p-Index From 2021 - 2026
11.366
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Bios Logos Bioeducation Journal JURNAL SAINS PERTANIAN EQUATOR Ilmu Administrasi Publik BIOTROPIA - The Southeast Asian Journal of Tropical Biology Jurnal Pengajaran MIPA EDUSAINS ENGINEERING Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati TELKOMNIKA (Telecommunication Computing Electronics and Control) Biogenesis: Jurnal Ilmiah Biologi Jurnal AgroBiogen Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Online Jurnal Matematika & Sains Techno: Jurnal Penelitian Jurnal Bioterdidik: Wahana Ekspresi Ilmiah Bioedukasi: Jurnal Pendidikan Biologi Journal of Mathematical and Fundamental Sciences JURNAL INTEGRASI PROSES Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA QUANTUM: Jurnal Inovasi Pendidikan Sains Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan: Teori, Penelitian, dan Pengembangan REINWARDTIA BERITA BIOLOGI E-Dimas: Jurnal Pengabdian kepada Masyarakat Pedagogi Hayati International Journal of Science and Applied Science: Conference Series Jurnal DIDIKA: Wahana Ilmiah Pendidikan Dasar Titian Ilmu: Jurnal Ilmiah Multi Sciences Jurnal Biodjati Knowledge Engineering and Data Science Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Bioedukatika BIOEDUKASI Jurnal IPA Terpadu Journal of Natural Science and Integration Biosfer: Jurnal Pendidikan Biologi EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Bioma : Jurnal Biologi Indonesia Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Assimilation: Indonesian Journal of Biology Education Bio Educatio : The Journal of Science and Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Bioedukasi: Jurnal Pendidikan Biologi ABDIMAS SILIWANGI Lectura : Jurnal Pendidikan Paspalum: Jurnal Ilmiah Pertanian BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Mangifera Edu JURNAL PENDIDIKAN MIPA Bio-Inoved : Jurnal Biologi-Inovasi Pendidikan Journal of Welding Technology BIO-EDU: Jurnal Pendidikan Biologi Jurnal Pendidikan Teknik Mesin Undiksha BERNAS: Jurnal Pengabdian Kepada Masyarakat SIMBIOSA Indonesian Journal of Social Research (IJSR) Yumary: Jurnal Pengabdian kepada Masyarakat Jurnal Riset Teknologi Pencegahan Pencemaran Industri Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran JIPB (Jurnal Inovasi Pembelajaran Biologi) Proceeding Biology Education Conference Bioed : Jurnal Pendidikan Biologi El-Jughrafiyah : Jurnal Geografi dan Terapannya Jurnal Pendidikan Dasar dan Sosial Humaniora Journal of Comprehensive Science Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biology and Education Journal (BaEJ) Acta Pedagogia Asiana Jurnal Penelitian Ekonomi Manajemen dan Bisnis Gunung Djati Conference Series Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) Nuansa Informatika JIPI (Jurnal IPA dan Pembelajaran IPA) IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Jurnal Pendidikan & Pengajaran Reinwardtia Journal of Computers for Society Jurnal Pendidikan MIPA Jurnal Mahasiswa Sistem Informasi Galuh (JMSIG) IJIS Edu : Indonesian Journal of Integrated Science Education
Claim Missing Document
Check
Articles

Perkembangan Keterampilan Komunikasi dan Kolaborasi Mahasiswa dalam Pembelajaran Inkuiri Berorientasi Entrepreneurship pada Mata Kuliah Keanekaragaman Tumbuhan Muhammad Syaipul Hayat; Nuryani Y Rustaman; Adi Rahmat; Sri Redjeki
Mangifera Edu Vol 4 No 1 (2019): Mangifera Edu
Publisher : Universitas Wiralodra

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (242.104 KB) | DOI: 10.31943/mangiferaedu.v4i1.41

Abstract

The paradigm of learning science, including biology continues to show a fundamental shift. Biology is taught not only through conventional inquiry, but also inquiry that envisions the debriefing of student lifelong learning. One strategy that can build this vision is through entrepreneurship oriented inquiry learning programs. In the mechanism, learning is designed into four stages based on conformity with indicators of entrepreneurship, i.e. stage I (basic), stage II (development), stage III (advance), and stage IV (professional). In the learning experience, students are provided with a variety of skills in a comprehensive manner in accordance with the standards of lifelong learning, among which those that will be studied in this paper are Communication and Collaboration Skills. These two standards become important things to study, because learning biology must not only be scientific but also students must be able to communicate their ideas and be able to build teamwork in solving problems. This research was conducted on the V semester students of the Biology Education Department in one teachers college in Central Java who took part in the course on Plant Diversity. The samples involved in the data collection were 31 people. Data was collected using observation sheets and questionnaires in the form of the Communication & Collaboration rubric adapted from Marzano's framework lifelong learning. There are six items in the rubric that represent data, three of which are about Communication Skills and three about Collaboration. The results of the study showed that on average the Communication Skills of students based on the results of observations had developed at each stage, i.e. stage I (2.45), stage II (2.83), stage III (3.17), and stage IV (3.54). In accordance with the Collaboration data students showed significant developments, i.e. stage I (2.47), stage II (2.89), stage III (3.32), and stage IV (3.60). Based on the results of the questionnaire collected before and after learning, the data showed a significant increase in both communication and collaboration skills. Thus it can be concluded that entrepreneurship-oriented inquiry learning programs applied to plant diversity course can improve student Communication and Collaboration Skills well
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Monitoring of insect pollinators of mango (Mangifera indica L.) inflorescence based on citizen science Ipin Aripin; Topik Hidayat; Nuryani Y Rustaman; Riandi Riandi
Biogenesis: Jurnal Ilmiah Biologi Vol 9 No 2 (2021)
Publisher : Department of Biology, Faculty of Sci and Tech, Universitas Islam Negeri Alauddin Makassar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24252/bio.v9i2.23509

Abstract

Mango cross-pollination can be encouraged through the presence of pollinating insects, which can be investigated and observed through citizen science activities. This study aims to monitor the presence of insect pollinators of mango (Mangifera indica L.) inflorescence through citizen science activities. The data generated in the study can be used as a reference to determine population trends and the biodiversity of mango insect pollinators. A citizen science approach in participatory research was used to collect and identify the data. A total of 68 volunteer participants from two universities in west Java were involved in this study. The participants had to meet the requirements to have contracted ecology courses. Smartphones and insect identification guidelines and databases at https://www.discoverlife.org/ and https://www.inaturalist.org/ were used as a tool in this research. The identified data were submitted via google form (www.bit.ly/csmangga) and the Inaturalist application for publication. It was discovered that mango inflorescence insect pollinators comprised five orders, 26 families, and 39 species. Diptera and Hymenoptera orders are insects that have the biggest role in mango pollination, and Chrysomya sp. is an insect species found in almost all mango cultivars.
ULASAN Kajian Filogenetika Molekuler dan Peranannya dalam Menyediakan Informasi Dasar untuk Meningkatkan Kualitas Sumber Genetik Anggrek Topik Hidayat; Adi Pancoro
Jurnal AgroBiogen Vol 4, No 1 (2008): April
Publisher : Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumber Daya Genetik Pertanian

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21082/jbio.v4n1.2008.p35-40

Abstract

Early informationresulted from molecular phylogenetic studies of many importantornamental crops is often less attention to manygrowers and farmers. Phylogenetics is one of the most preferablemethod in systematics to reconstruct evolutionaryrelationships of groups of biological organisms in order tounderstand their biodiversities. This has been revolutionizedby DNA sequences data. In this method, a group of organismsthat shares many identical characteristics are consideredto be closely related; deriving from a commonancestor and is assumed to have similar genetic patternsand biochemical properties. By these basic principles,molecular phylogenetics plays important roles in revealing abasic knowledge on pattern of relationships to whichgenetic resources can be improved. Over the past decade,botanists have done several thousand phylogenetic analysesbased on molecular data of economically and horticulturallyimportant crops. Orchids are the best example for this.There is no doubt that most orchid plants had played roles inhorticulture and hybridization. At present, many infragenericand intergeneric hybrids are available commercially. Successfulhybridization can be achieved if two or more individualplants understudy are closely related in respect to theirgenetics and evolution.
UPAYA MENINGKATKAN RESEARCH SKILL SISWA MELALUI CITIZEN SCIENCE PROJECT PADA PEMBELAJARAN BIOLOGI SMA Della Frisca Damayanti; Rini Solihat; Topik Hidayat
Bioedukasi Jurnal Pendidikan Biologi Vol 12, No 2 (2021): BIOEDUKASI, NOVEMBER 2021
Publisher : UNIVERSITAS MUHAMMADIYAH METRO

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24127/bioedukasi.v12i2.4438

Abstract

Developing Gen-21cs on smartphone to cultivate the 21st-century skills on biology teacher candidates Yuyun Maryuningsih; Topik Hidayat; R. Riandi; Nuryani Rustaman
JPBI (Jurnal Pendidikan Biologi Indonesia) Vol. 5 No. 3 (2019): NOVEMBER
Publisher : University of Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jpbi.v5i3.9714

Abstract

The accessibility of learning media is one of the determining factors of student skills in dealing with the 21st-century demands. This study aimed at developing the online-discussion-forum-based Gen-21cs application. This Design Development Research (DDR) used the Richey and Klein Model which comprised of six phases, namely, 1) identifying the problem by determining learning indicators and supporting literature, 2) determining the purpose of development, 3) making the design and development of tools 4 ) approve device testing, 5) try device test results and 6) communicate device test results. The data gained were analyzed using descriptive qualitative. The development results showed that the Gen-21cs application can be used in learning process and facilitated students to conduct online discussion. Furthermore, the validation results indicated that the media was feasible to use with ‘very good’ category.
The critical thinking skills of biology teacher candidates toward the ethical issues Yuyun Maryuningsih; Topik Hidayat; R. Riandi; Nuryani Y. Rustaman
JPBI (Jurnal Pendidikan Biologi Indonesia) Vol. 6 No. 1 (2020): MARCH
Publisher : University of Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jpbi.v6i1.10779

Abstract

The critical thinking skills are needed by biology teacher candidates to deal with the nowadays ethical issues arisen among society. The aim of this research was to observe the critical thinking skills of biology teacher candidates toward the ethical issues especially in genetic field through online discussion. The subjects of this experimental research were 104 biology teacher candidates who took the Genetics Course in an institution in West Java.  The subject were devided into three groups consisted of two experimental groups and one control group which conducted online discussion by using Gen-21cs application. The experimental groups discussed the topics given by the both instructor and students, while the control group only discussed the topics given by the instructor. The topics discussed were cell cloning, Genetically Engineered Products, stemcell and inbreeding. The online discussions have been done for four weeks. The biology teacher candidate responses were measured using the critica thinking measurement developed by Facione.The critical thinking scores gained were analyzed using descriptive statistic in term of mean. The results showed that the critical thinking skills of the biology teacher candidates tended to increase in each discussion sessions. Online discussion can be used to ensure the other thinking skills.
Cladogram misreading of undergraduate students in understanding evolutionary Sa'diatul Fuadiyah; Topik Hidayat; Didik Priyandoko
JPBI (Jurnal Pendidikan Biologi Indonesia) Vol. 7 No. 2 (2021): JULY
Publisher : University of Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jpbi.v7i2.12360

Abstract

The student's ability to understand evolutionary studies is determined by representing a phylogenetic tree or cladogram. This study aims to determine the tree thinking ability, especially the students' reading ability in interpreting the cladogram. This descriptive study involved 29 students as subjects. Students are selected by purposive random sampling, only students who have attended and studied evolution courses. The data collection instrument used tests and interview guidelines. The test questions consist of 20 multiple choice questions with five answer choices. The difficulty level of the questions used includes understanding, applying, analyzing, and evaluating. The phylogenetic tree interpretation refers to four indicators, including the most recent common ancestor (MRCA), monophyletic group, branch proximity, contemporary descendant, and counting the branch or nodes position. The data obtained were analyzed using Microsoft Excel 2013 and Anates-V4, then presented in percentage form. The results showed that many students misinterpreted the cladogram. Furthermore, errors in cladogram interpretation occurred in monophyletic group indicators (38%), most common ancestor (59%), branch proximity (41%), contemporary ancestry (39%), and branch position calculations (53%). These results indicate that misreading of analysis in cladogram interpretation is moderate to high, so it is necessary to formulate the most appropriate way to teach phylogenetic studies in evolution.
Application of genetic problem base online discussion to improve genetic literacy of prospective teachers Yuyun Maryuningsih; Topik Hidayat; R. Riandi; Nuryani Y. Rustaman
JPBI (Jurnal Pendidikan Biologi Indonesia) Vol. 8 No. 1 (2022): MARCH
Publisher : University of Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jpbi.v8i1.19035

Abstract

Genetics is a subject that is quite difficult according to students. Various strategies and methods are used to understand genetics in learning to have genetic literacy. One way of increasing genetic literacy in students is to apply genetic problems based on an online discussion in genetics lectures. The research was conducted to determine the effect of genetic problem-based online discussion on increasing students' genetic literacy. The research design used a pre-posttest control group design. It was carried out experimentally on three treatment groups: the genetic problem base of students, the genetic problem base of educators - students, and the genetic problem base of educators. According to the genetic literacy domain, genetic literacy is measured through multiple-choice tests, including genetic models, meiotic models, and molecular models. Manova analyzed the value of gene literacy, and a post-doc further test was performed to differentiate genetic literacy in the three treatment groups. The results showed that genetic literacy increased in all treatment groups, with the highest increase in the group that applied a genetic problem base focused on student problems.
The Improvement of Prospective Teachers' Life-long Learning during the Plant Diversity Course with 5E+e Inquiry Muhammad Syaipul Hayat; Nuryani Rustaman; Adi Rahmat; Sri Redjeki
Scientiae Educatia: Jurnal Pendidikan Sains Vol 9, No 2 (2020): December 2020
Publisher : Tadris Biologi Fakultas Ilmu Tarbiyah dan Keguruan IAIN SYEKH NURJATI CIREBON

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24235/sc.educatia.v9i2.7476

Abstract

Not a few students who have difficulty interpreting the material being studied in terms of life encourage the need for a paradigm shift in science learning, which is directed at lifelong learning. In this paper, an entrepreneurship-oriented 5E (Engagement, Explain, Exploration, Elaboration, and Evaluation) inquiry learning program is developed, which is also often called 5E+e. This research investigates the improvement of lifelong learning for the prospective teachers during the 5E+e inquiry in the plant diversity course. The quasi-experimental method with a one-group pretest-postest design was used. The research subjects were taken by purposive sampling, namely the fifth-semester students of the Biology Education Study Program at one of the Teachers Institution in Central Java with 31 participants. Data were gathered using a questionnaire filled out by students before (pre) and after (post) the treatment of the 5E+e inquiry learning and observation. The data analysis was carried out in both quantitative and qualitative-descriptive manners to make a comprehensive conclusion. The results revealed that the average lifelong learning score of prospective teachers compiled with rubrics had increased between before (2.68) and after being given the program (3.26) with a maximum score of 4.00. Thus, it can be concluded that the entrepreneurship-oriented inquiry learning program applied to the plant diversity course can increase the lifelong learning of prospective teachers.
Co-Authors A. Ch. Likadja, Jeffry A.A. Ketut Agung Cahyawan W Aa Juhanda Abd. Rasyid Syamsuri Abdull Rahim Mohd Yusoff Abdur Rasyid, Abdur Adelia Aryani Putri Adhi Yuniarto Adi Pancoro Adi Pancoro Adi Rahmat Aditya Suganda Aditya Suganda, Aditya Adriana Hiariej, Adriana Agus Sutanto Aini, Via Amalianneisha Rafadewi Andhanatami Putri Ana Ratna Wulan Ananda Yhuto Wibisono Putra Annisa Salsyabila Rahmi Any Fitriani Ari Widodo Aris Sunandar Aryanti, Fitri Astry Agusthina Muchtar Azhar Prabukusumo, Muhammad Azmi Aris Bahtiar, Rizal Bambang Supriatno Cahyaningrum, Mahmudah Nur Cristanti, Widya Dadang Sudirno Damayanti, Anggia Fitri Damayanti, Elok Dede Salim Nahdi Della Frisca Damayanti Denia Dwi Citra Resmi Dhiyassalam Imam Anshori Ismanto Diah - Kusumawaty Dian Din Yati Diardy Shauman Rachmatan Didik Priyandoko Dina Karina Islami Dina Mariana Dindin Nasrudin Donna Karolina Br Surbakti Dwi Susilaningsih DWI SUSILANINGSIH Dwicahya Supriatman, Rian E. Derozari, Petrus E. Ermayanti Ekajaya, Renandy Kristianlie Ekaputri, Rendi Zulni Eko Budi Raharjo Eko Budi Raharjo, Eko Budi Endlessa, Chayra Eni Nuraeni Eryan Ahmad Firdaus Euis Erlin Fauzi Akbar Anugrah Fawzy Muhammad Bayfurqon Feni Oktaviani FENNY MARTHA DWIVANY Fidela Zhafirah Fitri Aryanti Fitri Aryanti Fitriani Nurpratiwi Susanto Fransisca Sudargo Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudarto Tapilouw Ghullam Hamdu Giasintha Stefani Gusti, Utari Akhir Hafsah Hafsah Hana Gardenia Mahbubah Hani Susanti Hani Susanti, Hani Haris Abizar Hayat, Muhammad Syaipul Helmi Helmia Tasti Adri Hertien Koosbandiah Surtikanti Hidayati, Ajeng Homdijah, Oom Siti Husna Nugrahapraja I Gusti Bagus Wiksuana I NYOMAN RAI Ilhami, Aldeva Imam Nugroho Indri Rachmitasuci Ipin Aripin Ipin Aripin Ipin Aripin Ipin Aripin, Ipin Iqbal Syaichurrozi Irmayanti Irmayanti, Irmayanti Jayawarsa, A.A. Ketut Karlia Meitha Kelana, Himalaya Wana Ketut Wikantika Khamidun, Mohd Hairul Koosbandiah Surtikanti, Hertien Kurniawan, Iwan Setia Kusdianti Kusdianti Kusdianti Kusdianti Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusumawaty, Diah - Kwabena, James Lala Septem Riza Lia Lutianasari Lia Lutianasari Listia Andriani Mahbubah, Hana Gardena Mahmoud Fahsi Manullang, Wahyu Efendi Manurung, Jonson Meilia Gemilawati Miftakhul Bakhrir Rozaq Khamid Motomi - Ito Motomi - Ito, Motomi - Mr Amprasto Mr Sjaeful Anwar Mrs Sariwulan Diana Mu'aziyah, Siti Eneng Sururiyatul Muhammad Fakhri Basyir Muhammad Syaipul Hayat Muhammad Syaipul Hayat Nahadi Nahdiyati, Kartika Najira, Najira Natadiwijaya, Ismail Fikri Nengsih Juanengsih nengsih juanengsih Ningrum, Siti Ratu Rahayu Nisrina Sukriandi Nissa Rachmawati Nono Sutarno Nono Sutarno Novi Sofia Fitriasari Nur Hamidah Nur Hamidah, Nur Nur'aeni, Epon Nurani Rahmawati, Dini Nurfauziah, Ade Nurhayati, Ai Siti Nurlela Nurlela Nururrahmani, Azmah Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Y Rustaman Nuryani Y Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Yogipratama Rustaman Ono Rokhadhitomo Pancoro, Adi - Pangsuma, Nisa Pisca Hana Marsenda Purnamaulida Pratiwi Putra, Armansyah Putri Yunitha Wardiny Putri, Meirin Dwiningtyas R. Riandi, R. Rafi Muhammad F Rahman, M Ammar Fadhlur Rahmawati, Rima Aulia Ratni Purwasih Rendi Zulni Ekaputri Riandi Riandi Riandi Ridwan - Rifki Risma Munandar Rini Marwati Rini Nuroni Awaliyah Rini Nuroni Awaliyah Rini Solihat Risky Ayu Kristanti Risma Munandar, Rifki Rizky Nadhif Nandana Rizqina, Mahda Rosinta Septiana, Rosinta Rosyda, Miftahurrahma Sa'diatul Fuadiyah Salsabila, Amalia Putri Samah, Khyrina Airin Fariza Abu Santi Sri Rahayu Prajayanti sarbino . Sariani, Novita Setiasih Setiasih, Setiasih Setiono Sholihah, Ika Adhani Sidiq, Maulana Sihombing, Maria Engzelita Siregar, Herbert Siti Sriyati Soesy Asiah Soesilowaty Sofi Rahmania Solihat, Syifa Sri Anggraeni Sri Redjeki Sri Redjeki Sri Redjeki Sri Redjeki Stevia Ladisa Suandana, Nana SUHIRMAN SUHIRMAN Sumiyati Sa'adah Sungkono Sungkono Supandi, Achmad Surtikanti Hertien Koosbandiah, Surtikanti Sururi, Zaki Fahreza Susbiyanto, Susbiyanto Syamsiar, Syamsiar Sylva Sagita Taufik Rahman Taufik Rahman Tengku Idris, Tengku Tiara Putri Hendriani Tomi Hidayat Tomohisa - Yukawa Tomohisa - Yukawa, Tomohisa - Tony Hadibarata, Tony Tony Hadibrata Tuszie Widhiyanti Tyas Farrah Dhiba Utari Akhir Gusti Visi Tinta Manik Vitta Yaumul Hikmawati Wahyu Surakusumah Wawan Setiawan Wida Herlina Widi Purwianingsih Win Heri Sarfudin Yayan Sanjaya Yayan Sanjaya YAYAN SANJAYA Yogi Yogi Yudi Prasetyo Yuyun Maryuningsih Yuyun Maryuningsih Zain, Muhammad Iqbal