Claim Missing Document
Check
Articles

ANALYSIS SPECIFIC ACTIVITY OF XYLANASE ENZYME PRODUCED BY THE CONSORTIUM OF THERMOPHILIC BACTERIA FROM SAPAN SUNGAI ARO HOT SPRING Feby Yeriska; Mulia; Irdawati; Linda Advinda; Dwi Hilda Putri
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Thermophilic bacteria are bacteria that are able to survive in high temperatures ranging from 45 – 80oC so that they have the potential to produce enzymes that are stable against heat. Thermophilic bacteria can be found in various places in nature that have potential hot springs. One of the potentials of thermophilic bacteria in producing enzymes is the xylanase enzyme. Xylanase is able to hydrolyze xylan (hemicellulose) into xylo-olisaccharides and xylose. In the industrial world, xylanase enzymes are used as paper whiteners, increase the volume of bread, as juice purification, and are used in the manufacture of detergents. This research is a type of descriptive research that aims to determine the specific activity of the xylanase enzyme and the levels of xylanase protein produced by thermophilic bacteria SSA (Sapan Sungai Aro) with bacterial isolates SSA3, SSA4, SSA5, SSA6, SSA7, SSA8, SSA13, SSA14 and SSA15. The results showed that the bacterial isolates SSA3, SSA4, SSA5; isolates SSA6, SSA7, and SSA8; and SSA13, SSA14 and SSA15 respectively had specific activity of the xylanase enzyme with an average value of 0.1614 Unit/mg; 0.1638 Unit/mg and 0.1473 Unit/mg. The final measurement results showed that the highest specific activity of the xylanase enzyme was in the consortium of thermophilic bacteria isolates SSA6, SSA7, and SSA8 with an average of 0.1638 Unit/mg.
Pelatihan dan Pendirian Bank Sampah Ka Saro untuk Mendukung Pilot Project PHBS TP-PKK Tanjung Balik Azwir Anhar; Mades Fifendy; Eka Vidya Putra; Dwi Hilda Putri; Dezi Handayani; Irma Lailani Eka Putri; Gustina Indriati; Ganda Hijrah Selaras; Siska Alicia Farma
ABDI: Jurnal Pengabdian dan Pemberdayaan Masyarakat Vol 5 No 4 (2023): Abdi: Jurnal Pengabdian dan Pemberdayaan Masyarakat
Publisher : Labor Jurusan Sosiologi, Fakultas Ilmu Sosial, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/abdi.v5i4.490

Abstract

Masalah persampahan erat kaitannya dengan pertambahan penduduk, pertumbuhan ekonomi dan perubahan pola konsumsi masyarakat. Jumlah penduduk Nagari Tanjung Balik saat ini lebih kurang 2.411 jiwa, sehingga prediksi timbulan sampah adalah sebesar 38,57 m2 per hari. Penyebab utama dari persoalan prioritas nagari ini adalah belum tersedianya TPS dan Bank Sampah di Nagari Tanjung Balik. Tujuan pengabdian ini adalah mendampingi masyarakat dalam membentuk bank sampah, sekaligus menjadi salah satu program unggulan dalam pilot project PHBS Tim Penggerak PKK. Metode yang digunakan dalam kegiatan pengabdian ini adalah metode pendampingan partisipatif. Hasil kegiatan pengabdian berhasil mendirikan bank sampah yang diberi nama Ka Saro. Berdasarkan analisis angket terhadap masyarakat sasaran menunjukkan hasil bahwa terdapat peningkatan pengetahuan, sikap dan keterampilan masyarakat mitra terhadap pengelolaan sampah di Nagarinya. Hasil observasi di lapangan juga menunjukkan antusias yang tinggi dari masyarakat yang menjadi nasabah Bank Sampah Ka Saro. Jumlah nasabah hingga saat ini adalah 100 orang nasabah aktif.
Primers Designed For Amplifying TCF7L2 Gen S. Syamsurizal; Hengki Saputra; Dwi Hilda Putri; Elsa Badriyya
Biota Vol 6 No 2 (2020): Jurnal Biota 2020
Publisher : Faculty of Science and Technology Universitas Islam Negeri Raden Fatah Palembang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19109/10.19109/Biota.v6i2.5871

Abstract

Diabetes Mellitus (DM) is a disease characterized by high glucose levels because of the lack of insulin hormone in the body. Prevalence of Type-2 Diabetes Mellitus is associated with the variant of the TCF7L2 gene polymorphism, or SNP. The purpose of this study was to construct a specific primer to amplify the TCF7L2 gene fragment and their capabilities to detect the targeted area. This research was a descriptive study that design the primers using Geneious software version 5.4.7. The study was conducted at the Laboratory of Genetics and Biotechnology FMIPA Universitas Negeri Padang. Based on this research, a 10qF forward primer (NG_012631.1) and 10qR reverse primers (NG_012631.1) has successfully designed. The primers can amplify the targeted area of the TCF7L2 gene with 1208 bp length. The amplified gene region has many variants that are strictly related to the appearance of Type 2 Diabetes Mellitus.
Morphological Response of Several Rice Varieties to Drought Stress Simulation using PEG Rezi Nabilah; Afifatul Achyar; Zulyusri Zulyusri; Yusni Atifah; Dwi Hilda Putri; Violita Violita
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.122676

Abstract

Rice has become food for most of the world's population. Indonesia is the third largest producer in the world. However, in fact rice production in Indonesia has decreased by 0.43% compared to 2020. One of the factors that can cause this decline is drought. Because rice is a semi-aquatic plant that grows normally in flooded conditions, it makes drought stress very threatening. Drought stress that occurs in plants causes plants to experience oxidative stress due to excessive accumulation of ROS. PEG is a compound that is widely used to provide drought conditions in plants. Previous research has classified several varieties of rice plants based on their level of resistance to drought. However, it is not yet known how the morphological response will be in different periods of drought stress and rewatering treatment. This research was conducted by giving treatment in the form of control (Yoshida nutrient culture solution) and drought stress (Yoshida + PEG-6000 20% solution) repeated 3 times. The observed parameters were RWC which were analyzed using standard errors and morphological images of roots and leaves. The results showed that the RWC obtained during the stress period from the third to the fifth day, Harum had the highest value according to its class as tolerant rice. After rewatering Rosna has a better recovery ability. In addition, root morphology shows differences in the form of root length, small root diameter, inhibition of adventive root growth. On the leaves include a decrease in leaf area, leaf curl up, and leaf yellowing.
Sulam Project: Tuberculosis (TB) Health Education for Primary School Students as a community service collaboration between the Department of Biology FMIPA UNP and UPSI Malaysia Yosi Laila Rahmi; Elsa Yuniarti; Helsa Rahmatika; Dwi Hilda Putri; Heffi Alberida; Syakirah binti Samsudin
Pelita Eksakta Vol 6 No 2 (2023): Pelita Eksakta, Vol. 6, No. 2
Publisher : Fakultas MIPA Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/pelitaeksakta/vol6-iss2/7

Abstract

Tuberculosis (TB) is a global issue that is a priority in both Indonesia and Malaysia. Since being designated by WHO at 1993 as a global public health threat, Tuberculosis (TB) has become one of the top 10 leading causes of death worldwide. Recently, the number of Tuberculosis (TB) patients in Indonesia has increased, especially paediatric TB cases. In addition, Tuberculosis (TB) cases also increased in Malaysia. For the West Sumatra region, the highest number of TB patients is in Padang City. Since Tuberculosis (TB) is a disease that can affect anyone including children, the school environment as one of the places where children gather and interact has the opportunity to be a place for the spread of TB cases as well as having an important role in preventing TB transmission. However, in reality, the role of schools in early prevention efforts related to Tuberculosis (TB) disease in children, especially elementary school students, is still not optimal. In line with this, Tuberculosis (TB) disease is closely related to the human respiratory system which is one of the topics discussed in the human anatomy and physiology course in the MBKM activity between the Department of Biology FMIPA UNP and the Department of Biology UPSI. Therefore, it is necessary to make preventive efforts in the form of Tuberculosis prevention education. The results of community service are that several stages of community service activities have been carried out regarding Tuberculosis (TB) prevention education for elementary school students, namely the students involved are enthusiastic about the activities held, then pre-service biology teacher are also actively engaged in preparing and carrying out this activity and students' knowledge related to general knowledge, symptoms, their relationship with the respiratory system and prevention efforts are classified as good.
Isolation and Identification of Lactic Acid Bacteria Using PCR Gene from Tempe Wrapped with Banana Leaves and Plastic Fevria, Resti; Vauzia, Vauzia; Putri, Dwi Hilda; Achyar, Afifatul; Putri, Santi Diana; Edwin, Edwin
Indonesian Food Science and Technology Journal Vol. 7 No. 2 (2024): Volume 7 Number 2, July 2024 |IFSTJ|
Publisher : Department of Technology of Agricultural product (THP) Jambi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22437/ifstj.v7i2.32503

Abstract

Tempe is a typical Indonesian food that comes from fermenting soybeans with the fungus Rhizopus sp. Tempe is known to have good nutritional value because of the content contained in soybeans themselves and other microorganisms that appear as a result of the tempe fermentation process. The fermentation process increases the activity of bacteria in tempe which are beneficial for digestion, one of which is lactic acid bacteria. This research aims to see the differences morphological forms  and genomic of lactic acid bacteria produced by tempe wrapped in banana leaves and tempe wrapped in plastic. The differences in fermentation that occurred in tempe wrapped in banana leaves and those wrapped in plastic resulted in differences in lactic acid bacteria type. Based on the isolation of bacteria on Mann de Rogosa Sharpe Agar medium, 15 isolates of lactic acid bacteria were produced, with general morphological forms of bacilli and coccus. Then, genomic identification was carried out using the PCR. The phylogenetic tree built based on the 16S rRNA gene sequence can show the relationship between LAB diversity at the species level, but cannot differentiate LAB from the strain level.
Molecular Characteristics of Cassava Carvita 25 Somaclonal Variant Using SSR Marker Hartati, Hartati; Ramadanti, Nur Ayu; Putri, Dwi Hilda; Hartati, N. Sri
Jurnal ILMU DASAR Vol 21 No 2 (2020)
Publisher : Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/jid.v21i2.9396

Abstract

Cassava is one of the most important food commodities besides rice and corn. Carvita 25 is a somaclonal variation that was induced from Adira IV cassava variety. Our study aimed to analyze the genetic differences of Carvita 25 compared to Adira IV by using SSR markers. Two cassava varieties, Carvita 25 and Adira IV, were used as plant materials and eleven SSRY primers were used to amplifythe fragments of cassava DNA. The results showed that SSRY 151 primer produced the highest polymorphic band (85.71%) where 6 out of 7 alels were polymoprphics with the length size from 120 to 600 bp. Of the total 56 of polymorphic bands, 26 alels were previously present in Adira IV but then it can not be found in Carvita 25, while 30 other bands were new fragments that were previously not present in Adira IV but then were present in Carvita 25. These genetic differencesof both Adira IV and Carvita 25 were also strengthened by the Jacard similarity value. The Jaccard similarity between Carvita 25 and Adira IV were 0.40-0.50, while the similarity between plants of Carvita 25 were 0.79-0.87, and in plants of Adira IV were 0.98- 1.These values showed thewide genetic difference between Adira IV and a somaclonal variation of Carvita 25.Keywords: cassava, Carvita 25, polymorphic, somaclonal variation, SSR Marker.
Primer Design and Annealing Temperature Optimization for Catalase (CAT) Gene Amplification in Rice (Oryza sativa L.) Yulita, Nelfi; Violita; Achyar, Afifatul; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.222

Abstract

Catalase (CAT) is an antioxidant enzyme that plays an important role in plant growht and defense against abiotic stress, one of which is rice (Oryza sativa). When plants are under abiotic stress conditions, the CAT gene will be regulated and expressed as a form of defense response to stress. To determine the expression of this CAT gene, optimal primers and annealing temperatures are needed to spesifically amplify the CAT gene. This study aims to design primers and determine the optimal annealing temperatures to amplify the CAT gene. Primers are designed using the tools pick primer, primer BLAST and geneious prime. Primers are designed in silico and must meet the ideal primer criteria because they will be used in vitro. Optimization of the annealing temperature was carried out using a PCR temperature gradient. The results of this study obtained a pair of primers, namely forward primer 5’-ATAAGTAGGGCGGTGTGTGG-3’ with a primer length of 20 bp, and reverse primer 5’-GCGAGTTGTTGTTGTTCCATAC-3’ with a primer length 22 bp. This primer pair produces a 185 bp amplicon in the Oryza sativa CAT gene. The optimum annealing temperature for this primer pair is 60ºC.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
The Role of Phosphate Solubilizing Bacteria in Sustainable Agriculture Arlina, Sistika; Advinda, Linda; Chatri, Moralita; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.338

Abstract

The repeated and unwise use of chemical fertilizers agricultural land can cause various negative impacts such as disrupting natural microbes and losing soil fertility. Phosphate solubilizing bacteria are soil bacteria that can convert phosphate from insoluble to soluble so that it can be absorbed by plants. Phosphate solubilizing bacteria play an important role in increasing plant productivity. Although the availability of phosphorus (P) in soil is in high concentrations, only 0.1% of the total phosphorus is available to plants and represents a small portion of the total in the soil. This occurs because of the low level of solubility of phosphorus and its fixation ability in the soil with several other metal elements in the soil such as Al, Ca, Fe to form aluminum phosphate, calcium phosphate and iron phosphate. There is no availability of phosphate for plants so that the role of phosphate-soluble bacteria is needed which plays a role in providing phosphate for plants so that it can increase agricultural yields. Phosphate solubilizing bacteria have great potential as biofertilizers because they can increase the bioavailability of phosphorus for plants, promote sustainable agriculture, and increase soil fertility, and increase crop yields.
Co-Authors Abdul Razak Abdul Razak Abdul Razak Abdul Razak Achyar, Afifatul ADE ANDRIANI AERMA HASTUTY Afifatul Achyar Afionita, Santi Afroza, Faiza Ahmad Wibisana, Ahmad Albar, Rahmat Alfatimah Azzahra, Balkis Amanda, Nifsa Riski Annisa Irna Putri Annisa Khaira Arlina, Sistika Armen Armen Atifah, Yusni Aulia Yunita Aulia, Ony Nattasha Aura Iga Maharani Az-Zahra, Fauziah Azwir Anhar Berlinda Paradisa, Yashanti Cania Dewi, Rahmawitra Chatri, Moralita Chatri Cindy Pramila Darussyamsu, Rahmawati Des M Dezi Handayani Dezi Handayani Dina Sukma dina vaniana Dinda Sahara Djoelvinanda, Habibullah Echa Azkia Afandi Edwin Edwin Efliani Efliani Eka Vidya Putra Elsa Alfiyanti Elsa Badriyya Elsa Yuniarti Fahra Fahra Fatma Rahmadhani Febri Doni Febrina Anggiastanti Feby Yeriska Fevria, Resti Fhuji Winardi Fhuji Winardi Fira Safitri Fira Safitri Fransisco, Sandi Fronica, Imelda Ghiffari, Muhammad Gustina Indriati Hartati Hartati Heffi Alberida Helsa Rahmatika Hengki Saputra Herman, Reni Herman, Reni Husnul Khatimah Intan Febriani IRDAWATI Irdawati Irdawati Irdawati Irdawati Irdawati Irdawati Irma Lailani Eka Putri Irma Leilani Eka Putri Irma Leilani Eka Putri Irvan Faizal IWAN SASKIAWAN Jamhari Jamhari Jannah Koftiah Jihan Rezi Okanti Kardiman, Reki Karlini Oktarina Kiki Amelia, Kiki Larasati Arum Utami Linda Advinda Linda Advinda Lufri Lufri Mades Fifendy Mahjani Mahjani Maiyusri Eka Putri Marissa Angelina Maulia Indah Ayuningtyas Mellani Rachma Miftahul Jannah Miftahul Rahmi Moca Faulina putri Monhartini Monhartini Moralita Chatri Muhyiatul Fadilah Muhyiatul Fadilah Mukhlis Mukhlis Mukhtar Mukhtar Mulia Mulia Mulia mutia anika Mutia Anika N. Sri Hartati, N. Sri Nabilah, Rezi Nada Nafion Nadia Ndaru Andri Damayanti Nisa Afifah Novitasari, Yuliana Diyah Nur Ayu Ramadanti Nur Helmi Nur Shofiatun Nisa Nur Vaizi Nurfadillatun Nisa Wijaya Nurhelmi Nurhelmi Nurul Pratiwi Nurul Rahmi Pratama, Chelsylia Dara Pratama, Sandi Fransisco Prima, Rika Putri Rachma Auliya Putri, Aulia Devani Putri, Cici Adelia Putri, Irma Leilani Putri, Irma Leilani Eka Putri, Isna Aryunita Putri Putri, Rani Dwi Suci Putri, Santi Diana Quratul Akyuni Rachmayati, Rike Rahmadhani Fitri Rahmat Afif Rahmatul Huda Asra Rahmawati Darussyamsu Rahmawita Rahmawita Rahmawita Rahmawita Rahmi Holinesti Rahmi, Elva Ramadanti, Nur Ayu Ramadhan Sumarmin Ramadhan Sumarmin Ramadhan Sumarmin Rani Dwi Suci Hd Putri Ratih Rahayu Relsas Yogica, Relsas Resma Wahyuni Resti Desmayanti Rezi Nabilah Rhavy Ferdyan Rhini Febrianti Rinti Mutiara Sari Riri Apriyanti Riri Apriyanti S. Syamsurizal Salmi Halen Salsabilla, Vishtari Samsuriani Siregar Santosa, Tomi Apra Satria, Rijal Selaras, Ganda Hijrah Shinta Sari Maria Silviana Okwisan Sirwati, Fadila Sisca Alicia Farma Siska Alicia Farma Sisri Yandila Siti Aisyah Siti Helmyati Sity Sarroh SOLICHATUN SOLICHATUN Sri Okta Handayani Suhaimi . Sulistiani Sulistiani, Sulistiani Syakirah binti Samsudin Syifa Kamila Namidya Tiffany Mantoviana Tomi Apra Santosa Tomi Apra Santosa Santosa Valofi, Nagra Aulia Vauzia, Vauzia Vestimarta, Aldi Wahyuda Violita Violita Violita Violita Violita Viona, Alda Wahyuni Wahyuni wahyuni wahyuni Widya Ruchi Wilna Sari Wirda Taufik Yatnita Parama Cita Yolanda Ruhul Azomi Yosi Laila Rahmi Yulita, Nelfi Yuni Ahda Yuni Ahda Yuni Ahda Yuni Ahda Yuni Ahda Yusrizal Yusrizal Yusrizal Yusrizal Zahara Nurfatihah Z Zakri, Dwika Febriana Zuhratul Mardiyah Amir Amir Zulyusri Zulyusri Zulzusri, Zulzusri