p-Index From 2021 - 2026
11.905
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Bios Logos Biotika: Jurnal Ilmiah Biologi Bioeducation Journal JURNAL SAINS PERTANIAN EQUATOR Ilmu Administrasi Publik BIOTROPIA - The Southeast Asian Journal of Tropical Biology Jurnal Pengajaran MIPA EDUSAINS ENGINEERING Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati TELKOMNIKA (Telecommunication Computing Electronics and Control) Biogenesis: Jurnal Ilmiah Biologi Jurnal AgroBiogen Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Online Jurnal Matematika & Sains Techno: Jurnal Penelitian Jurnal Bioterdidik: Wahana Ekspresi Ilmiah Bioedukasi: Jurnal Pendidikan Biologi Journal of Mathematical and Fundamental Sciences JURNAL INTEGRASI PROSES Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA QUANTUM: Jurnal Inovasi Pendidikan Sains Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan: Teori, Penelitian, dan Pengembangan REINWARDTIA BERITA BIOLOGI E-Dimas: Jurnal Pengabdian kepada Masyarakat Pedagogi Hayati International Journal of Science and Applied Science: Conference Series Jurnal DIDIKA: Wahana Ilmiah Pendidikan Dasar Titian Ilmu: Jurnal Ilmiah Multi Sciences Jurnal Biodjati Knowledge Engineering and Data Science Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Bioedukatika BIOEDUKASI Publik (Jurnal Ilmu Administrasi) Jurnal IPA Terpadu Journal of Natural Science and Integration Biosfer: Jurnal Pendidikan Biologi EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Bioma : Jurnal Biologi Indonesia Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Assimilation: Indonesian Journal of Biology Education Bio Educatio : The Journal of Science and Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Bioedukasi: Jurnal Pendidikan Biologi ABDIMAS SILIWANGI Lectura : Jurnal Pendidikan Paspalum: Jurnal Ilmiah Pertanian BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Mangifera Edu JURNAL PENDIDIKAN MIPA Bio-Inoved : Jurnal Biologi-Inovasi Pendidikan Journal of Welding Technology Jurnal Biogenerasi BIO-EDU: Jurnal Pendidikan Biologi Jurnal Pendidikan Teknik Mesin Undiksha BERNAS: Jurnal Pengabdian Kepada Masyarakat 3BIO: Journal of Biological Science, Technology and Management SIMBIOSA Indonesian Journal of Social Research (IJSR) Yumary: Jurnal Pengabdian kepada Masyarakat Jurnal Riset Teknologi Pencegahan Pencemaran Industri Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran JIPB (Jurnal Inovasi Pembelajaran Biologi) Proceeding Biology Education Conference Bioed : Jurnal Pendidikan Biologi El-Jughrafiyah : Jurnal Geografi dan Terapannya Jurnal Pendidikan Dasar dan Sosial Humaniora Journal of Comprehensive Science Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biology and Education Journal (BaEJ) Acta Pedagogia Asiana Jurnal Penelitian Ekonomi Manajemen dan Bisnis Gunung Djati Conference Series Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Jurnal Pendidikan & Pengajaran Reinwardtia Journal of Computers for Society Jurnal Pendidikan MIPA Jurnal Mahasiswa Sistem Informasi Galuh (JMSIG) IJIS Edu : Indonesian Journal of Integrated Science Education
Claim Missing Document
Check
Articles

Kemampuan Klasifikasi dan Kolaborasi Siswa Pada Materi Klasifikasi Tumbuhan Menggunakan Pembelajaran Scientific Outbound: Studi Pendahuluan Cristanti, Widya; Hidayat, Topik; Supriatno, Bambang
Jurnal Penelitian Pendidikan IPA Vol 10 No 4 (2024): April
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i4.6341

Abstract

This research is a quantitative descriptive analysis which aims to describe the implementation of scientific outbound learning on plant classification material to see students' classification and collaboration abilities using data obtained objectively. The research was conducted in the botanical garden of the Indonesia University of Education with class X students at Daarut Tauhid Girl’s Boarding High School Bandung as research subjects. The research instruments used were a questionnaire assessing the design of scientific outbound learning, classification ability questions, as well as questionnaires and observation sheets of collaboration ability. The results of the research show that students' classification abilities are not yet optimal as seen through the pretest results, with an average of 38.13 and the posttest results with an average of 50.93 have not passed the school's KKM figure of 76 due to several obstacles and causal factors found, such as reduced students interest after learning is completed, lack of motivation given to students, and limited use of smartphones. Students' collaboration abilities are indicated to emerge through scientific outbound learning activities based on the results of students' collaboration abilities assessment which are already included in the category of developing collaboration abilities and already possessing collaboration abilities
Survey of Students' Gadget Utilization to Know the Readiness of Personal Digital Inquiry Learning Implementation Cahyaningrum, Mahmudah Nur; Hidayat, Topik; Kusnadi
Jurnal Penelitian Pendidikan IPA Vol 10 No 10 (2024): October
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i10.7950

Abstract

This study aims to determine the readiness of students and resources to implement Personal Digital Inquiry (PDI) learning. The research method was conducted by survey. The survey was conducted on public high school students in Depok city. 346 respondents were willing to answer 19 questions through a Google Form. Questions were asked in the form of multiple choice, checkbox, and short answer, including class, age group, as well as questions about gadgets and their utilization. The survey results were presented in graphical form and analyzed descriptively. The results of the analysis show that overall students and teachers are ready to implement PDI learning. Students have gadgets that qualify as one of the means in the implementation of PDI; students have also been accustomed to utilizing gadgets for learning even though they have not been maximized; students' proximity to social media can be used as an opportunity to be integrated in PDI learning; students are familiar and accustomed to utilizing various applications and search sites that can support the process of implementing PDI. Some obstacles to the use of gadgets can be taken into consideration in the preparation of PDD implementation scenarios.
DISASTER MITIGATION LECTURE STRATEGY BASED ON CITIZEN SCIENCE PROJECT WITH A COMBINATION OF INDOOR AND OUTDOOR ACTIVITIES Ekaputri, Rendi Zulni; Hidayat, Topik; Surtikanti, Hertien Koosbandiah; Surakusumah, Wahyu
Jurnal IPA Terpadu Vol 8, No 3 (2024)
Publisher : Universitas Negeri Makassar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35580/ipaterpadu.v8i3.66540

Abstract

This study aims to describe a disaster mitigation lecture strategy based on the Citizen Science Project (CSP) through a combination of indoor and outdoor learning methods. The study employs an action research approach by implementing a lecture strategy consisting of four phases: BuPAcE (Building Community, Project Expedition, Action, and Evaluate). This study involved 22 fifth-semester students from the Science Education Study Program in the 2023-2024 academic year. The Building Community, Action, and Evaluate phases are conducted using indoor learning methods, while the Project Expedition phase is carried out using outdoor methods. The implementation of the BuPAcE strategy is evaluated using observation sheets. The results indicate that the implementation percentage of the disaster mitigation lecture strategy based on CSP is 80% for the Building Community phase, 70% for the Project Expedition phase, 80% for the Action phase, and 75% for the Evaluate phase. Based on these results, it can be concluded that the disaster mitigation lecture strategy using a combination of indoor and outdoor methods is effective for use in lectures.
UTILITY OF matK GENE AS DNA BARCODE TO ASSESS EVOLUTIONARY RELATIONSHIP OF IMPORTANT TROPICAL FOREST TREE GENUS Mangifera (Anacardiaceae) IN INDONESIA AND THAILAND Hidayat, Topik -; Pancoro, Adi -; Kusumawaty, Diah -
BIOTROPIA Vol. 18 No. 2 (2011): BIOTROPIA Vol. 18 No. 2 December 2011
Publisher : SEAMEO BIOTROP

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (305.512 KB) | DOI: 10.11598/btb.2011.18.2.41

Abstract

MaturaseK (matK) gene of chloroplast DNA has been served as appropriate candidate to be a DNA barcode in angiosperms. Using this DNA marker, 19 species of genus Mangifera, one of ecologically important crop, collected from Indonesia and Thailand were analyzed. Phylogenetic analysis using parsimony method revealed that the gene could clasify Mangifera into three major groups, namely group I, II, and III. Moreover, the matK barcode can identify Mangifera species that is originated from Thailand. Although this classification system is different with the previous system, it can provide a new information about Mangifera taxonomy. Results further exhibited that DNA sequences of the matK of two Mangifera species (M. laurina dan M. macrocarpa) are different between Indonesia and Thailand specimens. Keywords— DNA barcode, Mangifera, matK gene, parsimony, phylogenetic analysis
KONSTRUKSI POHON FILOGENETIK SECARA IN-SILICO JAMUR BERKERABAT DEKAT Trametes versicolor SEBAGAI TERAPI LUPUS BERDASARKAN MARKER 18s rRNA Ika Adhani Sholihah; Topik Hidayat
Bioma Vol. 17 No. 2 (2021): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21009/Bioma17(2).5

Abstract

ABSTRAK Pengobatan herbal telah banyak dikembangkan contohnya adalah pengembangan obat tradisional pada penyakit Lupus. Diketahui bahwa Jamur Tremetes versicolor adalah jamur yang memiliki sifat immunodulator yang berfungsi untuk mengobati penyakit autoimun yaitu Systemic Lupus Erythematosus (SLE) yang memiliki senyawa protein unik Polysaccharide Peptide Krestin (PSK). Tetapi jamur Trametes tidak banyak dikonsumsi oleh masyarakat Indonesia. Tujuan dari penelitian ini adalah mengetahui jamur yang berkerabat dekat dengan Trametes versicolor yang dapat juga dijadikan sebagai terapi pada penyakit autoimun dan dapat dikonsumsi di Indonesia. Studi yang digunakan adalah studi filogenetik secara in-silico dengan jamur yang berkerabat dengan jamur Trametes versicolor dengan penanda gen 18s rRNA yang diperoleh dari genbank NCBI. Data molekuler sekuen menunjukkan bahwa jamur yang berkerabat dekat dengan jamur Trametes versicolor adalah Ganoderma lucidum, Lenzites betulinus, Agaricus bisporus, Agaricus subrufescens, Auricularia polytrica, dan Auricularia auricula-judae berdasarkan penanda gen 18s rRNA. Jamur ini dapat dijadikan sebagai obat alternatif untuk terapi penyakit autoimun dan mendapatkan senyawa yang terkandung dalam jamur tersebut dengan studi in-vitro lebih lanjut. Kata Kunci: In-Silico, Trametes, Ganoderma, Lenzites, Auricularia, Agaricus, Autoimun ABSTRACT Development of herbal treatment have been done quite frequently, for example the development of traditional medicines for Lupus. It is known that Tremetes versicolor mushroom is a fungus that has immunodulatory properties which functions to treat autoimmune disease namely Systemic Lupus Erythematosus (SLE) which has a unique protein compound Polysaccharide Peptide Krestine (PSK). However, Trametes are not widely consumed by Indonesian people. The purpose of this study was to find out which fungi are closely related to Trametes versicolor which can also be used as a therapy for autoimmune diseases and can be available for consupmtion in Indonesia. This study used an in-sillico phylogenetic with fungi that are related to Trametes versicolor mushroom with the 18s rRNA gene marker obtained from the NCBI genbank. Sequential molecular data shows that fungi closely related to Trametes versicolor mushrooms are Ganoderma lucidum, Lenzites betulinus, Agaricus bisporus, Agaricus subrufescens, Auricularia polytrica, and Auricularia auricula-judae based on the 18s rRNA gene marker. This fungi can be used as an alternative medicine for autoimmune diseases treatment by obtaining compounds contained in these fungi with further in-vitro studies. Keywords: In-Silico, Trametes, Ganoderma, Lenzites, Auricularia, Agaricus, Autoimun
Students' Oral Communication Skills in Using Digital Encyclopedia of Mammals Based on Citizen Science Project Fitri Aryanti; Topik Hidayat; Yayan Sanjaya; Kusnadi Kusnadi
IJIS Edu : Indonesian Journal of Integrated Science Education Vol 7, No 1 (2025): January 2025
Publisher : UIN Fatmawati Sukarno Bengkulu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29300/ijisedu.v7i1.6935

Abstract

This study aimed to analyze students' oral communication skills using the Citizen Science Project (CSP) based digital encyclopedia of mammals in learning. This research combines digital technology, community involvement, and the development of scientific communication skills as a novelty. The method used was descriptive quantitative with data collection techniques through observation. The research subjects consisted of 30 prospective teacher students of the Biology Education Study Program at a private university in Bandung. The instrument used was an observation sheet on oral communication skills. The results showed that most students scored good or sufficient. The average value on indicators 1-6, namely being able to provide information or ideas by 75%, including the good category, mastering the material to be used as presentation material by 70%, including the sufficient category, delivering report results systematically and clearly by 75% including the good category, questioning skills by 70% including the sufficient category, being able to answer questions by 75% including the good category, and confidence by 70% including the sufficient category. The percentage value of the active indicator in group discussions is 95%, which is included in the very good category. Based on these data, communication skills are critical because they allow students to convey ideas, work together, and exchange information. Students' oral communication skills can be improved by continuing to train and provide opportunities for students to communicate orally on an ongoing basis based on CSP.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Resmi, Denia Dwi Citra; Hidayat, Topik; Sriyati, Siti
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
PROFIL KEBUTUHAN PERKULIAHAN MITIGASI BENCANA MAHASISWA CALON GURU Ekaputri, Rendi Zulni; Hidayat, Topik; Surtikanti, Hertien Koosbandiah; Surakusumah, Wahyu
Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Vol 8 No 1 (2024)
Publisher : UNIB Press

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33369/diklabio.8.1.134-140

Abstract

Sekolah memiliki peran penting dalam mengubah perilaku siswa, terutama melalui integrasi materi kebencanaan dalam kurikulum IPA. Calon guru IPA berperan dalam membentuk karakter peduli lingkungan. Peningkatan literasi lingkungan berkontribusi pada perubahan perilaku proekologis dan mendukung pembangunan lingkungan berkelanjutan. Kajian ini mengacu pada kurikulum Program Studi Pendidikan IPA dengan tujuan mendeskripsikan profil kebutuhan perkuliahan terkait mitigasi bencana untuk pengembangan program lebih lanjut. Penelitian ini menggunakan metode field study dengan tiga pendekatan utama: pengumpulan data melalui dokumen, interaksi dengan narasumber, dan observasi di lokasi penelitian di Program Studi Pendidikan IPA jenjang S1 dan S2. Teknik pengumpulan data yang digunakan adalah instrumen non-tes, melibatkan analisis dokumen kurikulum, RPS mata kuliah Mitigasi Bencana, dan angket literasi lingkungan. Hasil analisis kurikulum dan RPS menunjukkan evaluasi yang baik pada identitas program studi, visi, misi, tujuan, dan strategi kurikulum. Meskipun tracer study alumni masih perlu ditingkatkan, keterkaitan antara capaian pembelajaran dengan kompetensi lulusan serta interaksi antara mahasiswa dan dosen dinilai baik. Wawancara dengan dosen mengungkapkan bahwa tujuan perkuliahan mitigasi bencana adalah menciptakan kesadaran akan bencana, dengan fokus pada prekursor kebencanaan dan kebiasaan masyarakat saat bencana terjadi. Integrasi kearifan lokal dalam menghadapi bencana masih terbatas, dan buku ajar atau modul yang menggabungkan kebencanaan dengan kearifan lokal masih kurang. Literasi lingkungan mencakup aspek sikap, kesadaran akan kelestarian lingkungan, dan perencanaan tindakan terhadap lingkungan, semuanya menunjukkan hasil yang baik dengan persentase di atas 60%.
Rancang Bangun Ensiklopedia Digital Mamalia Berbasis Citizen Science Project (CSP) Aryanti, Fitri; Hidayat, Topik; Sanjaya, Yayan; Kusnadi
Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Vol 8 No 1 (2024)
Publisher : UNIB Press

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33369/diklabio.8.1.141-151

Abstract

Teknologi telah banyak dimanfaatkan dalam proses pembelajaran dalam meningkatkan aksesibilitas dan interaktivitas sehingga dapat mendukung tujuan pembelajaran. Penelitian ini bertujuan membuat rancang bangun ensiklopedia digital mamalia berbasis Citizen Science Project (CSP) sebagai sumber belajar tambahan, dan mengetahui kelayakan ensiklopedia digital mamalia berbasis CSP. Perancangan ensiklopedia digital dilakukan dengan menggunakan MySQL untuk mengoperasikan sistem database dan menggunakan bahasa pemograman PHP version 8.2.4. Penelitian ini merupakan pendekatan penelitian dan pengembangan dengan model ADDIE yaitu Analyze, Design, Development, Implementation, Evaluation. Pengumpulan data dilakukan melalui observasi, wawancara dan angket. Ensiklopedia digital mamalia berbasis CSP divalidasi oleh ahli media dan ahli materi, dan ujicoba dilakukan terhadap 30 mahasiswa. Hasil penelitian menunjukkan bahwa ensiklopedia digital mamalia berbasis CSP yang dikembangkan termasuk dalam kategori sangat valid dengan skor validasi ahli media sebesar 86% ahli media, dan skor validasi ahli materi sebesar 90%. Selain itu persentase nilai rata-rata ujicoba terhadap dosen sebesar 91,45%, dan nilai rata-rata ujicoba terhadap mahasiswa sebesar 89,91%  yang termasuk pada kategori sangat baik. Berdasarkan hasil penelitian tersebut, ensiklopedia digital mamalia berbasis CSP yang dikembangkan menunjukkan  kelayakan untuk diimplementasikan pada perkuliahan zoologi vertebrata.
ANALISIS FILOGENETIK FAMILI ZINGIBERACEAE & COSTACEAE BERDASARKAN PENANDA MATK DAN GEN PARSIAL Hidayat, Topik; Novita Evelyn, Teressa; Rahma Widyanti, Nadya; Nurul Fadhilah, Nadia; Zainal Arifin, Muhammad
Jurnal Biogenerasi Vol. 10 No. 4 (2025): Volume 10 nomor 4 tahun 2025 Terbit Oktober-Desember 2025
Publisher : Universitas Cokroaminoto Palopo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30605/biogenerasi.v10i4.7827

Abstract

This study analyzes the phylogenetic relationship between the Zingiberaceae and Costaceae families based on partial maturase K (matK) gene sequences and examines their common ancestry. A molecular systematic approach was applied, with DNA sequences aligned using ClustalX 2.1 and edited in BioEdit 7.0.5. Phylogenetic reconstruction was conducted using the maximum parsimony method in PAUP 4.0b10 with heuristic search and 1000 bootstrap replications. The results show a clear separation between Zingiberaceae and Costaceae, with Musa (Musaceae) as the outgroup. Costaceae is identified as the sister family of Zingiberaceae, indicating a shared ancestor. The paraphyletic nature of Costus and taxonomic anomalies likely reflect limited resolution of partial matK data.
Co-Authors A. Ch. Likadja, Jeffry A.A. Ketut Agung Cahyawan W Aa Juhanda Abd. Rasyid Syamsuri Abdull Rahim Mohd Yusoff Abdur Rasyid, Abdur Adelia Aryani Putri Adhi Yuniarto Adi Pancoro Adi Pancoro Adi Rahmat Aditya Suganda Aditya Suganda, Aditya Adriana Hiariej, Adriana Agus Sutanto Aini, Via Amalianneisha Rafadewi Andhanatami Putri Ana Ratna Wulan Ananda Yhuto Wibisono Putra Ananda, Gheri Febri Annisa Salsyabila Rahmi Any Fitriani Ari Widodo Aris Sunandar Aryanti, Fitri Astry Agusthina Muchtar Azmi Aris Bahtiar, Rizal Bambang Supriatno Cahyaningrum, Mahmudah Nur Cristanti, Widya Dadang Sudirno Damayanti, Anggia Fitri Damayanti, Elok Dede Salim Nahdi Della Frisca Damayanti Denia Dwi Citra Resmi Dhiyassalam Imam Anshori Ismanto Diah - Kusumawaty Dian Din Yati Diardy Shauman Rachmatan Didik Priyandoko Dina Karina Islami Dina Mariana Dindin Nasrudin Donna Karolina Br Surbakti Dwi Susilaningsih DWI SUSILANINGSIH Dwicahya Supriatman, Rian E. Derozari, Petrus E. Ermayanti Ekajaya, Renandy Kristianlie Ekaputri, Rendi Zulni Eko Budi Raharjo Eko Budi Raharjo, Eko Budi Endlessa, Chayra Eni Nuraeni Euis Erlin Fauzi Akbar Anugrah Fawzy Muhammad Bayfurqon Feni Oktaviani FENNY MARTHA DWIVANY Fidela Zhafirah Fitri Aryanti Fitri Aryanti Fitriani Nurpratiwi Susanto Fransisca Sudargo Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudarto Tapilouw Ghullam Hamdu Giasintha Stefani Gusti, Utari Akhir Hafsah Hafsah Hana Gardenia Mahbubah Handoko, Pryo Hani Susanti Hani Susanti, Hani Haris Abizar Hayat, Muhammad Syaipul Helmi Helmia Tasti Adri Hernawati Hernawati Homdijah, Oom Siti Husna Nugrahapraja I Gusti Bagus Wiksuana I NYOMAN RAI Ika Adhani Sholihah Ilhami, Aldeva Imam Nugroho Indri Rachmitasuci Ipin Aripin Ipin Aripin Ipin Aripin Ipin Aripin, Ipin Iqbal Syaichurrozi Irmayanti Irmayanti, Irmayanti Jayawarsa, A.A. Ketut Karlia Meitha Kelana, Himalaya Wana Ketut Wikantika Khamidun, Mohd Hairul Kocha, Santana Koosbandiah Surtikanti, Hertien Kurnia, Nina Kurniawan, Iwan Setia Kusdianti Kusdianti Kusdianti Kusdianti Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusumawaty, Diah - Kwabena, James Lala Septem Riza Lia Lutianasari Lia Lutianasari Listia Andriani Maftuha, Mahda Rizqina Mahbubah, Hana Gardena Mahmoud Fahsi Manullang, Wahyu Efendi Meilia Gemilawati Miftakhul Bakhrir Rozaq Khamid Motomi - Ito Motomi - Ito, Motomi - Mr Amprasto Mr Sjaeful Anwar Mrs Sariwulan Diana Mu'aziyah, Siti Eneng Sururiyatul Muhammad Fakhri Basyir Muhammad Syaipul Hayat Muhammad Syaipul Hayat Nahadi Nahdiyati, Kartika Najira Natadiwijaya, Ismail Fikri Nengsih Juanengsih nengsih juanengsih Ningrum, Siti Ratu Rahayu Nisrina Sukriandi Nissa Rachmawati Nono Sutarno Nono Sutarno Novi Sofia Fitriasari Novita Evelyn, Teressa Nur Hamidah Nur Hamidah, Nur Nur'aeni, Epon Nurani Rahmawati, Dini Nurfauziah, Ade Nurhayati, Ai Siti Nurlela Nurlela Nurul Fadhilah, Nadia Nururrahmani, Azmah Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Y Rustaman Nuryani Y Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Yogipratama Rustaman Ono Rokhadhitomo Pancoro, Adi - Pangsuma, Nisa Pisca Hana Marsenda Purnamaulida Pratiwi Putra, Armansyah Putri Yunitha Wardiny Putri, Meirin Dwiningtyas R. Riandi, R. Rafi Muhammad F Rahma Widyanti, Nadya Rahman, M Ammar Fadhlur Rahmawati, Rima Aulia Ratni Purwasih Reni Tania, Reni Resmi, Denia Dwi Citra Riandi Riandi Riandi Ridwan - Rifki Risma Munandar Rifki Risma Munandar Rini Marwati Rini Nuroni Awaliyah Rini Nuroni Awaliyah Rini Solihat Risky Ayu Kristanti Risma Munandar, Rifki Rizky Nadhif Nandana Rosinta Septiana, Rosinta Rosyda, Miftahurrahma Sa'diatul Fuadiyah Salsabila, Amalia Putri Samah, Khyrina Airin Fariza Abu Santi Sri Rahayu Prajayanti sarbino . Sariani, Novita Setiasih Setiasih, Setiasih Setiono Sholihah, Ika Adhani Sidiq, Maulana Sihombing, Maria Engzelita Siregar, Herbert Siti Sriyati Soesy Asiah Soesilowaty Sofi Rahmania Solihat, Syifa Sri Anggraeni Sri Redjeki Sri Redjeki Sri Redjeki Sri Redjeki Sriyati , Siti Stevia Ladisa Suandana, Nana SUHIRMAN SUHIRMAN Sumiyati Sa'adah Sungkono Sungkono Supandi, Achmad Surtikanti Hertien Koosbandiah, Surtikanti Sururi, Zaki Fahreza Susbiyanto, Susbiyanto Syamsiar, Syamsiar Sylva Sagita Taufik Rahman Taufik Rahman Tengku Idris, Tengku Tiara Putri Hendriani Tomi Hidayat Tomohisa - Yukawa Tomohisa - Yukawa, Tomohisa - Tony Hadibarata, Tony Tony Hadibrata Tuszie Widhiyanti Tyas Farrah Dhiba Utari Akhir Gusti Visi Tinta Manik Vitta Yaumul Hikmawati Wahyu Surakusumah Wawan Setiawan Wida Herlina Widi Purwianingsih Win Heri Sarfudin YAYAN SANJAYA Yayan Sanjaya Yayan Sanjaya Yogi Yogi Yudi Prasetyo Yuyun Maryuningsih Yuyun Maryuningsih Zain, Muhammad Iqbal Zainal Arifin, Muhammad