Claim Missing Document
Check
Articles

Found 3 Documents
Search
Journal : Journal of Fisheries

Prevalensi dan Tingkat Kelulushidupan Ikan Mas (Cyprinus carpio) yang Diuji Tantang dengan Protein Spora Utuh Myxobolus Koi Di Tambak [ Prevalence and The Survival Rate Of Gold Fish (Cyprinus carpio Linn) that Challenced Whole Protein Spore Myxobolus Koi in Pond] Gunanti Mahasri; Nedi Nedi; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v7i1.11235

Abstract

Abstract One of parasite disease that often outbreak is protozoan disease that caused by Myxobollus koi, that recaqniced Myxobolusis. Starting at 2009 this disease included in fish quarantine disease, because it can caused fish sick and dead. This disease can to be big problem in aquaculture, it can caused mortality 60-90%, with the prevalence reach 100%. In 1974 and 1978 the myxobolusis case happened in Indonesia and it caused mortality antil 100% in seed stadium. The aims of this Research are to detect the prevalence of the gold fish (Cyprinus carpio Linn) that infected by Myxobolus koi that challence by spora protein of Myxobolus koi in pond and want know abaout the survival rate of gold fish (Cyprinus carpio Linn) that challence by protein spora of Myxobolus koi in pond. This Research is field experiment that consist to 4 group, this are : KP1= Controle (No challence by protein spore and nor infected by Myxobolus koi) ; KP2 = challence by protein spore and infected by the dose 600 µl/l/one fish and infeted by Myxobolus koi dengan with dose 80 spore / liter, KP3 = No challence by Protein spore with dose 600 µl/l/one fish and was infected by Myxobolus koi with dose 80 spore / liter and KP4 = challence with Protein spore and not infcteted by Myxobolus koi. The result showed that the highest prevalence 74% found on gold fish that infected by Myxobolus koi and not dipping by whole protein spore before scatter in pond and in 60 days age. Whole Protein spore of Myxobolus koi can be decreased the prevalence of the gold fish (Cyprinus carpio Linn) infected by Myxobolus koi in pond 47,8% for 30 days age, 62,1% for 60 days and 69% for 90 days age in pond. The Whole Protein spore of Myxobolus koi also can increased the survival rate of gold fish (Cyprinus carpio Linn) in pond from 29% to 81%, it means that whole protein spore can increased in 179,3%.
Analisis Respons Imun Ikan Koi (Cyprinus carpio Koi) yang Divaksin dengan Whole Protein Spora Myxobolus koi sebagai Kandidat Vaksin Myxobolusis [ Immune Response Analysis of Fish Koi (Cyprinus carpio Koi) Vaccinated Myxobolus Koi Spores Whole Protein as Vaccine Candidate Myxobolusis] Gunanti Mahasri; Mohamad Yusuf; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v7i1.11237

Abstract

Abstract Myxobolus is one of parasites on koi fish that belongs to a class myxosporea that can infect and systemic and can cause harm to the fish farming. Vaccination is an attempt to cause-specific endurance through vaccination. Observations differential leukocytes and increased optical density values can be used to determine the effectiveness of the vaccine is given. This study aims to analyze the immune response koi fish vaccinated with Myxobolus koi spores whole protein for vaccine development myxobolusis in koi fish. The method used in this study is Completely Randomized Design with 4 treatments and 5 replications. The results showed that a change in the total number and types of leukocytes that can be used as indicators of the presence of certain infectious diseases that occure in fish. The highest value of lymphocytes in treatment B, monocytes highest in treatment D, neutrophils on treatment D, eosinophils on treatment A and basophils highest in treatment A. The observation of the highest optical density value in treatment B (fish vaccinated and infected 80 M. koi spores / tail) of 0.593 at day 30, while the lowest in treatment D (fish are not vaccinated but diinveksi 80 M. koi spores / tail) of 0,064 in 30 days
Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ] Gunanti Mahasri; Lestari Wilujeng; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v6i2.11294

Abstract

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Co-Authors Abdul Samik Adi Sofyan Ansori, Muhammad Adiana Mutamsari Witaningrum Adikara, Tatang Santanu Aksono HP., Eduardus Bimo Al arif, Mohammad Anam Al Arif, Muhammad Anam Alasrorik, Muhammad Hizbulloh Alfina Azkiana Amalia Rosydinasari Rosydinasari Anam Al Arif andi jayawardhana Andi Jayawardhana Ardianto Ardianto Arif Pratiwi Arif Rahman Nurdianto Arimbi Aryaloka, Suhita Aryati Aryati Aryati Aryati Azizah Bilqis Nurkarimah Bagaskara, Ryan Bambang Sektiari Lukiswanto Benjamin Christoffel Tehupuring, Benjamin Christoffel Berlina, Cyrcilia Relita Boedi Setiawan Choirunnisa, Indaka Rachmah Chusniati, Sri Cindy Ercha Aulia Putri Dadik Rahardjo, Dadik Desty Shafira Dewi Purwatiningsih Dhimar Maulud Dyahningrum Dian Ayu Permatasari Didik Handijatno Djoko Legowo Djoko Legowo Doohan Mahendra Doohan Mahendra DWI PUTRI RAHMAWATI Dyah Ayu Kurniawati Dyah Ayu Kurniawati Edward Yonas Kristijanto Eka Pramyrtha Hestianah Eka Pramyrtha Hestianah, Eka Pramyrtha Elok Apriliawati Emy Koestanti Sabdoningrum Endah Rochmatika Endang Suprihati Endang Suprihati Erma Safitri Fakhryyah Maharani Deviyanti Farezi, Reza Adrio Fatmawati, Mira Fatmawati Fauziah Fitri Hernanto Fedik Abdul Rantam Firdaus , Muhammad Aviv Fitri, Paraswita Eindah Fransiska Cicilia Beka Frida Aulya Arningdiah Galaxy Guardian Gunanti Mahasri Haditanojo, Wiyanto Hana Eliyani Hana Eliyani Hani Plumeriastuti Hanna Harnida, Hanna Hartono Hartono Hayuning Nurrodhiya Heni Puspitasari Herdiansyah, Akbar Dimas Hermin Ratnani Herry Agoes Hermadi Hidanah , Sri Hidanah, Sri Ihda Hanny, Khurun'In Fadia IMAM MUSTOFA Indasari, Elly Nur Ira Sari Yudaniayanti Istiana, Izzatul Iwan Sahrial Hamid Jayanti Dian Eka Sari, Jayanti Dian Joko Prastowo Jumria, Andi Kenconojati, Hapsari Khairullah, Aswin Rafif Khalissa Farah Alifia Koesdarto Koesdarto Kurniawan, Muhammad 'Ahdi Kurniawan, Muhammad ‘Ahdi Kurniawati, Dyah Ayu Kusnoto Kusnoto Kusnoto Kusnoto Kusnoto, Kusnoto Legowo, Djoko Lestari Wilujeng Lilik Maslachah Lisnanti, Ertika Fitri Lucia Tri Suwanti, Lucia Tri Luqman, Epy Muhammad Lutfiah Annisa Billa Luthfiyyah Nur Afifah Siswandi Mafruchati, Maslichah Maghfiroh, Nurutin Tutur Bifatikhatil M Masdiana C Padaga Melani Anggraini Melanie Aulia Ashfiyah Mirni Lamid Mirni Lamid Mochammad Amin Alamsjah Mohamad Yusuf Mohammad Guritno Suryokusumo Moses, Ikechukwu Benjamin Mufa, Ramy Inas Mahirah Muhamad Amin Muhammad Ahdi Kurniawan Muhammad Al-Syafiq bin Abdul Halim Muhammad Ridwan Muslimah, Bintang Mustofa Helmi Effendi Nedi Nedi Nenny Harijani Ni Komang Aprilina Widisuputri Nining Sari Virgandina Vinola Nizar Bachrudin Prihandono Nunuk D.R. Lastuti Nunuk Dyah Retno Lastuti Nurdianti Nurdianti Nurdianto, Arif Rahman Nurfaizah, Diza Ulya Nusdianto Triakoso Nuurin Ajrin Karim Ochtavia, Sherly P Kumaladewi Permata Sari, Dian Ayu Pinatih, Ayu Komang Ria Trie Dewi Poedji Hastoetik Poedji Hastutiek Poetranto, Emmanuel Djoko Pradana, Giffari Danindra Praja, Ratih Novita Pratama, Bima Putra Pratama, Ponasari Galuh Pratiwi, Arif Primarizky, Hardany Puput Ade Wahyuningtyas Puput, Sesa Purbowati, Tri Endah Puspikawati, Septa Indra Rahadju Ernawati Rahardjo, Adi Prijo Rahmandari, Dina Agylia Rahmatullah, Aldin Akbar Ramadhana Ramadhana Ramadhanty, Miladhiyah Nabila Ratna Damayanti Rekasni Adallin A/P Morgan A/P Morgan Retno Yuli Rimayanti Rina Vitriasari Riwu, Katty Hendriana Priscilia Romy Muhammad Dary Mufa Romziah Sidik Rosyta, Pegy Sabdoningrum, Emy Koestanti Saksono, Bayu Sapto Andriyono Sari, Fifin Kurnia Septian Hakim Susantoputro Setiawan Koesdarto Setiawan Kusdarto Sherly Ochtavia Silfia, Himatul Ilma Soeharsono Soeharsono Soetojo Soetojo Sri Agus Sudjarwo Sri Pantja Madyawati Sri Pantja Madyawati, Sri Pantja Sukarno, Gerda Sumartono Sumartono Sunarso, Agus Susilo, Rahadian Indarto Talita Yuanda Reksa Taufan Ary Handoko Tita Damayanti Lestari Tony Hartono Tri Suwanti, Lucia Tri Wahyu Suprayogi Trifena Pristi Anindyta Tyasningsih, Wiwiek Vindo Rossy Pertiwi Wahidan Qodiip Maulana Warda Nafalizza Efendi Warsito, Sunaryo Hadi Widi Nugroho Widya Paramita Lokapirnasari Widya Paramita Lokapirnasari Win Darmanto Wiwik Misaco Yuniarti Wiwik Misaco Yuniarti Wurlina, W Yudanianyi, Ira Sari Yudaniayanti , Irasari Yudhana, Aditya Yulianna Puspitasari Yunus, Muchammad ZULFAH