Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

14.127

P-Index

This Author published in this journals

All Journal HAYATI Journal of Biosciences Jurnal Bios Logos Biotika: Jurnal Ilmiah Biologi Bioeducation Journal JURNAL SAINS PERTANIAN EQUATOR Jurnal Pengajaran MIPA EDUSAINS ENGINEERING Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati TELKOMNIKA (Telecommunication Computing Electronics and Control) Biogenesis: Jurnal Ilmiah Biologi Jurnal AgroBiogen Jurnal Pengajaran Matematika dan Ilmu Pengetahuan Alam Formica Online Jurnal Matematika & Sains Techno: Jurnal Penelitian Jurnal Bioterdidik: Wahana Ekspresi Ilmiah Bioedukasi: Jurnal Pendidikan Biologi Journal of Mathematical and Fundamental Sciences JURNAL INTEGRASI PROSES Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA QUANTUM: Jurnal Inovasi Pendidikan Sains Scientiae Educatia: Jurnal Pendidikan Sains REINWARDTIA BERITA BIOLOGI E-Dimas: Jurnal Pengabdian kepada Masyarakat Pedagogi Hayati International Journal of Science and Applied Science: Conference Series Jurnal DIDIKA: Wahana Ilmiah Pendidikan Dasar Titian Ilmu: Jurnal Ilmiah Multi Sciences Jurnal Biodjati Knowledge Engineering and Data Science Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Bioedukatika BIOEDUKASI Jurnal IPA Terpadu Journal of Natural Science and Integration Biosfer: Jurnal Pendidikan Biologi EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA LENSA (Lentera Sains): Jurnal Pendidikan IPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Bioma : Jurnal Biologi Indonesia Diklabio: Jurnal Pendidikan dan Pembelajaran Biologi Assimilation: Indonesian Journal of Biology Education Bio Educatio : The Journal of Science and Biology Education Jurnal BIOEDUIN : Program Studi Pendidikan Biologi Bioedukasi: Jurnal Pendidikan Biologi ABDIMAS SILIWANGI Lectura : Jurnal Pendidikan Paspalum: Jurnal Ilmiah Pertanian BIOSFER : Jurnal Biologi dan Pendidikan Biologi Jurnal Mangifera Edu JURNAL PENDIDIKAN MIPA Bio-Inoved : Jurnal Biologi-Inovasi Pendidikan Journal of Welding Technology Jurnal Biogenerasi BIO-EDU: Jurnal Pendidikan Biologi Jurnal Pendidikan Teknik Mesin Undiksha BERNAS: Jurnal Pengabdian Kepada Masyarakat Spizaetus: Jurnal Biologi dan Pendidikan Biologi SIMBIOSA Indonesian Journal of Social Research (IJSR) Yumary: Jurnal Pengabdian kepada Masyarakat Jurnal Riset Teknologi Pencegahan Pencemaran Industri Jurnal Kependidikan: Jurnal Hasil Penelitian dan Kajian Kepustakaan di Bidang Pendidikan, Pengajaran dan Pembelajaran JIPB (Jurnal Inovasi Pembelajaran Biologi) Bioed : Jurnal Pendidikan Biologi El-Jughrafiyah : Jurnal Geografi dan Terapannya Jurnal Pendidikan Dasar dan Sosial Humaniora Al Jahiz: Journal of Biology Education Research Journal of Comprehensive Science Journal of Mathematics Science and Computer Education Jurnal Ilmiah Ilmu Terapan Universitas Jambi Biology and Education Journal (BaEJ) Acta Pedagogia Asiana Jurnal Penelitian Ekonomi Manajemen dan Bisnis Gunung Djati Conference Series Filogeni: Jurnal Mahasiswa Biologi Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) Tropical Genetics SEARCH: Science Education Research IBERS : Jurnal Pendidikan Indonesia Bermutu Biodik: Jurnal Ilmiah Pendidikan Biologi Jurnal Pendidikan & Pengajaran Reinwardtia Jurnal Pendidikan IPA Indonesia Journal of Computers for Society Jurnal Pendidikan MIPA Jurnal Mahasiswa Sistem Informasi Galuh (JMSIG) IJIS Edu : Indonesian Journal of Integrated Science Education Journal of Biology, Environment, and Edu-Tourism Advanced Journal of STEM Education (AJOSED) Scientiae Educatia: Jurnal Pendidikan Sains Jurnal Pendidikan Sains Indonesia (Indonesian Journal of Science Education) JIPI (Jurnal IPA dan Pembelajaran IPA) THABIEA : JOURNAL OF NATURAL SCIENCE TEACHING

Topik Hidayat

Universitas Pendidikan Indonesia

Author-ID : 281692

Religion Agriculture, Biological Sciences & Forestry Arts Humanities Astronomy Automotive Engineering Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Mechanical Engineering Medicine & Pharmacology Neuroscience Nursing Physics Public Health Social Sciences Veterinary Other

Published : 166 Documents Claim Missing Document

Claim Missing Document

Articles

13 14 15 16 17

Ethnoscience Course Program Oriented Towards Education for Sustainable Development (ESD): A Needs Assesment Aldeva Ilhami; Topik Hidayat; Riandi Riandi; Siti Sriyati
SEARCH: Science Education Research Journal Vol. 4 No. 2 (2026): SEARCH: April 2026
Publisher : IAIN Sorong

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47945/search.v4i2.2813

Ethnoscience is one of the compulsory courses in the Science Education program. The implementation of Education for Sustainable Development (ESD) should be integrated into the ethnoscience course to enhance the awareness of prospective science teachers regarding the environment and sustainability. This study aims to analyze the implementation of the ethnoscience course program at a Teacher Training Institution (LPTK) in Riau Province. A case study methodology was employed, involving the analysis of ethnoscience course documents, observation and interviews with lecturers. The data were analyzed using qualitative descriptive methods based on the Miles-Huberman framework. The course implementation plan has met the established standards, and the majority of the learning outcomes align with the qualifications set by the Indonesian National Qualification Framework (KKNI). The ethnoscience course uses a research approach that examines the reconstruction of indigenous knowledge into scientific knowledge, though it has yet to emphasize sustainability literacy. Lecturers face challenges in accommodating the depth of content derived from student projects. Stakeholders should consider policies for collaborative teaching,like citizen science project in ethnoscience to support the optimization of achieving the course’s expected competencies.

Where Tradition Meets Innovation: Ethnoscience, Creativity, and the Future of Project-Based Learning in Higher Education Muhammad Fuad Sya'ban; Adi Rahmat; Siti Sriyati; Omay Sumarna
Journal of Mathematics Science and Computer Education Vol 6, No 1 (2026): MAY 2026
Publisher : Universitas Lambung Mangkurat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20527/jmscedu.v6i1.18260

Indigenous knowledge systems hold untapped potential for fostering creativity in higher education, yet their integration with project-based learning remains systematically unexplored. This study aimed to examine the effectiveness of ethnoscience-integrated project-based learning in developing creativity among higher education students and to map the current research landscape to identify thematic clusters, temporal patterns, and future directions. We employed systematic literature network analysis, combining systematic review with bibliometric analysis. Following PRISMA 2020 guidelines, a total of 49 articles were retrieved and subjected to keyword co-occurrence analysis using VOSviewer, of which six met full inclusion criteria and were systematically reviewed for empirical effectiveness. All six studies demonstrated positive creativity effects (100% directional consistency, p < 0.001) with moderate-to-large effect sizes (d = 0.4–0.6). Three mechanisms emerged: cultural relevance enhancing engagement, traditional knowledge providing novel perspectives, and community connections fostering applied creativity. Bibliometric analysis identified five major research clusters, revealing that ethnoscience integration shows near-complete absence from mainstream literature despite strong empirical support. These findings conclude that ethnoscience-integrated PBL consistently outperforms conventional approaches in both creativity quality and depth of applied problem-solving, suggesting its strong potential as a decolonizing and equity-driven pedagogy for higher education. The implications point toward the urgent need for curriculum redesign that embeds indigenous epistemologies, faculty development in cultural competency, and co-designed, culturally responsive assessment instruments. Looking ahead, the future of ethnoscience, creativity, and PBL in higher education lies in large-scale cross-cultural trials; technology-enhanced ethnoscience learning respecting indigenous data sovereignty; and community-led participatory research that positions indigenous knowledge holders as co-educators and co-researchers.

Perubahan Miskonsepsi Siswa pada Perkuliahan Evolusi Melalui Dual Situated Learning Model Adri, Helmia Tasti; Rustaman, Nuryani Y; Tapilouw, Fransisca Sudargo; Hidayat, Topik
Bioedukasi: Jurnal Pendidikan Biologi Vol 12, No 2 (2019): Bioedukasi: Jurnal Pendidikan Biologi
Publisher : Department of Biology Education Faculty of Teacher Training and Education Sebelas Maret Un

This research departs from the many found misconceptions experienced by students in evolutionary lectures. So it is very important to make improvements. The efforts carried out in this study were to improve students' misconceptions through the use of Dual situated learning model as a model of change in conception based on the criteria considered to be very capable of correcting problems. The study was conducted at a public university in Bandung in the department of biology with 33 respondents as the subject of research. To find out the success of the activities carried out, data was taken using the Certainty of response index test. The results found are that there is a significant effect of Dual Situated Learning Model usage on the level of change in student misconception.

Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.

Plant vs. Animal, Which is the Most Prefer Understanding of Evolution? Hana Gardenia Mahbubah; Topik Hidayat; Bambang Supriatno
International Journal of Science and Applied Science: Conference Series Vol 2, No 1 (2018): International Journal of Science and Applied Science: Conference Series
Publisher : Universitas Sebelas Maret

Evolution is one of the main subjects of biology taught in science colleges. Unfortunately, students seem less attention to this subject. In the subject of evolution, the lesson commonly uses the animal as a model to improve the students understanding. The purpose of this study is to compare the ability of tree thinking students who use animals and plants as a model in the evolution lesson. Tree thinking refers to an approach to evolution that emphasizes reading and interpreting phylogenetic tree. This study involved 20 undergraduate students enrolled in the evolution course for biology majors at Universitas Pendidikan Indonesia (UPI). The tree thinking ability of students was measured using Tree Thinking Concept Inventory (TTCI) of Naegle with a little modification. In this test, we analyzed student preferences using animal or plant models using phylogenetic tree diagrams. Results showed that students’ TTCI score was higher when using animal models (65.42%) than plant models (55%). These results suggested that students remain to prefer animal models compare to plant models to study evolution. Nevertheless, the use of plants as models can be an alternative to learning evolution in the future.

ANALISIS FILOGENETIK FAMILI ZINGIBERACEAE & COSTACEAE BERDASARKAN PENANDA MATK DAN GEN PARSIAL Topik Hidayat; Teressa Novita Evelyn; Nadya Rahma Widyanti; Nadia Nurul Fadhilah; Muhammad Zainal Arifin
Jurnal Biogenerasi Vol. 10 No. 4 (2025): Volume 10 nomor 4 tahun 2025 Terbit Oktober-Desember 2025
Publisher : Universitas Cokroaminoto Palopo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30605/biogenerasi.v10i4.7827

This study analyzes the phylogenetic relationship between the Zingiberaceae and Costaceae families based on partial maturase K (matK) gene sequences and examines their common ancestry. A molecular systematic approach was applied, with DNA sequences aligned using ClustalX 2.1 and edited in BioEdit 7.0.5. Phylogenetic reconstruction was conducted using the maximum parsimony method in PAUP 4.0b10 with heuristic search and 1000 bootstrap replications. The results show a clear separation between Zingiberaceae and Costaceae, with Musa (Musaceae) as the outgroup. Costaceae is identified as the sister family of Zingiberaceae, indicating a shared ancestor. The paraphyletic nature of Costus and taxonomic anomalies likely reflect limited resolution of partial matK data.

Virtual Laboratory Implementation in Molecular Biotechnology: Change in Prospective Biology Teachers’ Self-System and Mental Procedures Tengku Idris; Adi Rahmat; Topik Hidayat; Riandi Riandi; Mustafa Çakir
Jurnal Pendidikan IPA Indonesia Vol. 15 No. 2 (2026): June 2026
Publisher : Universitas Negeri Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/jpii.v15i2.44610

Limitations in laboratory facilities and the demands of 21st-century learning require technology-based instructional innovations in molecular biotechnology courses. Therefore, the use of virtual laboratories has become a relevant solution for improving students’ procedural skills and fostering the development of their self-system in a sustainable manner. The objective of this study is to observe the influence of and improvements in students’ self-system and mental procedures during molecular biotechnology lectures using a virtual lab, as well as the relationship between these two variables. This study used two methods: an experimental single-group pretest-posttest design and a diary study. The research sample was selected purposively from two universities. The instruments used in this study were questionnaires, questions, and observation sheets. The research data were analyzed descriptively, using the Wilcoxon Signed-Rank test to test for differences in means, the Spearman's rho correlation test, and linear regression testing. The results showed a moderate increase in the self-system category (N-gain = 0.59) from 67.60 to 87.58 and in the mental procedural category (N-gain = 0.69) from 15.42 to 68.94. Both increases were significant, with p-values (0.000) > α (0.05) and an effect size of 0.87 in the large category. Both variables showed a significant relationship (ρ = 0.40) and a self-system contribution to 11.5% increase in mental procedures. The findings of this study indicate that the use of virtual labs in biotechnology lectures can significantly improve students' self-system and mental procedural abilities.

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/jpii.v15i2.44610

Comparison of Machine Learning Algorithms for Species Family Classification using DNA Barcode Riza, Lala Septem; Rahman, M Ammar Fadhlur; Prasetyo, Yudi; Zain, Muhammad Iqbal; Siregar, Herbert; Hidayat, Topik; Abu Samah, Khyrina Airin Fariza; Rosyda, Miftahurrahma
Knowledge Engineering and Data Science
Publisher : citeus

Show Abstract | Download Original | Original Source | Check in Google Scholar

Classifying plant species within the Liliaceae and Amaryllidaceae families presents inherent challenges due to the complex genetic diversity and overlapping morphological traits among species. This study explores the difficulties in accurate classification by comparing 11 supervised learning algorithms applied to DNA barcode data, aiming to enhance the precision of species family classification in these taxonomically intricate plant families. The ribulose-1,5-bisphosphate carboxylase-oxygenase large sub-unit (rbcL) gene, selected as a DNA barcode locus for plants, is used to represent species within the Amaryllidaceae and Liliaceae families. The experimental results demonstrate that nearly all tested models achieve accurate species classification into the appropriate families, with an accuracy rate exceeding 97%, except for the Naïve Bayes model. Regarding computational time, the Random Forest model requires significantly more time for training than other models. Regarding memory usage, the Least Squares Support Vector Machine with a polynomial kernel, and Regularized Logistic Regression consume more memory than other models. These machine learning models exhibit strong concordance with NCBI's classifications when predicting families using the test dataset, effectively categorizing species into the Amaryllidaceae and Liliaceae families.

Analisis Kemampuan Representasi Visual Siswa dalam Menginterpretasi Diagram Siklus Hidup Bryophyta: Analisis Kemampuan Representasi Visual Siswa dalam Menginterpretasi Diagram Siklus Hidup Bryophyta Dewi Susanti; Adi Rahmat
Spizaetus: Jurnal Biologi dan Pendidikan Biologi Vol 6 No 2 (2025): Spizaetus: Jurnal Biologi dan Pendidikan Biologi
Publisher : Program Studi Pendidikan Biologi, FKIP, Universitas Nusa Nipa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55241/spibio.v6i2.564

Visual representation is important for scientific communication. One form of visual representation is a diagram. When representing diagrams, there are still students who fail to read labels or titles, misunderstand color codes, or follow arrows in the wrong direction. The aim of this research is to analyze students' ability to visually represent and interpret the Bryophyta life cycle diagram. The visual representations analyzed are internal and external visual representations. This study uses a descriptive approach involving one biology teacher and 33 students from grades X, XI, and XII at one of the high schools in the city of Bandung. Data were obtained through worksheets and semi-structured interviews. Internal visual representation is obtained from the activity of reading and re-representing the available diagrams, while external visual representation is obtained from the activity of redrawing the Bryophyta diagram based on one's own understanding. Assessment is conducted based on three main indicators: the number of phases, the sequence of phases, and the accuracy of phase descriptions. Scores are converted into percentages and categorized into five levels of proficiency: very good, good, moderate, poor, and very poor. The analysis results show that the internal visual representation of students in grades X, XI, and XII falls into the poor category, while the external visual representation of students in grades X and XI falls into the good category, and grade XII falls into the moderate category. The analysis also shows a relationship between visual representation and prior knowledge. These findings have important implications for the development of visual-based learning and mapping students' difficulties in understanding diagrams.

Co-Authors ., sarbino A. Ch. Likadja, Jeffry A.A. Ketut Agung Cahyawan W Aa Juhanda Abd. Rasyid Syamsuri Abdull Rahim Mohd Yusoff Abdur Rasyid, Abdur Abu Samah, Khyrina Airin Fariza Adelia Aryani Putri Adhi Yuniarto Adi Pancoro Adi Pancoro Adi Rahmat Aditya Suganda Aditya Suganda, Aditya Adriana Hiariej, Adriana Agus Sutanto Aini, Via Aldeva Ilhami Aldeva Ilhami Amalianneisha Rafadewi Andhanatami Putri Amelia Pardiana Putri Ana Ratna Wulan Ananda Yhuto Wibisono Putra Ananda, Aisya Belva Ananda, Gheri Febri Annisa Salsyabila Rahmi Any Fitriani Ari Widodo Arini Rahmadana Aris Sunandar Aryanti, Fitri Astry Agusthina Muchtar Azmi Aris Bambang Supriatno Cita Tresnawati, Cita Dadang Sudirno Damayanti, Anggia Fitri Damayanti, Elok Dede Salim Nahdi Della Frisca Damayanti Denia Dwi Citra Resmi Dewi Susanti Dewi Susanti Dhiyassalam Imam Anshori Ismanto Diah - Kusumawaty Dian Din Yati Diardy Shauman Rachmatan Didik Priyandoko Dina Karina Islami Dina Mariana Dindin Nasrudin Donna Karolina Br Surbakti DWI SUSILANINGSIH Dwi Susilaningsih Dwicahya Supriatman, Rian E. Derozari, Petrus E. Ermayanti Ekajaya, Renandy Kristianlie Ekaputri, Rendi Zulni Eko Budi Raharjo Eko Budi Raharjo, Eko Budi Endlessa, Chayra Eni Nuraeni Euis Erlin Fadhil Muharram Fauzi Akbar Anugrah Fawzy Muhammad Bayfurqon Feni Oktaviani FENNY MARTHA DWIVANY Fidela Zhafirah Fitri Aryanti Fitri Aryanti Fitriani Nurpratiwi Susanto Fransisca Sudargo Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw Fransisca Sudargo Tapilouw, Fransisca Sudargo Fransisca Sudarto Tapilouw Ghullam Hamdu Giasintha Stefani Gusti, Utari Akhir Hafsah Hafsah Haibah Afifah Azmi Hana Gardenia Mahbubah Hani Susanti Hani Susanti, Hani Haris Abizar Hayat, Muhammad Syaipul Helmi Helmia Tasti Adri Hernawati Hernawati Homdijah, Oom Siti Husna Nugrahapraja I Gusti Bagus Wiksuana I NYOMAN RAI Ika Adhani Sholihah Ilhami, Aldeva Imam Nugroho Indri Rachmitasuci Ipin Aripin Ipin Aripin Ipin Aripin Ipin Aripin, Ipin Iqbal Syaichurrozi Jayawarsa, A.A. Ketut Jihan Bilqis Kelana, Himalaya Wana Ketut Wikantika Khamidun, Mohd Hairul Kocha, Santana Koosbandiah Surtikanti, Hertien Kurniawan, Iwan Setia Kusdianti Kusdianti Kusdianti Kusdianti Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kusnadi Kwabena, James Lala Septem Riza Lia Lutianasari Lia Lutianasari Lilit Rusyati Listia Andriani Luthfiah Nurfajriyah Maftuha, Mahda Rizqina Mahbubah, Hana Gardena Mahmoud Fahsi Mahmudah Nur Cahyaningrum Manullang, Wahyu Efendi Mayla Maulida Meilia Gemilawati Meitha, Karlia Miftakhul Bakhrir Rozaq Khamid Motomi - Ito Motomi - Ito, Motomi - Mr Amprasto Mr Sjaeful Anwar Mrs Sariwulan Diana Mu'aziyah, Siti Eneng Sururiyatul Mubiar Agustin Muhamad Wafda Jamil Muhammad Fakhri Basyir Muhammad Fuad Sya'ban Muhammad Syaipul Hayat Muhammad Syaipul Hayat Muhammad Zainal Arifin Mustafa Çakir Mustafa Cakir Nadia Nurul Fadhilah Nadya Rahma Widyanti Nahadi Nahdiyati, Kartika Najira Natadiwijaya, Ismail Fikri Nengsih Juanengsih Nifrah Mislah Ningrum, Siti Ratu Rahayu Nisrina Sukriandi Nissa Rachmawati Nono Sutarno Nono Sutarno Novi Sofia Fitriasari Novita Sariani Nur Hamidah Nur Hamidah, Nur Nur'aeni, Epon Nurani Rahmawati, Dini Nurfauziah, Ade Nurhayati, Ai Siti Nurlela Nurlela Nururrahmani, Azmah Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Rustaman Nuryani Y Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Y. Rustaman Nuryani Yogipratama Rustaman Omay Sumarna Ono Rokhadhitomo Pangsuma, Nisa Pisca Hana Marsenda Purnamaulida Pratiwi Putra, Armansyah Putri Yunitha Wardiny Putri, Meirin Dwiningtyas Putri, Novi Indrya R. Riandi, R. Rafi Muhammad F Rahadian Rasyid Alyasa Rahman, M Ammar Fadhlur Rahmawati, Rima Aulia Ratni Purwasih Regina Anindya Putri Riandi Riandi Riandi Riandi Ridwan - Rifki Risma Munandar Rifki Risma Munandar Rifki Risma Munandar Rini Marwati Rini Nuroni Awaliyah Rini Nuroni Awaliyah Rini Solihat Risky Ayu Kristanti Risma Munandar, Rifki Rizky Nadhif Nandana Rosinta Septiana, Rosinta Rosyda, Miftahurrahma Sa'diatul Fuadiyah Salsabila, Amalia Putri Samah, Khyrina Airin Fariza Abu Santi Sri Rahayu Prajayanti Sariwulan Diana Setiasih Setiasih, Setiasih Setiono Sholihah, Ika Adhani Sidiq, Maulana Sihombing, Maria Engzelita Siregar, Herbert Siti Sriyati Siti sriyati Soesy Asiah Soesilowaty Sofi Rahmania Solihat, Syifa Sri Anggraeni Sri Redjeki Sri Redjeki Sri Redjeki Sri Redjeki Stevia Ladisa SUHIRMAN SUHIRMAN Sumiyati Sa'adah Sungkono Sungkono Surtikanti Hertien Koosbandiah, Surtikanti Sururi, Zaki Fahreza Susbiyanto, Susbiyanto Syamsiar, Syamsiar Sylva Sagita Taufik Rahman Taufik Rahman Tengku Idris Tengku Idris, Tengku Teressa Novita Evelyn Tiara Putri Hendriani Tomi Hidayat Tomohisa - Yukawa Tomohisa - Yukawa, Tomohisa - Tony Hadibarata, Tony Tony Hadibrata Turahmah, Ai Himma Tuszie Widhiyanti Tyas Farrah Dhiba Umarlin, Sindy Utari Akhir Gusti Visi Tinta Manik Vitta Yaumul Hikmawati Wahyu Surakusumah Wawan Setiawan Wida Herlina Widi Purwianingsih Widya Cristanti Win Heri Sarfudin YAYAN SANJAYA Yayan Sanjaya Yayan Sanjaya Yenni Verawati Yogi Yogi Yudi Prasetyo Yuyun Maryuningsih Zain, Muhammad Iqbal

Title

Found 166 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 166 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 166 Documents
Search