p-Index From 2021 - 2026
14.127
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Bios Logos Biotika: Jurnal Ilmiah Biologi Bioeducation Journal JURNAL SAINS PERTANIAN EQUATOR Jurnal Pengajaran MIPA EDUSAINS ENGINEERING Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati TELKOMNIKA (Telecommunication Computing Electronics and Control) Biogenesis: Jurnal Ilmiah Biologi Jurnal AgroBiogen Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Online Jurnal Matematika & Sains Techno: Jurnal Penelitian Jurnal Bioterdidik: Wahana Ekspresi Ilmiah Bioedukasi: Jurnal Pendidikan Biologi Journal of Mathematical and Fundamental Sciences JURNAL INTEGRASI PROSES Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA QUANTUM: Jurnal Inovasi Pendidikan Sains Scientiae Educatia: Jurnal Pendidikan Sains REINWARDTIA BERITA BIOLOGI E-Dimas: Jurnal Pengabdian kepada Masyarakat Pedagogi Hayati International Journal of Science and Applied Science: Conference Series Jurnal DIDIKA: Wahana Ilmiah Pendidikan Dasar Titian Ilmu: Jurnal Ilmiah Multi Sciences Jurnal Biodjati Knowledge Engineering and Data Science Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Bioedukatika BIOEDUKASI Jurnal IPA Terpadu Journal of Natural Science and Integration Biosfer: Jurnal Pendidikan Biologi EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA LENSA (Lentera Sains): Jurnal Pendidikan IPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Bioma : Jurnal Biologi Indonesia Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Assimilation: Indonesian Journal of Biology Education Bio Educatio : The Journal of Science and Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Bioedukasi: Jurnal Pendidikan Biologi ABDIMAS SILIWANGI Lectura : Jurnal Pendidikan Paspalum: Jurnal Ilmiah Pertanian BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Mangifera Edu JURNAL PENDIDIKAN MIPA Bio-Inoved : Jurnal Biologi-Inovasi Pendidikan Journal of Welding Technology Jurnal Biogenerasi BIO-EDU: Jurnal Pendidikan Biologi Jurnal Pendidikan Teknik Mesin Undiksha BERNAS: Jurnal Pengabdian Kepada Masyarakat Spizaetus: Jurnal Biologi dan Pendidikan Biologi SIMBIOSA Indonesian Journal of Social Research (IJSR) Yumary: Jurnal Pengabdian kepada Masyarakat Jurnal Riset Teknologi Pencegahan Pencemaran Industri Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran JIPB (Jurnal Inovasi Pembelajaran Biologi) Bioed : Jurnal Pendidikan Biologi El-Jughrafiyah : Jurnal Geografi dan Terapannya Jurnal Pendidikan Dasar dan Sosial Humaniora Al Jahiz: Journal of Biology Education Research Journal of Comprehensive Science Journal of Mathematics Science and Computer Education Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biology and Education Journal (BaEJ) Acta Pedagogia Asiana Jurnal Penelitian Ekonomi Manajemen dan Bisnis Gunung Djati Conference Series Filogeni: Jurnal Mahasiswa Biologi Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) Tropical Genetics SEARCH: Science Education Research IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Jurnal Pendidikan & Pengajaran Reinwardtia Jurnal Pendidikan IPA Indonesia Journal of Computers for Society Jurnal Pendidikan MIPA Jurnal Mahasiswa Sistem Informasi Galuh (JMSIG) IJIS Edu : Indonesian Journal of Integrated Science Education Journal of Biology, Environment, and Edu-Tourism Advanced Journal of STEM Education (AJOSED) Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) THABIEA : JOURNAL OF NATURAL SCIENCE TEACHING
Claim Missing Document
Check
Articles

Single Strand Conformation Polymorphism Method for Initial Detection DNA Sequences Homogeneity Topik Hidayat; Adi Pancoro
HAYATI Journal of Biosciences Vol. 17 No. 1 (2010): March 2010
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (48.186 KB) | DOI: 10.4308/hjb.17.1.50

Abstract

In molecular phylogenetic study, homogeneity of DNA sequences is a prerequisite before putting it into practice. Internal transcribed spacer (ITS) region of nuclear ribosomal DNA (nrDNA) has been common in phylogenetic study, but a homogenous sequence is often difficult to obtain. Here we use single-stranded conformation polymorphism (SSCP) method to detect homogeneity for nine pooled amplified products of ITS region. Our results suggested that SSCP method has been applicable in detection homogeneity of ITS region prior to using it in sequencing processes.
Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region Topik Hidayati; Didik Priyandoko; Putri Yunitha Wardiny; Dina Karina Islami
HAYATI Journal of Biosciences Vol. 23 No. 2 (2016): April 2016
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (562.581 KB) | DOI: 10.4308/hjb.23.2.92

Abstract

Withania somnifera (family Solanaceae), known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS) region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.
Survey on Ethnobotanic Value of Banana (Musa spp; Musaceae) in Bali Province, Indonesia Topik Hidayat; Himalaya Wana Kelana; Dhiyassalam Imam Anshori Ismanto; Karlia Meitha
HAYATI Journal of Biosciences Vol. 25 No. 1 (2018): January 2018
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (486.945 KB) | DOI: 10.4308/hjb.25.1.31

Abstract

Bali, one of Indonesia island, is a region inhabited by a large number and varied banana (Musa spp; Musaceae). Many varieties of banana have been utilized by local peoples since long time ago as traditional medicine, edible material, used in traditional ceremony and others. However, information regarding the knowledge on ethnobotany of banana in Bali remains scattered and is not documented well. The purpose of this study was to evaluate and document the ethnobotanic values of bananas in Bali. Ethnobotanic data was collected through focus group discussion (FGD), surveys and interviews from 9 study sites (1 city and 8 regencies) with one or two villages represented each site. Ethnobotanical value of banana was determined by Local User’s Value Index (LUVI) with Pebble Distribution Method (PDM). Subsequently, data obtained was analysed using simple statistic description. Results showed that as many as 44 varieties of banana in Bali were documented. Local peoples have been utilizing banana in their daily life for ritual as indicated by higher LUVI (0.4867), followed by food (0.3), medicine (0.1533), and other (0.06). On the basis of testimony of respondents, indigenous knowledge of peoples in Bali about banana is vertically transmitted from parents to their children (98%). This study provided a valuable information of how the local peoples manage and conserve the banana and its nature.
Genetic Relationship between Tongka Langit Bananas (Musa troglodytarum L.) from Galunggung and Maluku, Indonesia, Based on ITS2 Fenny Martha Dwivany; Giasintha Stefani; Agus Sutanto; Husna Nugrahapraja; Ketut Wikantika; Adriana Hiariej; Topik Hidayat; I Nyoman Rai; Nisrina Sukriandi
HAYATI Journal of Biosciences Vol. 27 No. 3 (2020): July 2020
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.27.3.258

Abstract

Tongka Langit or Fe’i banana (Musa troglodytarum L.) has the T genome and a very high content of beta-carotene. It only grew and spread around the regions of Maluku islands and Papua. However, recently our team found this banana on the foot of mount Galunggung, West Java, so this raised the question about its origin. The objective of this study was to understand the genetic relationship between Tongka Langit from Galunggung and Maluku islands and compared it with other bananas with different genomes. Genetic diversity analysis was done using ITS2 DNA marker and dendrogram analysis showed three groups. From the comparison of the ITS2 sequences, there were no difference (100% identity) between the ITS2 sequence of Tongka Langit originating from Galunggung and Maluku. In conclusion, based on the ITS2 marker, the Tongka Langit were more distantly related to cultivars with A and B genomes, and there was no difference in the ITS2 sequence of Tongka Langit originating from Galunggung and Maluku. To the best of our knowledge, there is no previous report of genetic relationship between Tongka Langit from Galunggung and other regions.
First Phylogenetic Treatment of Apple Cucumber (Family Cucurbitaceae) from Indonesia Utilizing DNA Variation of Internal Transcibed Spacer Region Topik Hidayat; Nurcahyo Widyodaru Saputro; Miftakhul Bakhrir Rozaq Khamid; Fawzy Muhammad Bayfurqon
HAYATI Journal of Biosciences Vol. 28 No. 1 (2021): January 2021
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.28.1.48

Abstract

Cucurbitaceae is one of the largest family in Angiosperm in which the most member of this family is important fruit crops in Indonesia such as Cucumber, Melon, Watermelon, and Apple Cucumber. In particular, Apple Cucumber, currently attracts attention to many researchers due to its phylogeneticand taxonomic problem. In term of its appearance, the fruit looks like an apple but the taste is melon. The purpose of this study was to elucidatephylogenetic relationship between Apple Cucumber and other species of Cucurbitaceae based on variation of DNA sequences derived from internal transcribed spacer (ITS) region. As many as six individuals of Apple Cucumber collected from Karawang, Jember, and Aceh were examined. The ITS sequences of some species of family Cucurbitaceae were retrieved from GenBank, and put them in the analysis. Phylogenetic analysis based on parsimony method with using Begoniaas outgroup reveals that Apple Cucumber are nested in the same clade as Melon (Cucumis melo) with high bootstrap value (100%), suggesting that Apple Cucumber is under the same species as Melon. However, on the basis of morphological characters of fruit, apple cucumber is different with that of Melon. This considerably first phylogenetics treatment provides fundamental knowledge for establishing a subspecies of Melon.
STUDI KASUS KEWIRAUSAHAAN DISTRO DENGAN PENDEKATAN EKONOMI TEKNIK Aditya Suganda; Topik Hidayat; Eko Budi Raharjo
Engineering : Jurnal Bidang Teknik Vol 6 No 1 (2015): April
Publisher : Universitas Pancasakti Tegal

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (370.002 KB) | DOI: 10.24905/eng.v6i1.414

Abstract

Penelitian ini bertujuan untuk mengetahui kelayakan sebuah usaha distro yang dijalankan oleh penulis, Metode yang digunakan dalam penelitian ini menggunakan metode ekonomi teknik yaitu  menganalisa semua biaya dari modal awal hingga pendapatan dengan menggunakan NPV, AE, PBP, BCR, dan IRR. Hasil penelitian dengan menggunakan metode ekonomi teknik menghasilkan nilai NPV sebesar sebesar Rp. 439.955.627 dan AE sebesar Rp.12.924.107 nilai ini jauh lebih besar dari nol, dengan demikian rencana inevstasi membuka toko / distro pakaian & sepatu ini direkomendasikan layak (feasible) secara ekonomis. Hal ini didukung pula hasil perhitungan dengan metode payback period (PBP) dengan nilai k= 3,565 nilai k ini lebih kecil dari periode investasi yang direncanakan 12 bulan dan diperkuat juga dengan nilai IRR lebih besar dari MARR yaitu 23,37% dengan IRR 18%, hal ini semakin memperkuat bahwa rencana investasi membuka toko / distro pakaian & sepatu inidirekomendasikan untuk diterapkan. Tapi pada metodeBenefit Cost Ratio (BCR) nilai BCR= 3,41 lebih besar dari 1 dan ini menunjukan investasi layak untuk di terapkan.kunci :Kelayakan Usaha Distro, NPV, AE, IRR
Parallel random projection using R high performance computing for planted motif search Lala Septem Riza; Tyas Farrah Dhiba; Wawan Setiawan; Topik Hidayat; Mahmoud Fahsi
TELKOMNIKA (Telecommunication Computing Electronics and Control) Vol 17, No 3: June 2019
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.12928/telkomnika.v17i3.11750

Abstract

Motif discovery in DNA sequences is one of the most important issues in bioinformatics. Thus, algorithms for dealing with the problem accurately and quickly have always been the goal of research in bioinformatics. Therefore, this study is intended to modify the random projection algorithm to be implemented on R high performance computing (i.e., the R package pbdMPI). Some steps are needed to achieve this objective, ie preprocessing data, splitting data according to number of batches, modifying and implementing random projection in the pbdMPI package, and then aggregating the results. To validate the proposed approach, some experiments have been conducted. Several benchmarking data were used in this study by sensitivity analysis on number of cores and batches. Experimental results show that computational cost can be reduced, which is that the computation cost of 6 cores is faster around 34 times compared with the standalone mode. Thus, the proposed approach can be used for motif discovery effectively and efficiently.
Sikap Wirausaha Mahasiswa pada Perkuliahan Bioteknologi Bermuatan Bioenterpreneurship Ismail Fikri Natadiwijaya; Adi Rahmat
Mangifera Edu Vol 3 No 1 (2018): Mangifera Edu
Publisher : Universitas Wiralodra

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (416.053 KB) | DOI: 10.31943/mangiferaedu.v3i1.11

Abstract

Penelitian ini bertujuan untuk mengetahui sikap wirausaha mahasiswa pada program perkuliahan bioteknologi bermuatan bioentrepreneurship. Satu kelompok diberi perlakuan, dan selanjutnya diobservasi hasilnya. Satu kelas mahasiswa yang mengontrak mata kuliah bioteknologi semester genap 2016/2017 terlibat sebagai subjek penelitian. Instrumen yang digunakan adalah 50 item angket sikap wirausaha yang kemudian diberi skor serta dihitung nilai total rata-ratanya, dan penilaian sosialisasi produk, dimana kegiatan sosialisasi yang telah dilakukan kemudian didokumentasikan, lalu dinilai dengan cara pemberian skor berdasarkan kriteria pada rubrik yang telah ada. Pada penelitian ini didapatkan nilai sikap wirausaha mahasiswa yang dijaring melalui instrumen termasuk kategori tinggi. Sehingga dapat disimpulkan bahwa sikap wirausaha mahasiswa juga dapat memiliki nilai yang tinggi apabila dilatih melalui program bioteknologi bermuatan bioentrepreneurship.Secara umum nilai yang ada telah menunjukkan bahwa sikap wirausaha mahasiswa telah mencukupi sebagai bagi mereka menjadi guru biologi yang berjiwa wirausaha. Melalui angket respon, kebanyakan mahasiswa menyatakan bahwa perkuliahan Bioteknologi bermuatan bioentrepreneurship dapat membuat mereka memiliki sikap wirausaha yang baik, lebih menyadari besarnya kaitan antara bioteknologi dengan kewirausahaan, mampu membuat produk dan mensosialisasikannya, serta dapat meningkatkan minat terhadap bioteknologi.Berdasarkan hasil penelitian ini, maka dapat diajukan beberapa saran, yaitu diperlukannya pendampingan supaya produk-produk yang dihasilkan dapat terjual. Produk yang terjual tersebut dapat memberikan manfaat finansial bagi mahasiswa sehingga diharapkan dapat menjaga atau bahkan meningkatkan sikap wirausaha mahasiswa ke depannya.
Perkembangan Keterampilan Komunikasi dan Kolaborasi Mahasiswa dalam Pembelajaran Inkuiri Berorientasi Entrepreneurship pada Mata Kuliah Keanekaragaman Tumbuhan Muhammad Syaipul Hayat; Nuryani Y Rustaman; Adi Rahmat; Sri Redjeki
Mangifera Edu Vol 4 No 1 (2019): Mangifera Edu
Publisher : Universitas Wiralodra

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (242.104 KB) | DOI: 10.31943/mangiferaedu.v4i1.41

Abstract

The paradigm of learning science, including biology continues to show a fundamental shift. Biology is taught not only through conventional inquiry, but also inquiry that envisions the debriefing of student lifelong learning. One strategy that can build this vision is through entrepreneurship oriented inquiry learning programs. In the mechanism, learning is designed into four stages based on conformity with indicators of entrepreneurship, i.e. stage I (basic), stage II (development), stage III (advance), and stage IV (professional). In the learning experience, students are provided with a variety of skills in a comprehensive manner in accordance with the standards of lifelong learning, among which those that will be studied in this paper are Communication and Collaboration Skills. These two standards become important things to study, because learning biology must not only be scientific but also students must be able to communicate their ideas and be able to build teamwork in solving problems. This research was conducted on the V semester students of the Biology Education Department in one teachers college in Central Java who took part in the course on Plant Diversity. The samples involved in the data collection were 31 people. Data was collected using observation sheets and questionnaires in the form of the Communication & Collaboration rubric adapted from Marzano's framework lifelong learning. There are six items in the rubric that represent data, three of which are about Communication Skills and three about Collaboration. The results of the study showed that on average the Communication Skills of students based on the results of observations had developed at each stage, i.e. stage I (2.45), stage II (2.83), stage III (3.17), and stage IV (3.54). In accordance with the Collaboration data students showed significant developments, i.e. stage I (2.47), stage II (2.89), stage III (3.32), and stage IV (3.60). Based on the results of the questionnaire collected before and after learning, the data showed a significant increase in both communication and collaboration skills. Thus it can be concluded that entrepreneurship-oriented inquiry learning programs applied to plant diversity course can improve student Communication and Collaboration Skills well
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Co-Authors ., sarbino A. Ch. Likadja, Jeffry A.A. Ketut Agung Cahyawan W Aa Juhanda Abd. Rasyid Syamsuri Abdull Rahim Mohd Yusoff Abdur Rasyid, Abdur Abu Samah, Khyrina Airin Fariza Adelia Aryani Putri Adhi Yuniarto Adi Pancoro Adi Pancoro Adi Rahmat Aditya Suganda Aditya Suganda, Aditya Adriana Hiariej, Adriana Agus Sutanto Aini, Via Aldeva Ilhami Aldeva Ilhami Amalianneisha Rafadewi Andhanatami Putri Amelia Pardiana Putri Ana Ratna Wulan Ananda Yhuto Wibisono Putra Ananda, Aisya Belva Ananda, Gheri Febri Annisa Salsyabila Rahmi Any Fitriani Ari Widodo Arini Rahmadana Aris Sunandar Aryanti, Fitri Astry Agusthina Muchtar Azmi Aris Bambang Supriatno Cita Tresnawati, Cita Dadang Sudirno Damayanti, Anggia Fitri Damayanti, Elok Dede Salim Nahdi Della Frisca Damayanti Denia Dwi Citra Resmi Dewi Susanti Dewi Susanti Dhiyassalam Imam Anshori Ismanto Diah - Kusumawaty Dian Din Yati Diardy Shauman Rachmatan Didik Priyandoko Dina Karina Islami Dina Mariana Dindin Nasrudin Donna Karolina Br Surbakti Dwi Susilaningsih DWI SUSILANINGSIH Dwicahya Supriatman, Rian E. Derozari, Petrus E. Ermayanti Ekajaya, Renandy Kristianlie Ekaputri, Rendi Zulni Eko Budi Raharjo Eko Budi Raharjo, Eko Budi Endlessa, Chayra Eni Nuraeni Euis Erlin Fadhil Muharram Fauzi Akbar Anugrah Fawzy Muhammad Bayfurqon Feni Oktaviani FENNY MARTHA DWIVANY Fidela Zhafirah Fitri Aryanti Fitri Aryanti Fitriani Nurpratiwi Susanto Fransisca Sudargo Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw, Fransisca Sudargo Fransisca Sudarto Tapilouw Ghullam Hamdu Giasintha Stefani Gusti, Utari Akhir Hafsah Hafsah Haibah Afifah Azmi Hana Gardenia Mahbubah Hani Susanti Hani Susanti, Hani Haris Abizar Hayat, Muhammad Syaipul Helmi Helmia Tasti Adri Hernawati Hernawati Homdijah, Oom Siti Husna Nugrahapraja I Gusti Bagus Wiksuana I NYOMAN RAI Ika Adhani Sholihah Ilhami, Aldeva Imam Nugroho Indri Rachmitasuci Ipin Aripin Ipin Aripin Ipin Aripin Ipin Aripin, Ipin Iqbal Syaichurrozi Jayawarsa, A.A. Ketut Jihan Bilqis Kelana, Himalaya Wana Ketut Wikantika Khamidun, Mohd Hairul Kocha, Santana Koosbandiah Surtikanti, Hertien Kurniawan, Iwan Setia Kusdianti Kusdianti Kusdianti Kusdianti Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kwabena, James Lala Septem Riza Lia Lutianasari Lia Lutianasari Lilit Rusyati Listia Andriani Luthfiah Nurfajriyah Maftuha, Mahda Rizqina Mahbubah, Hana Gardena Mahmoud Fahsi Mahmudah Nur Cahyaningrum Manullang, Wahyu Efendi Mayla Maulida Meilia Gemilawati Meitha, Karlia Miftakhul Bakhrir Rozaq Khamid Motomi - Ito Motomi - Ito, Motomi - Mr Amprasto Mr Sjaeful Anwar Mrs Sariwulan Diana Mu'aziyah, Siti Eneng Sururiyatul Mubiar Agustin Muhamad Wafda Jamil Muhammad Fakhri Basyir Muhammad Fuad Sya'ban Muhammad Syaipul Hayat Muhammad Syaipul Hayat Muhammad Zainal Arifin Mustafa Cakir Mustafa Çakir Nadia Nurul Fadhilah Nadya Rahma Widyanti Nahadi Nahdiyati, Kartika Najira Natadiwijaya, Ismail Fikri Nengsih Juanengsih Nifrah Mislah Ningrum, Siti Ratu Rahayu Nisrina Sukriandi Nissa Rachmawati Nono Sutarno Nono Sutarno Novi Sofia Fitriasari Novita Sariani Nur Hamidah Nur Hamidah, Nur Nur'aeni, Epon Nurani Rahmawati, Dini Nurfauziah, Ade Nurhayati, Ai Siti Nurlela Nurlela Nururrahmani, Azmah Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Y Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Yogipratama Rustaman Omay Sumarna Ono Rokhadhitomo Pangsuma, Nisa Pisca Hana Marsenda Purnamaulida Pratiwi Putra, Armansyah Putri Yunitha Wardiny Putri, Meirin Dwiningtyas Putri, Novi Indrya R. Riandi, R. Rafi Muhammad F Rahadian Rasyid Alyasa Rahman, M Ammar Fadhlur Rahmawati, Rima Aulia Ratni Purwasih Regina Anindya Putri Riandi Riandi Riandi Riandi Ridwan - Rifki Risma Munandar Rifki Risma Munandar Rifki Risma Munandar Rini Marwati Rini Nuroni Awaliyah Rini Nuroni Awaliyah Rini Solihat Risky Ayu Kristanti Risma Munandar, Rifki Rizky Nadhif Nandana Rosinta Septiana, Rosinta Rosyda, Miftahurrahma Sa'diatul Fuadiyah Salsabila, Amalia Putri Samah, Khyrina Airin Fariza Abu Santi Sri Rahayu Prajayanti Sariwulan Diana Setiasih Setiasih, Setiasih Setiono Sholihah, Ika Adhani Sidiq, Maulana Sihombing, Maria Engzelita Siregar, Herbert Siti Sriyati Siti sriyati Soesy Asiah Soesilowaty Sofi Rahmania Solihat, Syifa Sri Anggraeni Sri Redjeki Sri Redjeki Sri Redjeki Sri Redjeki Stevia Ladisa SUHIRMAN SUHIRMAN Sumiyati Sa'adah Sungkono Sungkono Surtikanti Hertien Koosbandiah, Surtikanti Sururi, Zaki Fahreza Susbiyanto, Susbiyanto Syamsiar, Syamsiar Sylva Sagita Taufik Rahman Taufik Rahman Tengku Idris Tengku Idris, Tengku Teressa Novita Evelyn Tiara Putri Hendriani Tomi Hidayat Tomohisa - Yukawa Tomohisa - Yukawa, Tomohisa - Tony Hadibarata, Tony Tony Hadibrata Turahmah, Ai Himma Tuszie Widhiyanti Tyas Farrah Dhiba Umarlin, Sindy Utari Akhir Gusti Visi Tinta Manik Vitta Yaumul Hikmawati Wahyu Surakusumah Wawan Setiawan Wida Herlina Widi Purwianingsih Widya Cristanti Win Heri Sarfudin Yayan Sanjaya Yayan Sanjaya YAYAN SANJAYA Yenni Verawati Yogi Yogi Yudi Prasetyo Yuyun Maryuningsih Zain, Muhammad Iqbal