Article Per Year (5 Year)
p-Index From 2021 - 2026
6.327
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Jurnal Veteriner Indonesian Journal of Applied Sciences Media Kedokteran Hewan Jurnal Ilmu-Ilmu Peternakan (Indonesian Journal of Animal Science) Jurnal Biosains Pascasarjana JITRO (Jurnal Ilmiah dan Teknologi Peternakan Tropis) Aceh Journal of Animal Science Jurnal Ilmiah Kedokteran Wijaya Kusuma Qanun Medika - Medical Journal Faculty of Medicine Muhammadiyah Surabaya Jurnal Ilmu Nutrisi dan Teknologi Pakan Jurnal Medik Veteriner NERSMID: Jurnal Keperwatan dan Kebidanan Jurnal Ilmiah Fillia Cendekia Journal of Aquaculture and Fish Health Veterinary Biomedical and Clinical Journal Jurnal Ilmu Peternakan Terapan Journal of Parasite Science Ovozoa: Journal of Animal Reproduction Journal of Applied Veterinary Science and Technology Bioscientist : Jurnal Ilmiah Biologi journal of Basic Medical Veterinary Jurnal Kedokteran Hewan Journal of Fisheries & Marine
Mufasirin
Divisi Parasitologi Veteriner, Universitas Airlangga, Surabaya
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Dentistry Education Environmental Science Health Professions Immunology & microbiology Medicine & Pharmacology Neuroscience Nursing Public Health Social Sciences Veterinary Other

Published : 74 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 74 Documents
Search

 2   3   4   5   6 
THE DILATATION OF BRAIN VENTRICLE DUE TO CONGENITAL TOXOPLASMOSIS IN MICE CORRELATED WITH APOPTOSIS BUT NOT WITH TRANSFORMING GROWTH FACTOR BETA Lucia Tri Suwanti; Mufasirin Mufasirin; Hani Plumeriastuti
Jurnal Kedokteran Hewan Vol 12, No 1 (2018): March
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (600.441 KB) | DOI: 10.21157/j.ked.hewan.v12i1.5428

Abstract

This study aimed to determine the occurences of mice brain ventricles dilatation that congenitally infected with Toxoplasma gondii (T. gondii) as a marker of hydrocephalus and cellular changes in the brain. A total of twenty pregnant mice (11.5 days pregnacy) were divided into 2 groups, which were control (P1) group and treatment (P2) group. The mice in the treatment group were infected with 101 tachyzoites of T. gondii. All mice were maintained until delivery. The newborn mice were sacrificed and their brain were removed and fixed in 10% buffered formalin to prepare histology slides with HE staining for observation of ventricular width, TUNEL assay for apoptosis observation, and immunohistochemistry for the expression of transforming growth factor beta (TGF-β) observations. The data were analyzed using t test and linear regression. The results showed that ventricular width and apoptosis index significantly increased (P0.01) in the treatment group compared to control group, but there was no difference in the expression of TGF-β (P0.05) in both groups. Dilatation of ventricle correlated with the apoptotic index of brain cells but did not correlated with the expression of TGF-β.
Identification and Prevalence of Endoparasite on Layer Chicken in Udanawu Sub-district Blitar Khalissa Farah Alifia; Setiawan Koesdarto; Yulianna Puspitasari; Mufasirin; Adiana Mutamsari Witaningrum
Journal of Parasite Science (JoPS) Vol. 7 No. 1 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i1.38769

Abstract

The aim of this research was to determined the prevalence and infection degrees of endoparasite on layer chicken in Sub-district Udanawu, Blitar. Ninety-six samples were taken from layer chicken in 3 different villages namely Bakung Village, Tunjung Village, and Slemanan Village. The examinations taken in this study are fecal examination using native, sediment, and floating methods and blood examination using blood smear method. Result showed that 81.25% samples are positive for helminthiasis infection consisting of Ascaridia galli (66.67%), Heterakis gallinarum (45.83%), Raillietina sp. (31.25%), and Strongyloides avium (7.29%). Blood examination result shown there is no positive sample that infect layer chicken in Sub-district Udanawu, Blitar. Chi-Square test result showed there are significant difference (P<0.05) of Ascaridia galli and Heterakis gallinarum in Bakung Village, Tunjung Village, and Slemanan Village in Sub-district Udanawu, meanwhile there are no significant difference (P>0.05) of Raillietina sp. and Strongyloides avium. Range of infection degrees of helminthiasis in Bakung village, Tunjung village, and Slemanan Village are 608.75 ± 588.53, 223.12 ± 359.21, 156.25 ± 332.39. There are significant difference (P<0.05) on helminthiasis infection degree of layer chicken in Udanawu District, Blitar.
Identification of Gastrointestinal Parasite in Hospitalized Cats at Several Animal Clinics in Surabaya Using Faecal Examination Method Luthfiyyah Nur Afifah Siswandi; Agus Sunarso; Iwan Sahrial Hamid; Mufasirin; Nusdianto Triakoso
Journal of Parasite Science (JoPS) Vol. 7 No. 1 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i1.39689

Abstract

The aim of this study is to identify the parasite species and prevalence of gastrointestinal parasites that infect cats hospitalized at several veterinary clinics in Surabaya using the faecal examination method. The type of this research is an observational with research design used in this study is a cross sectional study. The samples used in this study were 100 cat feces that were hospitalized at several veterinary clinics in Surabaya and each took 25 fecal samples. This sample was examined using native, sedimentation, and floating methods. The results showed 35% of samples were positively infected by gastrointestinal parasites with 28% parasites as single infection and 7% as mixed infection. The gastrointestinal parasites that identified in this study were Toxocara cati, Ancylostoma sp., Cryptosporidium sp., Isospora felis, and Isospora rivolta. The results of statistical analysis with chi square test showed that sex and age were not related to the prevalence of the gastrointestinal parasites in hospitalized cats at several animal clinics in Surabaya.
Efek Proteksi dari Terapi Oksigen Hiperbarik terhadap Ekspresi Bcl-2 Miometrium Rattus norvegicus Bunting yang Terinfeksi oleh Tachyzoite Toxoplasma gondii Arif Rahman Nurdianto; Aryati Aryati; Mohammad Guritno Suryokusumo; Mufasirin Mufasirin
Jurnal Ilmiah Kedokteran Wijaya Kusuma Vol 9, No 1 (2020): MARET 2020 available online since April 2020
Publisher : Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30742/jikw.v9i1.730

Abstract

Hyperbaric Oxygen Therapy (HBOT) can increase oxygen delivery to tissues and stimulate the formation of H2O2 as a secondary messenger for phosphorylation of nuclear factor kappa beta (NF-kB) which plays an important role in the transcription of the anti apoptotic gene. This study aimed to determine the effects of Hyperbaric Oxygen Therapy (HBOT) in enhancing the expressions of Bcl-2 in the myometrium of pregnant rats infected by Toxoplasma gondii. This study was an experimental study with a randomized control group of post-test only and designed by 37 pregnant Rattus norvegicus Sprague Dawley. Randomly, the rats were divided into four groups. Group A is infected pregnant rats that exposed by 10 sessions of HBOT 2.4 ATA in 3x30 minutes. Group B is non-infected pregnant rats and exposed by 10 sessions of HBOT 2.4 ATA in 3x30 minutes. Group C is infected pregnant rats without any exposure. Group D is non-infected pregnant rats without any exposure. Each infected pregnant rat was given a 103 tachyzoite of T.gondii by intraperitoneal injection. Bcl-2 expressions were measured through immunohistochemistry. All data were analyzed using ANOVA test through SPSS 21 program application. There was a significant difference in Bcl-2 expression between Group A and Group C because p<α (p<0.017). HBOT can increase the expression of Bcl-2 from infected and not infected rat myometrium, in the provision of HBOT 2.4 ATA for 3x30 minutes, twice a day for 5 days.
Prevalensi dan Tingkat Kelulushidupan Ikan Mas (Cyprinus carpio) yang Diuji Tantang dengan Protein Spora Utuh Myxobolus Koi Di Tambak [ Prevalence and The Survival Rate Of Gold Fish (Cyprinus carpio Linn) that Challenced Whole Protein Spore Myxobolus Koi in Pond] Gunanti Mahasri; Nedi Nedi; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v7i1.11235

Abstract

Abstract One of parasite disease that often outbreak is protozoan disease that caused by Myxobollus koi, that recaqniced Myxobolusis. Starting at 2009 this disease included in fish quarantine disease, because it can caused fish sick and dead. This disease can to be big problem in aquaculture, it can caused mortality 60-90%, with the prevalence reach 100%. In 1974 and 1978 the myxobolusis case happened in Indonesia and it caused mortality antil 100% in seed stadium. The aims of this Research are to detect the prevalence of the gold fish (Cyprinus carpio Linn) that infected by Myxobolus koi that challence by spora protein of Myxobolus koi in pond and want know abaout the survival rate of gold fish (Cyprinus carpio Linn) that challence by protein spora of Myxobolus koi in pond. This Research is field experiment that consist to 4 group, this are : KP1= Controle (No challence by protein spore and nor infected by Myxobolus koi) ; KP2 = challence by protein spore and infected by the dose 600 µl/l/one fish and infeted by Myxobolus koi dengan with dose 80 spore / liter, KP3 = No challence by Protein spore with dose 600 µl/l/one fish and was infected by Myxobolus koi with dose 80 spore / liter and KP4 = challence with Protein spore and not infcteted by Myxobolus koi. The result showed that the highest prevalence 74% found on gold fish that infected by Myxobolus koi and not dipping by whole protein spore before scatter in pond and in 60 days age. Whole Protein spore of Myxobolus koi can be decreased the prevalence of the gold fish (Cyprinus carpio Linn) infected by Myxobolus koi in pond 47,8% for 30 days age, 62,1% for 60 days and 69% for 90 days age in pond. The Whole Protein spore of Myxobolus koi also can increased the survival rate of gold fish (Cyprinus carpio Linn) in pond from 29% to 81%, it means that whole protein spore can increased in 179,3%.
Analisis Respons Imun Ikan Koi (Cyprinus carpio Koi) yang Divaksin dengan Whole Protein Spora Myxobolus koi sebagai Kandidat Vaksin Myxobolusis [ Immune Response Analysis of Fish Koi (Cyprinus carpio Koi) Vaccinated Myxobolus Koi Spores Whole Protein as Vaccine Candidate Myxobolusis] Gunanti Mahasri; Mohamad Yusuf; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v7i1.11237

Abstract

Abstract Myxobolus is one of parasites on koi fish that belongs to a class myxosporea that can infect and systemic and can cause harm to the fish farming. Vaccination is an attempt to cause-specific endurance through vaccination. Observations differential leukocytes and increased optical density values can be used to determine the effectiveness of the vaccine is given. This study aims to analyze the immune response koi fish vaccinated with Myxobolus koi spores whole protein for vaccine development myxobolusis in koi fish. The method used in this study is Completely Randomized Design with 4 treatments and 5 replications. The results showed that a change in the total number and types of leukocytes that can be used as indicators of the presence of certain infectious diseases that occure in fish. The highest value of lymphocytes in treatment B, monocytes highest in treatment D, neutrophils on treatment D, eosinophils on treatment A and basophils highest in treatment A. The observation of the highest optical density value in treatment B (fish vaccinated and infected 80 M. koi spores / tail) of 0.593 at day 30, while the lowest in treatment D (fish are not vaccinated but diinveksi 80 M. koi spores / tail) of 0,064 in 30 days
Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ] Gunanti Mahasri; Lestari Wilujeng; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v6i2.11294

Abstract

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Stray Cat Gastrointestinal Protozoa Prevalence and Infection Degree in Madiun Public Health Center and Traditional Market Hayuning Nurrodhiya; Legowo, Djoko; Suprihati, Endang; Hastutiek, Poedji; Mufasirin; Rahardjo, Dadik
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.46201

Abstract

This study determine the prevalence and protozoa infection degree of gastrointestinal in stray cats at Public Health Center and Traditional Market of Madiun City. 80 fecal sample collected. Fecal samples examined with direct smear, sedimentation, and floatation method. Positive samples calculated using the Lucient-Brumpt method. The result of the examination in Public Health Center showed that 37,5% stray cat infected by Isospora sp., Entamoeba sp., and Cryptosporidium sp., with 1167.33a±168.373 infection degree. The examination result in Traditional Market showed that 62,5% stray cat infected by Isospora sp., Entamoeba sp., and Cryptosporidium sp., with 1186.00a±148.577 infection degree. The result of Chi Square analysis obtained p<0,05 indicated that there were significant differences between stray cat including faecal collection location, age, type of cat and faecal condition. The result of Kruskal Wallis analysis of the degree infection obtained p>0,05 indicated that there were no significant differences.
Culling Layer Hen Gastrointestinal Helminth Identification at Wonokromo Market Surabaya Fakhryyah Maharani Deviyanti; Hastutiek, Poedji; Arimbi; Mufasirin; Permata Sari, Dian Ayu; Sunarso, Agus
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.47979

Abstract

This study aimed to find out and identification gastrointestinal species parasites in cullinglayer hen which sold at in the Wonokromo traditional market Surabaya City. The samples were100 culling layer hen purchased from five merchant. Research design with purposive sampling.The samples was examined by having surgery through the digestive tract and fecal examination.Meanwhile, fecal examination used native methods, sediment and floating. Types of wormsidentified were Ascaridia galli, Heterakis gallinarum, Raillietina tetragona and Mediorhynchusgallinarum through examination the digestive tract surgery. There were Ascaridia galli, Heterakisgallinarum, and Raillietina sp. found in examination of worm egg in fecal. The prevalence ofparasite gastrointestinal in the culling layer hen in sold at in the Wonokromo traditional marketSurabaya City was 85%. The difference in percentage rates were likely due to seasonal factors,maintenance management, feeding and ranching systems.
Prevalence Rate and Infection Degree of Helminthiasis on Pigeon (Columbia Livia Domestica) in North Surabaya Ihda Hanny, Khurun'In Fadia; Djoko Legowo; Mufasirin; Kusnoto; Dian Ayu Permatasari; Poedji Hastutiek
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.48823

Abstract

Pigeon meat is an alternative option to other poultry meat such as chikens. As pigeons are easy to keep and quickly reproduce. Improper hygene practices is a strong factor in helminthiasis transmission. This study aims to know the prevalence and degree of infection of helminthiasis in North Surabaya. 70 samples were taken from pigeon butchers in North Surabaya from September to November 2022. Dissection method was used for prevalence rate count and modified McMaster method was used to count degree of infection. The result shown that 70% of samples had positive worm infection. Types of worms found were R. cesticillus (55.7%), Ascaridia sp. (25.7%), Capillaria sp. (14.2%), Echinostoma sp. (2.8%) and Heterakis sp. (1.4%). Qualitative exam shown helminthiasis was more prevalent in adult pigeon than in squab, but analysis with Chi-square test shown no significant association between helminthiasis infection and age of the pigeons (P>0.05). Quantitative exam with McMaster method shown degree of infection of single Ascaridia infection in adult pigeons is 340 EPG while in Capillaria sp. is 287.5 EPG and 150 EPG in Heterakis. All of them are considered mild infection. Thus, proper loft and feed hygene method should be informed to prevent more transmission.
Co-Authors Abdul Samik Adi Sofyan Ansori, Muhammad Adiana Mutamsari Witaningrum Adikara, Tatang Santanu Aksono HP., Eduardus Bimo Al arif, Mohammad Anam Al Arif, Muhammad Anam Alasrorik, Muhammad Hizbulloh Alfina Azkiana Amalia Rosydinasari Rosydinasari Anam Al Arif andi jayawardhana Andi Jayawardhana Ardianto Ardianto Arif Pratiwi Arif Rahman Nurdianto Arimbi Aryaloka, Suhita Aryati Aryati Aryati Aryati Azizah Bilqis Nurkarimah Bagaskara, Ryan Bambang Sektiari Lukiswanto Benjamin Christoffel Tehupuring, Benjamin Christoffel Berlina, Cyrcilia Relita Boedi Setiawan Choirunnisa, Indaka Rachmah Chusniati, Sri Cindy Ercha Aulia Putri Dadik Rahardjo, Dadik Desty Shafira Dewi Purwatiningsih Dhimar Maulud Dyahningrum Dian Ayu Permatasari Didik Handijatno Djoko Legowo Djoko Legowo Doohan Mahendra Doohan Mahendra DWI PUTRI RAHMAWATI Dyah Ayu Kurniawati Dyah Ayu Kurniawati Edward Yonas Kristijanto Eka Pramyrtha Hestianah Eka Pramyrtha Hestianah, Eka Pramyrtha Elok Apriliawati Emy Koestanti Sabdoningrum Endah Rochmatika Endang Suprihati Endang Suprihati Erma Safitri Fakhryyah Maharani Deviyanti Farezi, Reza Adrio Fatmawati, Mira Fatmawati Fauziah Fitri Hernanto Fedik Abdul Rantam Firdaus , Muhammad Aviv Fitri, Paraswita Eindah Fransiska Cicilia Beka Frida Aulya Arningdiah Galaxy Guardian Gunanti Mahasri Haditanojo, Wiyanto Hana Eliyani Hana Eliyani Hani Plumeriastuti Hanna Harnida, Hanna Hartono Hartono Hayuning Nurrodhiya Heni Puspitasari Herdiansyah, Akbar Dimas Hermin Ratnani Herry Agoes Hermadi Hidanah , Sri Hidanah, Sri Ihda Hanny, Khurun'In Fadia IMAM MUSTOFA Indasari, Elly Nur Ira Sari Yudaniayanti Istiana, Izzatul Iwan Sahrial Hamid Jayanti Dian Eka Sari, Jayanti Dian Joko Prastowo Jumria, Andi Kenconojati, Hapsari Khairullah, Aswin Rafif Khalissa Farah Alifia Koesdarto Koesdarto Kurniawan, Muhammad 'Ahdi Kurniawan, Muhammad ‘Ahdi Kurniawati, Dyah Ayu Kusnoto Kusnoto Kusnoto Kusnoto Kusnoto, Kusnoto Legowo, Djoko Lestari Wilujeng Lilik Maslachah Lisnanti, Ertika Fitri Lucia Tri Suwanti, Lucia Tri Luqman, Epy Muhammad Lutfiah Annisa Billa Luthfiyyah Nur Afifah Siswandi Mafruchati, Maslichah Maghfiroh, Nurutin Tutur Bifatikhatil M Masdiana C Padaga Melani Anggraini Melanie Aulia Ashfiyah Mirni Lamid Mirni Lamid Mochammad Amin Alamsjah Mohamad Yusuf Mohammad Guritno Suryokusumo Moses, Ikechukwu Benjamin Mufa, Ramy Inas Mahirah Muhamad Amin Muhammad Ahdi Kurniawan Muhammad Al-Syafiq bin Abdul Halim Muhammad Ridwan Muslimah, Bintang Mustofa Helmi Effendi Nedi Nedi Nenny Harijani Ni Komang Aprilina Widisuputri Nining Sari Virgandina Vinola Nizar Bachrudin Prihandono Nunuk D.R. Lastuti Nunuk Dyah Retno Lastuti Nurdianti Nurdianti Nurdianto, Arif Rahman Nurfaizah, Diza Ulya Nurmayani, Seli Nusdianto Triakoso Nuurin Ajrin Karim Ochtavia, Sherly P Kumaladewi Permata Sari, Dian Ayu Pinatih, Ayu Komang Ria Trie Dewi Poedji Hastoetik Poedji Hastutiek Poetranto, Emmanuel Djoko Pradana, Giffari Danindra Praja, Ratih Novita Pratama, Bima Putra Pratama, Ponasari Galuh Pratiwi, Arif Primarizky, Hardany Puput Ade Wahyuningtyas Puput, Sesa Purbowati, Tri Endah Puspikawati, Septa Indra Rahadju Ernawati Rahardjo, Adi Prijo Rahmandari, Dina Agylia Rahmatullah, Aldin Akbar Ramadhana Ramadhana Ramadhanty, Miladhiyah Nabila Ratna Damayanti Rekasni Adallin A/P Morgan A/P Morgan Retno Yuli Rimayanti Rina Vitriasari Riwu, Katty Hendriana Priscilia Romy Muhammad Dary Mufa Romziah Sidik Rosyta, Pegy Sabdoningrum, Emy Koestanti Saksono, Bayu Sapto Andriyono Sari, Fifin Kurnia Septian Hakim Susantoputro Setiawan Koesdarto Setiawan Kusdarto Sherly Ochtavia Silfia, Himatul Ilma Soeharsono Soeharsono Soetojo Soetojo Sri Agus Sudjarwo Sri Pantja Madyawati Sri Pantja Madyawati, Sri Pantja Sukarno, Gerda Sumartono Sumartono Sunarso, Agus Susilo, Rahadian Indarto Talita Yuanda Reksa Taufan Ary Handoko Tita Damayanti Lestari Tony Hartono Tri Suwanti, Lucia Tri Wahyu Suprayogi Trifena Pristi Anindyta Tyasningsih, Wiwiek Vindo Rossy Pertiwi Wahidan Qodiip Maulana Warda Nafalizza Efendi Warsito, Sunaryo Hadi Widi Nugroho Widya Paramita Lokapirnasari Widya Paramita Lokapirnasari Win Darmanto Wiwik Misaco Yuniarti Wiwik Misaco Yuniarti Wurlina, W Yudanianyi, Ira Sari Yudaniayanti , Irasari Yudhana, Aditya Yulianna Puspitasari Yunus, Muchammad ZULFAH