Article Per Year (5 Year)
p-Index From 2021 - 2026
9.637
P-Index
This Author published in this journals
All Journal Jurnal Biologi Udayana Bioscience Bioeducation Journal Jurnal Ilmu Dasar AL KAUNIYAH Jurnal Biotek Medisiana Indonesia Althea Medical Journal Biota Biomedika BIO-SITE |BIOLOGI Sains Terapan Jurnal Penelitian dan Pembelajaran IPA Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Indonesian Food Science and TechnologyJournal Jurnal Agrotek Tropika Bio-Lectura Eksakta : Berkala Ilmiah Bidang MIPA Jurnal Ilmu Kefarmasian Indonesia AL-ULUM: JURNAL SAINS DAN TEKNOLOGI Atrium Pendidikan Biologi Serambi Biologi Majalah Kesehatan Pharmamedika Pelita Eksakta Abdi: Jurnal Pengabdian dan Pemberdayaan Masyarakat Sainstek : Jurnal Sains dan Teknologi Jurnal Biogenerasi IJECA (International Journal of Education and Curriculum Application) Suluah Bendang: Jurnal Ilmiah Pengabdian Kepada Masyarakat Jurnal Biosense Halal Research Journal TROPICAL GENETICS Scientific Journal MASALIQ: Jurnal Pendidikan dan Sains Tropical Genetics Jurnal Serambi Biologi Berita Biologi
Dwi Hilda Putri
Universitas Negeri Padang
Religion Agriculture, Biological Sciences & Forestry Humanities Astronomy Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Education Energy Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Mechanical Engineering Medicine & Pharmacology Physics Public Health Social Sciences Veterinary Other

Published : 109 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 109 Documents
Search

 6   7   8   9   10 
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
The Role of Phosphate Solubilizing Bacteria in Sustainable Agriculture Arlina, Sistika; Advinda, Linda; Chatri, Moralita; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.338

Abstract

The repeated and unwise use of chemical fertilizers agricultural land can cause various negative impacts such as disrupting natural microbes and losing soil fertility. Phosphate solubilizing bacteria are soil bacteria that can convert phosphate from insoluble to soluble so that it can be absorbed by plants. Phosphate solubilizing bacteria play an important role in increasing plant productivity. Although the availability of phosphorus (P) in soil is in high concentrations, only 0.1% of the total phosphorus is available to plants and represents a small portion of the total in the soil. This occurs because of the low level of solubility of phosphorus and its fixation ability in the soil with several other metal elements in the soil such as Al, Ca, Fe to form aluminum phosphate, calcium phosphate and iron phosphate. There is no availability of phosphate for plants so that the role of phosphate-soluble bacteria is needed which plays a role in providing phosphate for plants so that it can increase agricultural yields. Phosphate solubilizing bacteria have great potential as biofertilizers because they can increase the bioavailability of phosphorus for plants, promote sustainable agriculture, and increase soil fertility, and increase crop yields.
Efektivitas Larvasida Alami Ekstrak Daun Alpukat (Persea americana Mill.) dengan Teknologi Nano terhadap Mortalitas Larva Aedes aegypti L. Cania Dewi, Rahmawitra; Razak, Abdul; Satria, Rijal; Hilda Putri, Dwi
Jurnal Serambi Biologi Vol. 9 No. 2 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i2.357

Abstract

One of the vectors of dengue fever, the Aedes aegypti mosquito, can be controlled by using synthetic chemical mosquito repellents such as 1% abate (temephos). However, the continuous use of abate 1% can cause water pollution and human poisoning. To overcome the side effects of using synthetic larvicides, plant extracts can be used as natural larvicides, one of which is avocado leaf. One of the efforts to increase the content of active ingredients in avocado leaves can be done by using nano bubbles. This study aims to determine the effectiveness of avocado leaf extract (Persea americana Mill.) on the mortality of Aedes aegypti larvae. This study used a completely randomized design (CRD). There are Control+ and Control- and 3 treatments in the form of avocado leaf extract diluted with nanobubble water with concentrations of 5%, 10% and 15%. The test material used in this study was Aedes aegypti instar III mosquito larvae. Observations were made for 48 hours. Data were analyzed by probit analysis to determine LC50 and LT50, One Way ANOVA and Post Hoc BSD test. The results showed significant differences (P < 0.05). The results of probit analysis obtained LC50 is 5.326% and LT50 value is 35 hours. The conclusion of this study is that avocado leaf extract natural larvicide with nano technology is effective on the mortality of Aedes aegypti larvae.
Senior High School Biology Teachers’ Perception towards Evolution Learning Darussyamsu, Rahmawati; Wahyuni, Resma; Fitri, Rahmadhani; Fadilah, Muhyiatul; Putri, Dwi Hilda; Mukhtar, Mukhtar
Jurnal Penelitian dan Pembelajaran IPA Vol 5, No 2 (2019): Available Online in November 2019 (Web of Science Indexed)
Publisher : Department of Science Education, Universitas Sultan Ageng Tirtayasa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30870/jppi.v5i2.3335

Abstract

Teachers’ perception of a particular material is an influential aspect of the way teachers learn the material.  Since evolution is a debating material, teachers affected by this condition when they teaching the evolutionary topic. For those reasons, this descriptive study aimed to identify teachers’ perception of evolution learning, which consists of four main aspects: learning material, strategy, sources, and assessment. The population is all biology teachers at Padang, Sumatera Barat, Indonesia. Sampling was taken by purposive sampling, with criteria biology teachers that already taught the evolutionary topic in senior high school. Data collected from the questionnaire and analyzed descriptively in percentage. The result showed that for the majority of biology teachers at Padang have perceptions toward four aspects of evolution learning in a category very good, good, and good enough. In details, more concerns are needed for some less valued descriptor related to the contradiction issue between evolution theory and Islamic beliefs. In the average, each score of perception for four aspects are: learning material 3.71; strategies 4.11; sources 3.64; and assessment 3.92 with all average criteria in good category. Each aspect performed is discussed.
Isolasi dan Karakterisasi Bakteri Asam Laktat (BAL) pada Fermentasi Durian Montong (Durio zibethinus Murr.) Viona, Alda; Fevria, Resti; Irdawati, Irdawati; Putri, Dwi Hilda
MASALIQ Vol 4 No 1 (2024): JANUARI
Publisher : Lembaga Yasin AlSys

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58578/masaliq.v4i1.2636

Abstract

Lactic acid bacteria is a group of bacteria that produce lactic acid as the main product in fermentation. Tempoyak is a processed durian fruit product made by anaerobic spontaneous fermentation for 3-7 days. The fermentation process that occurs in making tempoyak is lactic acid fermentation. Carbohydrates are broken down into glucose, then BAL will ferment the glucose to produce lactic acid (main product), ethanol and CO2 (by-product). The aim of this research was to isolate lactic acid bacteria (LAB) from fermented durian. This research method is descriptive. 8 BAL isolates were obtained and identified macroscopically and microscopically by gram staining method. Based on the research that has been done, colonies of gram-positive bacteria in the form of bacilli and coccus cells were obtained. Gram-positive bacteria have cell wall characteristics with thicker peptidoglycan so that color absorption from violet crystals absorbed in cells will survive.
Literature Review: Benefits and applications of alginate liase enzyme) Sirwati, Fadila; Putri, Dwi Hilda; Rachmayati, Rike
Bioscience Vol 8, No 2 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i2.131077

Abstract

Alginate is a polymer found in large amounts in the cell walls of brown algae. This polymer consists of α-L guluronic acid (G) and mannuronic acid (M). Alginate can be degraded by an enzyme, known as alginate liase by removing the glycosidic bond and producing an unsaturated oligosaccharide with a double bond at the non-reducing end. To provide an overview of the utilization of alginate lyase, information is needed on the biological activity of alginate lyase as an antibiofilm agent, the production of alginate oligosaccharides, and its antioxidant properties. This study aims to provide scientific insight into the important role of the benefits and applications of alginate lyase. The research design used was a literature review. Articles were collected based on sources from PubMed, Science Direct, and Google Scholar, which included more than thirty national and international journals. The articles collected showed that alginate lyase exhibits many biological activities, including antibiofilm, antioxidant, and oligosaccharide production. These properties have the potential to be used in a wide range of applications, which include the food, pharmaceutical, and biotechnology industries.
Development and Optimization of SARS-CoV-2-Specific Primers for Accurate Diagnosis: A Case Study in West Sumatra - Indonesia Aulia, Ony Nattasha; Putri, Dwi Hilda; Faizal, Irvan
Althea Medical Journal Vol 11, No 4 (2024)
Publisher : Faculty of Medicine Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15850/amj.v11n4.3348

Abstract

Background: In 2022, new cases of Covid-19 emerged, including the Omicron variant which is classified as a variant of concern (VOC). West Sumatra is one of the top ten provinces with the highest number of cases in Indonesia. This study aimed to design specific primers and optimize the PCR method that can be used for accurate detection, specifically for SARS-CoV-2 circulating in West Sumatra.Methods: This study used an in silico approach, using whole genome sequencing (WGS) data available at the global initiative on sharing avian influenza data (GISAID), and employing the Geneious Prime application which confirmed samples collected from Padang, West Sumatra, and from Jakarta, Bogor, Depok, Tangerang, Bekasi (Jabodetabek) serving as comparative sample tests. Technology development was supported by bioinformatics testing, laboratory testing, and validation methods, involving gene mining, sequence alignment, and primer design. Laboratory tests and validation included viral genomes extraction and cDNA synthesis, polymerase chain reaction (PCR) testing, and results analysis. Results: Three sets of optimal primer candidates amplified the coveted target gene was discovered, specifically, the S gene of the receptor binding domain (RBD) region.Conclusions: The primers designed through a consensus between the complete genome of the SARS-CoV-2 isolate Wuhan-Hu-1 and the WGS of the Omicron variant in Padang, West Sumatra, have successfully detected the SARS-CoV-2 virus variant in the region. The most effective temperature optimization results were achieved by testing three primer products on samples from Padang and Jabodetabek. It has significance as a valuable diagnostic tool in the primer form.
Antibiotic Sensitivity Test Against Soil Bacteria Exposed to Disinfectants in 2x11 Kayu Tanam District, Padang Pariaman Regency, West Sumatera Prima, Rika; Vestimarta, Aldi Wahyuda; Putri, Dwi Hilda
Jurnal Serambi Biologi Vol. 9 No. 3 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i3.367

Abstract

In Indonesia, the population growth rate is high and requires rapid and sustainable improvements in the agricultural sector. Improvements in the agricultural sector require various supporting facilities, namely agricultural tools, fertilizers, chemicals including pesticides. Pesticides are chemicals or mixtures of several chemicals that are used to control or eradicate plant pest organisms. Specific uses are an inseparable part of the agricultural system. Pesticides are used as a preventive measure to control pests/diseases. The research carried out included testing on soil samples, testing bacterial turbidity, and testing inhibition zones using antibiotics. This research is descriptive research. This research was carried out from March to June 2023, at the Research Laboratory, Department of Biology, Faculty of Mathematics and Natural Sciences, Padang State University. From the research carried out on soil sample tests, what was observed was the color, shape, height and edges of each different type of bacterial colony. The turbidity test was obtained in accordance with Macfarlan standards. Then the zone inhibition test uses antibiotics which use positive, negative and spectrum antibiotics. From the table of inhibition zones that are formed, it can be seen that in each bacterial colony, each antibiotic works according to the type of antibiotic, positive antibiotics inhibit the growth of gram-positive bacteria and negative antibiotics inhibit the growth of gram-negative bacterial colonies, while spectrum antibiotics can inhibit the growth of gram-positive bacteria and bacteria. gram negative.
META-ANALISIS: EFEKTIFITAS PEMBERIAN PAKAN BUATAN UNTUK MENINGKATKAN LAJU PERTUMBUHAN DAN KUALITAS REPRODUKSI SPESIES Monopterus albus Santosa, Tomi Apra; Putri, Rani Dwi Suci; Sumarmin, Ramadhan; Putri, Dwi Hilda
Eksakta : Jurnal Penelitian dan Pembelajaran MIPA Vol 6, No 2 (2021): Eksakta : Jurnal Penelitian dan Pembelajaran MIPA
Publisher : Fakultas Keguruan Dan Ilmu Pendidikan, UM-Tapsel

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31604/eksakta.v6i2.222-227

Abstract

This study aims to determine the effectiveness of artificial feeding on the growth and reproduction rate of Monopterus Albus species. This research is meta-analysis research. The data source comes from a search of 18 national and international articles published in 2010-2020 related to feeding the Monopterus albus species. Data obtained from google scholar database, DOAJ, ScienceDirect, sagejournal, Springer, and IEEE. The data analysis technique is a qualitative descriptive analysis with JASP software. The results showed that 35% of artificial feeding affected the growth of Monopterus albus and 28.5% affected the reproductive rate with an effect size of 1.2. This shows that artificial feeding is effective in increasing the growth and reproductive quality of Monopterus albus.
LITERATUR REVIEW: SENYAWA AKTIF TUMBUHAN YANG EFEKTIF SEBAGAI PESTISIDA NABATI UNTUK PENGENDALIAN PENYAKIT TANAMAN Nadia; Chatri, Moralita; Advinda, Linda; Putri, Dwi Hilda
JURNAL BIOSENSE Vol 8 No 1 (2025): Edisi Januari 2025
Publisher : Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas PGRI Banyuwangi, Jalan Ikan Tongkol No 01, Telp (0333) 421593, 428592 Banyuwangi 68416

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36526/biosense.v8i1.5028

Abstract

Abstrak Perlunya pengendalian penyakit tanaman yang ramah lingkungan mendorong dikembangkannya fitopestisida berbahan aktif senyawa tanaman. Senyawa aktif seperti alkaloid, flavonoid, saponin, tanin dan minyak atsiri terbukti efektif mengendalikan patogen tanaman sekaligus mengurangi efek negatif pestisida kimia. Senyawa tersebut berasal dari bagian tumbuhan seperti akar, batang, daun, bunga dan buah. Penelitian ini bertujuan untuk mengumpulkan dan menganalisis artikel terkait efektivitas senyawa aktif pada tanaman sebagai pestisida nabati. Perancangan menggunakan literatur review yang dikumpulkan melalui mesin pencari seperti PubMed, Google Scholar, dan ScienceDirect. Kriteria artikel yang digunakan adalah artikel terbitan tahun 2019 hingga 2024 yang membahas tentang penggunaan pestisida tanaman untuk mengendalikan penyakit tanaman. Hasil analisis menunjukkan bahwa senyawa aktif pada tanaman dapat menghambat pertumbuhan patogen dengan berbagai cara, misalnya dengan merusak membran sel patogen, mengganggu metabolisme, dan menghentikan beberapa enzim. Oleh karena itu, pestisida nabati dapat digunakan untuk pertanian organik dan kelestarian lingkungan.
Co-Authors Abdul Razak Abdul Razak Abdul Razak Abdul Razak Achyar, Afifatul ADE ANDRIANI AERMA HASTUTY Afandi, Echa Azkia Afionita, Santi Afroza, Faiza Ahmad Wibisana, Ahmad Albar, Rahmat Alfatimah Azzahra, Balkis Amanda, Nifsa Riski Andri Damayanti, Ndaru Annisa Irna Putri Annisa Khaira Arlina, Sistika Armen Armen Astrid Atifah, Yusni Aulia Yunita Aulia, Ony Nattasha Aura Iga Maharani Ayuningtyas, Maulia Indah Az-Zahra, Fauziah Azwir Anhar Benny Alexander Maisa Berlinda Paradisa, Yashanti Cania Dewi, Rahmawitra Chatri, Moralita Chatri Cindy Pramila Darussyamsu, Rahmawati Des M Dezi Handayani Dezi Handayani Dina Sukma dina vaniana Dinda Sahara Djoelvinanda, Habibullah Edwin Edwin Efliani Efliani Eka Nuraini, Fauzi Eka Vidya Putra Elsa Alfiyanti Elsa Badriyya Elsa Yuniarti Fadilaturahmah Fadilaturahmah Fahra Fahra Fahra, Fahra Farras, Fadhila Annisa Fatma Rahmadhani Febri Doni Febrianti, Liza Febrina Anggiastanti Feby Yeriska Fevria, Resti Fhuji Winardi Filza Yulina Ade Fira Safitri Fransisco, Sandi Fronica, Imelda Fuadiyah, Sa’diatul Ghiffari, Muhammad Gustina Indriati Handayani , Dezi Hartati Hartati Heffi Alberida Helsa Rahmatika Hengki Saputra Herman, Reni Herman, Reni Husnul Khatimah Intan Febriani IRDAWATI Irdawati Irdawati Irdawati Irdawati Irdawati Irdawati Irma Lailani Eka Putri Irma Leilani Eka Putri Irma Leilani Eka Putri Irvan Faizal IWAN SASKIAWAN Jamhari Jamhari Jannah Koftiah Jihan Rezi Okanti Kardiman, Reki Karlini Oktarina Kheniva Diah Anggita Kiki Amelia, Kiki Larasati Arum Utami Linda Advinda Lufri Lufri Mades Fifendy Mahjani Mahjani Maiyusri Eka Putri Mantoviana, Tiffany Mardhiyah Nazri, Laila Marissa Angelina Marten, Threo Wanda Mellani Rachma Miftahul Jannah Miftahul Rahmi Moca Faulina putri Monhartini, Monhartini Moralita Chatri Muhyiatul Fadilah Muhyiatul Fadilah Mukhlis Mukhlis Mukhtar Mukhtar Mulia Mulia Mulia mutia anika Mutia Anika N. Sri Hartati, N. Sri Nabilah, Rezi Nada Nafion Nadia Nazri, Laila Mardhiyah Nisa Afifah Novitasari, Yuliana Diyah Nur Ayu Ramadanti Nur Helmi Nur Shofiatun Nisa Nur Vaizi Nuraini, Fauzi Eka Nurfadillatun Nisa Wijaya Nurfatihah Z, Zahara Nurhelmi Nurhelmi Nurul Pratiwi Nurul Rahmi Pratama, Chelsylia Dara Pratama, Sandi Fransisco Prima, Rika Putri Qalbina Putri Rachma Auliya Putri, Aulia Devani Putri, Cici Adelia Putri, Irma Leilani Putri, Irma Leilani Eka Putri, Isna Aryunita Putri Putri, Rani Dwi Suci Putri, Santi Diana Quratul Akyuni Rachmayati, Rike Rahmadhani Fitri Rahmat Afif Rahmatul Huda Asra Rahmawati Darussyamsu Rahmawita Rahmawita Rahmawita Rahmawita Rahmi Holinesti Rahmi, Elva Ramadanti, Nur Ayu Ramadhan Sumarmin Ramadhan Sumarmin Ramadhan Sumarmin Rani Dwi Suci Hd Putri Ratih Rahayu Relsas Yogica, Relsas Resti Desmayanti Rezi Nabilah Rhavy Ferdyan Rhini Febrianti Rinti Mutiara Sari Riri Apriyanti Riri Apriyanti S. Syamsurizal safitri, fira Salmi Halen Salsabilla, Vishtari Samsuriani Siregar Santosa, Tomi Apra Sari, Rinti Mutiara Satria, Rijal Selaras, Ganda Hijrah Shinta Sari Maria Silviana Okwisan Sirwati, Fadila Sisca Alicia Farma Sisri Yandila Siti Aisyah Siti Helmyati Sity Sarroh SOLICHATUN SOLICHATUN Solusia, Carbiriena Sri Okta Handayani Suhaimi . Sulistiani Sulistiani, Sulistiani Syakirah binti Samsudin Syifa Kamila Namidya Taufiqa, Zuhrah Tomi Apra Santosa Tomi Apra Santosa Santosa Valofi, Nagra Aulia Vauzia, Vauzia Vestimarta, Aldi Wahyuda Violita Violita Violita Violita Violita Viona, Alda Wahyuni Wahyuni wahyuni wahyuni Wahyuni, Resma Widya Ruchi Wilna Sari Winardi, Fhuji Wirda Taufik Wulandari, Tesya Yannita, Defni Yatnita Parama Cita Yolanda Ruhul Azomi Yosi Laila Rahmi Yulita, Nelfi Yuni Ahda Yuni Ahda Yuni Ahda Yuni Ahda Yusrizal Yusrizal Yusrizal Yusrizal Yusrizal Yusrizal Zakri, Dwika Febriana Zuhratul Mardiyah Amir Amir Zulyusri Zulyusri Zulzusri, Zulzusri