and the back primer BPHA232_597 (GGAAAYATAGGTRGTTGGRTTYTGATAG) The results were five of the seven isolates were positive AI subtype B5 585 - 581 The five isolates of AI subtype H5N1 were subsequently sequenced, the results were all positive for AI virus subtype H5N1 clade 2.3.2. Each field isolate was given the name A / Chicken / Bali3A / GAY / 2019; A / Chicken / Bali9C / GAY / 2019; A / Chicken / BaliA4 / GAY / 2019; A / Chicken / Bali10A / GAY / 2016 and A / Chicken / Bali10C / GAY / 2019. One A / Chicken / Bali 9C / GAY / 2016 isolate was subsequently repeated 7 times until a stable H5N1 subtype AI virus titer was obtained. The results of matching with bioinformatics turned out that A / Chicken / Bali 9C / GAY / 2016 isolates had a kinship of 98.62% with AI subtype H5N1 Banyuwangi, amounting to 98.45% with AI subtype H5N1 Lamongan, amounting to 98.10% with AI-H5N1 Lumajang, 97.58% with AI-H5N1 Kediri, 97.07% with AIH5N1 Blitar, 96.72% with AI-H5N1 Denpasar, 96.72% with AI-H5N1 Buleleng and 96.72% with AI-H5N1Sukoharjo. The conclusion is one of isolate namely A / Chicken / Bali 9C / GAY / 2019 including AI subtype H5N1 clade 2.3.2, is’t stable at passage on SPF eggs, has a kinship of 96.72% with A / duck / Sukoharjo / BBVW-1428- 9/2012, the virus content is 106.9 ELD50 so it is potential for vaccine candidates.
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

Abstract

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Pengaruh Perbedaan Waktu Pemberian Premedikasi Xylazine dengan Ketamine dalam Pembiusan Anjing Lokal (EFFECT OF TIME DIFFERENCES OF XYLAZINE ADMINISTRATION AS PEMEDICATION FOR ANESTHESIA WITH KETAMINE IN LOCAL DOGS) Kristina Kristina; I Nyoman Suartha
Jurnal Veteriner Vol 4 No 2 (2003)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (2979.787 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Pembiusan Monyet Ekor Panjang (Macaca fascicularis) Jantan dengan Campuran Ketamin dan Xilazin pada Topografi Daerah Berbeda (THE ANAESTHETIZATION OF LONG TAILED MACAQUE (MACACA FASCICULARIS) BY KETAMINE-XYLAZINE ON DIFFERENT TOPOGRAPHIC AREA) I Nyoman Suartha; I Gusti Agung Arta Putra; I Nengah Wandia
Jurnal Veteriner Vol 4 No 1 (2003)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3543.398 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Co-Authors A A N G D Wisesa A A N O Pujawan A A S I Pradnyantari Abram Hary Batistuta Adi Setiawan Adnyana, Ida Bagus Nararya Primastana Agatha Seren Lumban Tobing Agatha Serena Lumban Tobing Aida Lousie Tenden Rompis Alya Nita Shena Gayanti Anak Agung Ayu Mirah Adi Anak Agung Gde Oka Dharmayudha Anak Agung Sagung Istri Pradnyantari Anak Agung Sagung Kendran Anak Agung Sagung Kendran Ananta, Muhammad Ghufron angelina serlin Anita Dwi Handayani Annisa Budiani Annisa Putri Cahyani Annisa Putri Cahyani Apriliana, Kadek Soma Arini Nur Handayani Arini Nur Handayani Arini Nurhandayani Arini Nurhandayani Ayu Fitriani Baiq Indah Pertiwi Bambang Pontjo Priosoeryanto Bhakty, Zatya Wira Bhaskara, Audrey Febiannya Putri BIBIANA W LAY Boro, Saptarima Eka Estiani Cahyaniarta, I Kade Candra Cyrilus Jefferson Bour Daniel Raja Bonar Nainggolan Dewa Odiec Purnawan Dewanti, Desak Gede Bintang Pradnya Dewi, Desak Made Wiga Puspita Dewi, Putu Ayu Purbani Novia Diana Mustikawati Duarsa, Bima Satya Agung DWI SURYANTO Dyah Utami Dewi EKA MAHARDHIKA RATUNDIMA Emy Sapta Budiari Eustokia Yulisa Madu, Eustokia Yulisa Fajar Mubarok Fatmawati Aras Fernandes, Nuno G.A.M.K. Dewi Gede Herdian Permana Putra Gusti Ayu Kencana Gusti Ayu Mayani Kristina Dewi Gusti Ayu Yunianti Kencana Gusti Ayu Yuniati Kencana Heparandita, Ananda Agung Dextra I Gede Soma I Gede Soma I Gusti Agung Arta Putra I Gusti Agung Ayu Suartini I Gusti Made Krisna Erawan I Gusti Made Krisna Erawan I Gusti Ngurah Badiwangsa Temaja I Gusti Ngurah Bagus Trilaksana I GUSTI NGURAH DIBYA PRASETYA I GUSTI NGURAH KADE MAHARDHIKA I Gusti Ngurah Kade Mahardika I Gusti Ngurah Mahardika I Gusti Ngurah Mahardika I Gusti Ngurah Narendra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra1, I Gusti Ngurah Narendra, I Gusti Ngurah I Gusti Ngurah Sudisma I GustiKetut Suarjana I K. SUATHA I KADEK SAKA WIRYANA I Ketut Eli Supartika I Ketut Gunata I Ketut Gunatha I Ketut Suada I Ketut Tomy Caesar Ramanda I Komang Wahyu Yuliana I Made Dira Swantara I Made Kardena I Made Merdana I Made Sukada I MADE SUMA ANTARA I Made Suma Anthara I Nengah Sudarmayasa i Nengah Wandia I NYOMAN MANTIK ASTAWA I Nyoman Suarsana I Nyoman Windhu Paramarta I Putu Gede Yudhi Arjentinia I Putu Indra Parmayoga I Putu Sudiarta I Putu Wira Adi Wibawa I W Y Semarariana I Wayan Batan I Wayan Bebas I Wayan Gorda I Wayan Suardana I wayan Teguh Wibawan I Wayan Wirata I. B. K. Suardana I.A.M.L. Dewi I.A.P. Apsari I.A.P. Gayatri I.B.K. Suardana I.G.A.A. Idayati I.H. Utama I.W. Batan Ida Ayu Dian Kusuma Dewi Ida Ayu Pasti Apsari Ida Ayu Sri Candra Dewi Ida Ayu Sri Chandra Dewi Ida Bagus Kade Suardana Ida Bagus Komang Ardana Ida Bagus Ngurah Swacita Ida Bagus Oka Winaya Ida Bagus Windia Adnyana Iman Bayu Prakoso Darmono Insani, Widia Iwan Harjono Utama Kadek Karang Agustina Kamaliana, Baiq Reni Ketut Budiasa Ketut Sepdyana Kartini Kevin Dominika Komang Andika Purnama Kristiana Yoaltiva Jinorati Kristina Kristina Ledi Natalia Surbakti Levina, Stephanie Luh Dewi Anggreni Luh Gde Sri Surya Heryani Luh Kadek Nanda Laksmi Luh Made Sudimantini Luh Made Sudimartini Lusiana Lasmari Siahaan Luwis, Jeremy Christian M P A Yunikawati M Windhu M.D. Rudyanto Madania, Reydanisa Noor MADE KOTA BUDIASA Made Ririn Sri Wulandari Made Suma Anthara Made Suma Anthara Margaretha Dhea Sinthalarosa Marmanto, Tessa Saputri Mawar Datu Allo Dendang Megariyanthi, Ni Putu Arie Melkias Oagay Melkias Oagay Muh Ramadhan Muhammad Ulqiya Syukron Musdalifa, Annisa Nareswari, Ayu Widya Nazara, Nonitema Nengah Tegar Saputra Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Ketut Suwiti Ni Komang Ade Juliantari Ni Luh Eka Setiasih Ni Luh Putu Dharmawati Ni Luh Putu Kusuma Clara Dewinda Ni Luh Putu Sriyani Ni Luh Putu Yunita Listiana Dewi Ni Luh Watiniasih Ni Made Ayu Sintya Paramita Ni Made Ernawati Ni Made Restiati Ni Made Rita Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi2 Ni Nyoman Werdi Susari Ni Nyoman Werdi Susari Ni Putu Ayu Dewi Wijayanti Ni Putu Tiara Indriana Ni Wayan Tatik Inggriati Norawigaswari, Nengah Desy Nyoman Sadra Dharmawan P S Dwipartha P T E Sucitrayani P.I.S.S. Oka P.K. Pebyanthi Patabang, Denselina Lilis Prasatya, I Gde Made Abdi Priska Mariane Serang Putrawan, Baja Sadhayu Putri Utami Putri, Ayu Chitra Adhitya Putu Adi Cahya Dewi Putu Adrian Junaedi Putu Ayu Sisyawati Putriningsih Putu Devi Jayanti Putu Gede Yudhi Arjentinia Putu Hendrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Rahim, M. Andry Ratu Shinta Mayasari Remontara, Al Afuw Niha Reny Septyawati Retno Damayanti Soejoedono Rui Daniel de Carvalho S.K. Widyastuti Sachio, Drevani Angelika Samosir, Hartina Saputra, I Nyoman Dwi Eka Saweng, Cikal Farah Irian Jati Sawitajaya, I Made Sayu Raka Padma Wulan Sari, Sayu Raka Padma Wulan Septianingsih, Ni Luh Putu Diah Sheira Tannia Welfalini Sibarani, Oktryna Hodesi Sitohang, Martina Tiodora Situmorang, Fernando Jose Immanuel Clinton Sri Kayati Widyastuti Sri Kayati Widyastuti Sry Agustina Suarniti, Ni Luh Putu Sukoco, Hendro Sutadisastra, Nisha Aisya Suwartini, Ni Komang Swandewi, Ni Kadek Meita Syamsidar Syamsidar Syarif Lalu Hidayatullah T. Sari Nindia Tahlia, Ninis Arsyi Taruklinggi, Utari Resky Tiara L Rona Tjok Gde Oka Pemayun Tjokorda Sari Nindhia TRI KOMALA SARI Tri Suci Galingging, Tri Suci Valerie Xylia Tay Vivi Indrawati Widyanti, Agnes Indah Wijaya, Dhyana Ayu Manggala Willy Moris Nainggolan Wirawan, I Gede WIWIK SUSANAH RITA Wulandari Wulandari Yekhonya Rehuel Sidjabat Yoana Pratiwi Clara Pakpahan Yoga Pratama Nuradi Yosaphat L.S Kote Zumara Mufida Hidayati