Claim Missing Document
Check
Articles

Penggunaan Antibodi Anti-idiotipe sebagai Vaksin terhadap Streptokokosis (THE USING OF ANTI-IDIOTYPE ANTIBODY AS VACCINE AGAINST STREPTOCOCCOSIS) I Nyoman Suartha; Iwan Harjono Utama; Bambang Pontjo Priyosoeryanto; I Wayan Teguh Wibawan
Jurnal Veteriner Vol 2 No 4 (2001)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3457.972 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Vaksin Kombinasi Newcastle Disease dengan Avian Influenza Memicu Imunitas Protektif pada Ayam Petelur terhadap Penyakit Tetelo dan Flu Burung (COMBINED NEWCASTLE DISEASE (ND) AND AVIAN INFLUENZA (AI) VACCINES INDUCE PROTECTIVE IMMUNE RESPONSE IN COMMERCIA Gusti Ayu Yuniati Kencana; I Nyoman Suartha; Ni Made Ayu Sintya Paramita; Arini Nur Handayani
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (109.72 KB)

Abstract

Newcastle disease (ND) and Avian Influenza (AI) are infectious diseases and still endemic in Indonesia.Prevention of the disease is conducted by vaccination of birds as the source of the infection. The use ofcombined ND-AI vaccine is expected to be able to prevent both diseases simultaneously. This study aimwas to determine the potency of combined ND-AI vaccine in field condition. Field trial vaccination wasconducted in commercial layer chickens in Tabanan Bali, and the HI test was conducted at the Faculty ofVeterinary Medicine Udayana University, Denpasar. Field trial in commercial layer chickens showed thatthe average HI titer of ND sera from pre-vaccinated chickens was 22.7HI units and AI titer was 21.27 HIunits. The ND titers increased to 25.47 HI Unit, 27.0 HI units, and to 28.73 HI units, whereas AI titersincreased to 27.93 HI Unit, 28.53 HI units, and 28.47 HI units in two, three and four weeks post-vaccinationwith the ND-AI combined vaccine, respectively. Statistically, based on ND and AI antibody pre and postvaccination,it is indicated that the combined ND-AI vaccine was able to induce immune response higherthan the protective titer level (>24). Period of collecting the sera samples also affected the titer of NDVand AI antibodies (P<0.01). Therefore it is recommended that vaccination should be conducted at antibodytiter of < 4 HI Unit.
Karaterisasi Virus Avian Influenza Subtipe H5N1 Isolat Lapang Asal Bali Untuk Kandidat Vaksin Gusti Ayu Yuniati Kencana; I Nyoman Suartha; I Made Kardena; Arini Nurhandayani
Jurnal Veteriner Vol 21 No 4 (2020)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (155.103 KB) | DOI: 10.19087/jveteriner.2020.21.4.530

Abstract

A research on the isolation and characterization of the Avian Influenza H5N1 subtype field isolate has been carried out at the BSL-3 Laboratory of PT Sanbio Laboratories, Bogor. The aim of the study was to prepare a candidate for the H5N1 subtype Avian Influenza virus vaccine. Virus isolates were taken from field isolates from Bali. A total of seven field H5N1 AI subtypes from Bali were characterized in Bogor. The isolates were: isolate 3A, isolate 4A, isolate 9C, isolate 10 A, isolate 10 C, isolate P65, isolate P67. The passage of isolates was carried out on 9-day-old embryonic Specific Pathogenic (SPF) chicken eggs by injecting 0.1 mL of SPF isolates/eggs through the allantoic cavity. Each isolate was placed in five SPF eggs and then incubated in an incubator at 37 C and candled every day. Since day 2-4 post inoculation, embryo death has occurred. The eggs are harvested by their allantoic fluid and tested for haemagglutination test(HA/HI). The HI test results were confirmed by Reverse Transcriptase Polymerase Chain Reaction(RT-PCR) using the front primer FPHA232_13 (ATTGGTTAYCATGCAAAYAACTCG) and the back primer BPHA232_597 (GGAAAYATAGGTRGTTGGRTTYTGATAG) The results were five of the seven isolates were positive AI subtype B5 585 - 581 The five isolates of AI subtype H5N1 were subsequently sequenced, the results were all positive for AI virus subtype H5N1 clade 2.3.2. Each field isolate was given the name A / Chicken / Bali3A / GAY / 2019; A / Chicken / Bali9C / GAY / 2019; A / Chicken / BaliA4 / GAY / 2019; A / Chicken / Bali10A / GAY / 2016 and A / Chicken / Bali10C / GAY / 2019. One A / Chicken / Bali 9C / GAY / 2016 isolate was subsequently repeated 7 times until a stable H5N1 subtype AI virus titer was obtained. The results of matching with bioinformatics turned out that A / Chicken / Bali 9C / GAY / 2016 isolates had a kinship of 98.62% with AI subtype H5N1 Banyuwangi, amounting to 98.45% with AI subtype H5N1 Lamongan, amounting to 98.10% with AI-H5N1 Lumajang, 97.58% with AI-H5N1 Kediri, 97.07% with AIH5N1 Blitar, 96.72% with AI-H5N1 Denpasar, 96.72% with AI-H5N1 Buleleng and 96.72% with AI-H5N1Sukoharjo. The conclusion is one of isolate namely A / Chicken / Bali 9C / GAY / 2019 including AI subtype H5N1 clade 2.3.2, is’t stable at passage on SPF eggs, has a kinship of 96.72% with A / duck / Sukoharjo / BBVW-1428- 9/2012, the virus content is 106.9 ELD50 so it is potential for vaccine candidates.
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

Abstract

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Pengaruh Perbedaan Waktu Pemberian Premedikasi Xylazine dengan Ketamine dalam Pembiusan Anjing Lokal (EFFECT OF TIME DIFFERENCES OF XYLAZINE ADMINISTRATION AS PEMEDICATION FOR ANESTHESIA WITH KETAMINE IN LOCAL DOGS) Kristina Kristina; I Nyoman Suartha
Jurnal Veteriner Vol 4 No 2 (2003)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (2979.787 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Pembiusan Monyet Ekor Panjang (Macaca fascicularis) Jantan dengan Campuran Ketamin dan Xilazin pada Topografi Daerah Berbeda (THE ANAESTHETIZATION OF LONG TAILED MACAQUE (MACACA FASCICULARIS) BY KETAMINE-XYLAZINE ON DIFFERENT TOPOGRAPHIC AREA) I Nyoman Suartha; I Gusti Agung Arta Putra; I Nengah Wandia
Jurnal Veteriner Vol 4 No 1 (2003)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3543.398 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Ekstrak Etanol dan Fraksi Heksan Buah Pare (Momordica charantia) Sebagai Penurun Kadar Glukosa Darah Tikus Diabetes (ETHANOL EXTRACT AND HEXANE FRACTION OF MOMORDICA CHARANTIA DECREASE BLOOD GLUCOSE LEVEL OF DIABETIC RAT) I Nyoman Suartha; I Made Dira Swantara; Wiwik Susanah Rita
Jurnal Veteriner Vol 17 No 1 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (114.53 KB)

Abstract

The research on the potency of Momordica charantia as lowering blood glucose has been carried out.The fruit was extracted by 70 % ethanol at room temperature. The extract was then partition with NHexane.The filtrate of partition was purified with thin layer chromatography. Three months old of whitemale rats (Rattus novergicus) with approximately 200-250 grams in weight were used as Bio-indicators.This study used a randomized block design (CRD) consisting of eight treatment groups (each treatmentconsisted of five rats). Rats were injected with streptozotocin to get hyperglycemic condition. The M.charantia fruit fraction (fraction 1-5) with dose 100 mg/kg bw was treated to each group when the ratt wason hyperglycemic condition. Rat blood glucose levels were observed on days 0, 4, 11, and 18 respectively .The results showed that blood glucose levels of M. charantia fraction 1and 5 with dose of 100 mg/kg bwhave the same effect with a negative control from day 4th, fraction 2 on day 18 whereas The others fractionare 3, and 4 were effect on days 18th. Based on the result it can be concluded that the M. charantia fraction1 with dose of 100 mg/kg bw effectively in decreasing the blood glucose levels of diabetic rat.
Deteksi Anaplasma sp. pada Anjing di Bali secara Klinis, Serologis, dan Molekuler (THE DETECTIONS OF ANAPLASMA SP. IN DOGS IN BALI WITH CLINICAL, SEROLOGICAL AND MOLECULAR) Anak Agung Sagung Istri Pradnyantari; I Nyoman Suartha; I Gusti Made Krisna Erawan; I Gusti Ngurah Kade Mahardika
Jurnal Veteriner Vol 20 No 4 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.703 KB) | DOI: 10.19087/jveteriner.2019.20.4.479

Abstract

This study aims to determine the infection of Anaplasma sp. in dogs in Bali with clinical, serological and molecular detections. This research method uses Cross Sectional. The samples were collected from June 2017 to July 2018. The total number of samples obtained was 109 dogs from 3.563 samples from seven veterinarian clinics in Bali. Clinical examinations and blood tests are method of clinical detection. Serological detection is using a rapid test kit E. canis & Anaplasma spp. BioNote© production. Molecular detection have been using with the Polymerase Chain Reaction technique. PCR products were sequenced at 1st BASE Laboratories Sdn Bhd, Malaysia. Data were analyzed using the MEGA 4 program. The results showed that Anaplasma sp. are present in dogs in Bali and can be detected by clinically (3,05%), serologically (55,04% base on clinically positive) and molecularly (42,20% base on clinically positive) detection. Thus, detected species Anaplasma sp. In Bali from this study can be identified as A. platys.
Enzyme Linked Immunosorbent Assay Test for Antibody of Classical Swine Fever Virus In Timor-Leste (UJI ENZYME LINKED IMMUNOSORBENT ASSAY TERHADAP ANTIBODI VIRUS CLASSICAL SWINE FEVER DI TIMOR-LESTE) Rui Daniel de Carvalho; I Nyoman Suartha; Nyoman Sadra Dharmawan; I Made Kardena
Jurnal Veteriner Vol 17 No 4 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (93.015 KB)

Abstract

The objective of this study was to evaluate the implementation of Classical Swine Fever (CSF)vaccination on pigs in Timor-Leste. The study was conducted by analyzing the percentage of CSF antibodyin pigs sera that obtained from pigs in four districts which were located in the hills and coast of Timor-Leste. Evaluation was also carried out by observing the dominant factor that affecting the increase ofantibody titers in the sera. A total of 240 pigs sera were taken before and after vaccination and thenchecked for antibodies against of CSF virus by using PrioCheck CSFV Ab ELISA kits (Prionics Ag). Twohundred and forty serums obtained from non-vaccinated pigs and 240 other serum obtained from the samepigs, after being vaccinated with CSF vaccine. Time interval from the first and the second serum collectionwas at least 14 days post-vaccination. The results showed there was a significant difference (P<0.01) forthe presence of antibody in vaccinated pigs compared with the unvaccinated. A total of 75% serum fromvaccinated pigs was found positive for the antibody containing, while only 16.7% of serum from nonvaccinatedpigs was positive. The odd ratio analysis showed that the most influential factor for theincrease of antibody titer against CSF virus was vaccination status. among the other factors of age, sexand geographical study.
Laporan Kasus: Penanganan Dipylidiasis pada Kucing Anggora dengan Praziquantel Annisa Putri Cahyani; I Nyoman Suartha; Nyoman Sadra Dharmawan
Jurnal Sains dan Teknologi Peternakan Vol 1 No 1 (2019): Jurnal Sains dan Teknologi Peternakan
Publisher : Universitas Sulawesi Barat

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (223.468 KB) | DOI: 10.31605/jstp.v1i1.540

Abstract

Dipylidiasis is a tapeworm disease that attacks cats and dogs and classified as a zoonotic disease because it can be transmitted to humans. A 2 years old female angora cat weighing 3 kg was examined with complaints of bloody diarrhea for 2 weeks. The results of native faecal examination showed the presence of D. caninum worm eggs. Animals diagnosed with dipylidiasis. Cat cases were treated by administering 50 mg praziquantel therapy with the recommendation of 1 tablet for 10 kg/BW orally. In conclusion, the treatment of dipylidiasis by administering praziquantel therapy has proven to be effective.
Co-Authors A A N G D Wisesa A A N O Pujawan A A S I Pradnyantari Agatha Seren Lumban Tobing Agatha Serena Lumban Tobing Aida Lousie Tenden Rompis Alya Nita Shena Gayanti Anak Agung Ayu Mirah Adi Anak Agung Gde Oka Dharmayudha Anak Agung Sagung Istri Pradnyantari Anak Agung Sagung Kendran Ananta, Muhammad Ghufron angelina serlin Anita Dwi Handayani Annisa Budiani Annisa Putri Cahyani Annisa Putri Cahyani Apriliana, Kadek Soma Arini Nur Handayani Arini Nur Handayani Arini Nurhandayani Arini Nurhandayani Ayu Fitriani Baiq Indah Pertiwi Bambang Pontjo Priosoeryanto Bhakty, Zatya Wira Bhaskara, Audrey Febiannya Putri BIBIANA W LAY Boro, Saptarima Eka Estiani Cahyaniarta, I Kade Candra Cyrilus Jefferson Bour Daniel Raja Bonar Nainggolan Dewa Odiec Purnawan Dewanti, Desak Gede Bintang Pradnya Dewi, Desak Made Wiga Puspita Dewi, Putu Ayu Purbani Novia Diana Mustikawati Duarsa, Bima Satya Agung DWI SURYANTO Dyah Utami Dewi EKA MAHARDHIKA RATUNDIMA Emy Sapta Budiari Eustokia Yulisa Madu, Eustokia Yulisa Fajar Mubarok Fatmawati Aras Fernandes, Nuno G.A.M.K. Dewi Gede Herdian Permana Putra Gusti Ayu Kencana Gusti Ayu Mayani Kristina Dewi Gusti Ayu Yunianti Kencana Gusti Ayu Yuniati Kencana Heparandita, Ananda Agung Dextra I Gede Soma I Gede Soma I Gusti Agung Arta Putra I Gusti Agung Ayu Suartini I Gusti Made Krisna Erawan I Gusti Made Krisna Erawan I Gusti Ngurah Badiwangsa Temaja I GUSTI NGURAH DIBYA PRASETYA I GUSTI NGURAH KADE MAHARDHIKA I Gusti Ngurah Kade Mahardika I Gusti Ngurah Mahardika I Gusti Ngurah Mahardika I Gusti Ngurah Narendra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra1, I Gusti Ngurah Narendra, I Gusti Ngurah I Gusti Ngurah Sudisma I GustiKetut Suarjana I K. SUATHA I KADEK SAKA WIRYANA I Ketut Eli Supartika I Ketut Gunata I Ketut Gunatha I Ketut Suada I Ketut Tomy Caesar Ramanda I Komang Wahyu Yuliana I Made Dira Swantara I Made Kardena I Made Merdana I Made Sukada I MADE SUMA ANTARA I Made Suma Anthara I Nengah Sudarmayasa i Nengah Wandia I NYOMAN MANTIK ASTAWA I Nyoman Suarsana I Nyoman Windhu Paramarta I Putu Gede Yudhi Arjentinia I Putu Indra Parmayoga I Putu Sudiarta I Putu Wira Adi Wibawa I W Y Semarariana I Wayan Batan I Wayan Bebas I Wayan Gorda I Wayan Suardana I wayan Teguh Wibawan I Wayan Wirata I. B. K. Suardana I.A.M.L. Dewi I.A.P. Apsari I.A.P. Gayatri I.B.K. Suardana I.G.A.A. Idayati I.H. Utama I.W. Batan Ida Ayu Pasti Apsari Ida Ayu Sri Candra Dewi Ida Ayu Sri Chandra Dewi Ida Bagus Kade Suardana Ida Bagus Komang Ardana Ida Bagus Ngurah Swacita Ida Bagus Oka Winaya Iman Bayu Prakoso Darmono Insani, Widia Iwan Harjono Utama Kadek Karang Agustina Kamaliana, Baiq Reni Ketut Budiasa Ketut Sepdyana Kartini Komang Andika Purnama Kristiana Yoaltiva Jinorati Kristina Kristina Ledi Natalia Surbakti Luh Dewi Anggreni Luh Gde Sri Surya Heryani Luh Kadek Nanda Laksmi Luh Made Sudimantini Luh Made Sudimartini Lusiana Lasmari Siahaan Luwis, Jeremy Christian M P A Yunikawati M Windhu M.D. Rudyanto Madania, Reydanisa Noor MADE KOTA BUDIASA Made Ririn Sri Wulandari Made Suma Anthara Made Suma Anthara Margaretha Dhea Sinthalarosa Marmanto, Tessa Saputri Megariyanthi, Ni Putu Arie Melkias Oagay Melkias Oagay Muh Ramadhan Muhammad Ulqiya Syukron Musdalifa, Annisa Nareswari, Ayu Widya Nazara, Nonitema Nengah Tegar Saputra Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Komang Ade Juliantari Ni Luh Putu Dharmawati Ni Luh Putu Kusuma Clara Dewinda Ni Luh Putu Sriyani Ni Luh Putu Yunita Listiana Dewi Ni Luh Watiniasih Ni Made Ayu Sintya Paramita Ni Made Ernawati Ni Made Restiati Ni Made Rita Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi2 Ni Putu Ayu Dewi Wijayanti Ni Putu Tiara Indriana Ni Wayan Tatik Inggriati Norawigaswari, Nengah Desy P S Dwipartha P T E Sucitrayani P.I.S.S. Oka P.K. Pebyanthi Patabang, Denselina Lilis Prasatya, I Gde Made Abdi Priska Mariane Serang Putrawan, Baja Sadhayu Putri, Ayu Chitra Adhitya Putu Adi Cahya Dewi Putu Adrian Junaedi Putu Ayu Sisyawati Putriningsih Putu Devi Jayanti Putu Hendrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Putu Henrywaesa Sudipa Rahim, M. Andry Ratu Shinta Mayasari Remontara, Al Afuw Niha Reny Septyawati Retno Damayanti Soejoedono Rui Daniel de Carvalho S.K. Widyastuti Sachio, Drevani Angelika Samosir, Hartina Saputra, I Nyoman Dwi Eka Saweng, Cikal Farah Irian Jati Sawitajaya, I Made Sayu Raka Padma Wulan Sari, Sayu Raka Padma Wulan Septianingsih, Ni Luh Putu Diah Sheira Tannia Welfalini Sibarani, Oktryna Hodesi Sitohang, Martina Tiodora Situmorang, Fernando Jose Immanuel Clinton Sri Kayati Widyastuti Sry Agustina Sukoco, Hendro Sutadisastra, Nisha Aisya Suwartini, Ni Komang Swandewi, Ni Kadek Meita Syamsidar Syamsidar Syarif Lalu Hidayatullah T. Sari Nindia Tahlia, Ninis Arsyi Taruklinggi, Utari Resky Tiara L Rona Tjokorda Sari Nindhia TRI KOMALA SARI Tri Suci Galingging, Tri Suci Vivi Indrawati Widyanti, Agnes Indah Wijaya, Dhyana Ayu Manggala Willy Moris Nainggolan Wirawan, I Gede WIWIK SUSANAH RITA Wulandari Wulandari Yekhonya Rehuel Sidjabat Yoana Pratiwi Clara Pakpahan Yoga Pratama Nuradi Yosaphat L.S Kote Zumara Mufida Hidayati