Article Per Year (5 Year)
p-Index From 2020 - 2025
7.089
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Buletin Veteriner Udayana Jurnal Veteriner Indonesian Journal of Applied Sciences Media Kedokteran Hewan Jurnal Ilmu-Ilmu Peternakan (Indonesian Journal of Animal Science) Jurnal Biosains Pascasarjana JITRO (Jurnal Ilmiah dan Teknologi Peternakan Tropis) Aceh Journal of Animal Science Jurnal Ilmiah Kedokteran Wijaya Kusuma Qanun Medika - Medical Journal Faculty of Medicine Muhammadiyah Surabaya Jurnal Ilmu Nutrisi dan Teknologi Pakan Jurnal Medik Veteriner NERSMID: Jurnal Keperwatan dan Kebidanan Jurnal Ilmiah Fillia Cendekia Journal of Aquaculture and Fish Health Veterinary Biomedical and Clinical Journal Jurnal Ilmu Peternakan Terapan Journal of Parasite Science Ovozoa: Journal of Animal Reproduction Journal of Applied Veterinary Science and Technology Bioscientist : Jurnal Ilmiah Biologi journal of Basic Medical Veterinary Jurnal Kedokteran Hewan Journal of Fisheries & Marine
Mufasirin
Divisi Parasitologi Veteriner, Universitas Airlangga, Surabaya
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemistry Dentistry Education Environmental Science Health Professions Immunology & microbiology Medicine & Pharmacology Neuroscience Nursing Public Health Social Sciences Veterinary Other

Published : 71 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 71 Documents
Search

 3   4   5   6   7 
Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ] Gunanti Mahasri; Lestari Wilujeng; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jipk.v6i2.11294

Abstract

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Epidemiological Studies of Subclinical Mastitis in Dairy Goats in Lumajang Regency, East Java, Indonesia Mira Fatmawati Fatmawati; Lucia Tri Suwanti; Mufasirin; Mirni Lamid; Nunuk Dyah Retno Lastuti; Endang Suprihati; Mustofa Helmi Effendi; Anam Al Arif; Widi Nugroho; Masdiana C Padaga
Jurnal Ilmu-Ilmu Peternakan Vol. 33 No. 3 (2023): December 2023
Publisher : Faculty of Animal Science, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jiip.2023.033.03.07

Abstract

Subclinical mastitis is an economically important disease in dairy goat farming. Lumajang is a center for dairy goats in East Java. However, routine examination of subclinical mastitis for screening tests has no data. This study aimed to provide prevalence data and identification factors that influenced subclinical mastitis. Therefore, this study was carried out as part of the national surveillance program. The research design is a cross-sectional study with simple random sampling. Samples came from 19 farms with a total individual sample of 224 dairy goats. Detection of subclinical mastitis using an undirect test with the California Mastitis Test (CMT). Identification of management factors and characteristics that can influence subclinical mastitis in dairy goat farms using a structured questionnaire. The results showed that the prevalence of subclinical mastitis in Lumajang District was 36.2%. There was a significant difference in subclinical mastitis in each village (p<0.05). The highest prevalence of subclinical mastitis was in Kandangtepus village. A farmer's characteristic factor that significantly influences subclinical mastitis is the farmer's experience. The aspect of livestock management that significantly affects subclinical mastitis is structured work management. Subclinical mastitis was prevalent in dairy goats in Lumajang District and requires prevention efforts. Prevention approach through education for farmers to increase knowledge, attitude, and socialization to improve livestock management.
Stray Cat Gastrointestinal Protozoa Prevalence and Infection Degree in Madiun Public Health Center and Traditional Market Hayuning Nurrodhiya; Legowo, Djoko; Suprihati, Endang; Hastutiek, Poedji; Mufasirin; Rahardjo, Dadik
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.46201

Abstract

This study determine the prevalence and protozoa infection degree of gastrointestinal in stray cats at Public Health Center and Traditional Market of Madiun City. 80 fecal sample collected. Fecal samples examined with direct smear, sedimentation, and floatation method. Positive samples calculated using the Lucient-Brumpt method. The result of the examination in Public Health Center showed that 37,5% stray cat infected by Isospora sp., Entamoeba sp., and Cryptosporidium sp., with 1167.33a±168.373 infection degree. The examination result in Traditional Market showed that 62,5% stray cat infected by Isospora sp., Entamoeba sp., and Cryptosporidium sp., with 1186.00a±148.577 infection degree. The result of Chi Square analysis obtained p<0,05 indicated that there were significant differences between stray cat including faecal collection location, age, type of cat and faecal condition. The result of Kruskal Wallis analysis of the degree infection obtained p>0,05 indicated that there were no significant differences.
Culling Layer Hen Gastrointestinal Helminth Identification at Wonokromo Market Surabaya Fakhryyah Maharani Deviyanti; Hastutiek, Poedji; Arimbi; Mufasirin; Permata Sari, Dian Ayu; Sunarso, Agus
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.47979

Abstract

This study aimed to find out and identification gastrointestinal species parasites in cullinglayer hen which sold at in the Wonokromo traditional market Surabaya City. The samples were100 culling layer hen purchased from five merchant. Research design with purposive sampling.The samples was examined by having surgery through the digestive tract and fecal examination.Meanwhile, fecal examination used native methods, sediment and floating. Types of wormsidentified were Ascaridia galli, Heterakis gallinarum, Raillietina tetragona and Mediorhynchusgallinarum through examination the digestive tract surgery. There were Ascaridia galli, Heterakisgallinarum, and Raillietina sp. found in examination of worm egg in fecal. The prevalence ofparasite gastrointestinal in the culling layer hen in sold at in the Wonokromo traditional marketSurabaya City was 85%. The difference in percentage rates were likely due to seasonal factors,maintenance management, feeding and ranching systems.
Prevalence Rate and Infection Degree of Helminthiasis on Pigeon (Columbia Livia Domestica) in North Surabaya Ihda Hanny, Khurun'In Fadia; Djoko Legowo; Mufasirin; Kusnoto; Dian Ayu Permatasari; Poedji Hastutiek
Journal of Parasite Science Vol. 7 No. 2 (2023): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v7i2.48823

Abstract

Pigeon meat is an alternative option to other poultry meat such as chikens. As pigeons are easy to keep and quickly reproduce. Improper hygene practices is a strong factor in helminthiasis transmission. This study aims to know the prevalence and degree of infection of helminthiasis in North Surabaya. 70 samples were taken from pigeon butchers in North Surabaya from September to November 2022. Dissection method was used for prevalence rate count and modified McMaster method was used to count degree of infection. The result shown that 70% of samples had positive worm infection. Types of worms found were R. cesticillus (55.7%), Ascaridia sp. (25.7%), Capillaria sp. (14.2%), Echinostoma sp. (2.8%) and Heterakis sp. (1.4%). Qualitative exam shown helminthiasis was more prevalent in adult pigeon than in squab, but analysis with Chi-square test shown no significant association between helminthiasis infection and age of the pigeons (P>0.05). Quantitative exam with McMaster method shown degree of infection of single Ascaridia infection in adult pigeons is 340 EPG while in Capillaria sp. is 287.5 EPG and 150 EPG in Heterakis. All of them are considered mild infection. Thus, proper loft and feed hygene method should be informed to prevent more transmission.
Scabies Prevalence on Cats and Rabbits in Animal Hospital of East Java Livestock Service on 2021 Ramadhanty, Miladhiyah Nabila; Kusnoto, Kusnoto; Hastutiek, Poedji; Mufasirin, Mufasirin; Setiawan, Boedi; Hestianah, Eka Pramyrtha
Journal of Parasite Science Vol. 8 No. 2 (2024): Journal of Parasite Science
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jops.v8i2.56205

Abstract

This study aims to obtain information and data on the prevalence of scabies in cats and rabbits at the Animal Hospital of East Java Livestock Service Surabaya. The data obtained in this study are data on visitors or pet owners to the Animal Hospital in January - December 2021. The type of research is descriptive research. The data obtained tabulated and analyzed with a prevalence test and discussed descriptively. The prevalence of scabies in cats and rabbits at the study was 5.62% or 76 positive of 1352 visiting clients. Forty five of them were cats (59.21% of 76) and 31 were rabbits (40.79% of 76). Scabies attacks animals in the nose, mouth and ears. Scabies also causes weight loss, hair loss, irritation, anemia and even death. Scabies treatment at the research location is by cleaning the scars caused by scabies, applying an ointment containing 5% permethrin, and giving anti-histamine and anti-parasitic as well as providing supportive therapy in the form of grooming using shampoo containing anti-ectoparasites. Pet owners are expected to follow the advice given by animal hospital staff who have provided knowledge in terms of controlling and preventing Scabies.
Parasites Prevalence of Dairy Cattle in Argopuro Area, Krucil District, Probolinggo Regency, Indonesia Pradana, Giffari Danindra; Mufasirin; Madyawati, Sri Pantja; Tri Suwanti, Lucia; Kusnoto; Sunarso, Agus; Aryaloka, Suhita
Veterinary Biomedical and Clinical Journal Vol. 5 No. 2 (2023)
Publisher : Faculty of Veterinary Medicine Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.VetBioClinJ.2023.005.02.3

Abstract

This study aimed to identify endoparasitic species and their prevalence in dairy cows in the Probolinggo, Indonesia. This survey was conducted in the Cooperation of Argopuro, in the hill side of Krucil district, Probolinggo regency, during rainy season from March until July 2020. Faecal samples were collected (n=100), and three fecal examinations were performed for parasite identification: native, sedimentation, and flotation techniques. Results showed that the prevalence of endoparasitosis was 56%; 29% was due to helminthiases and the other 37% was of Balantidium coli. Fasciola sp., Oesophagostomum sp., Gaigeria pachyscelis, Toxocara vitulorum, Mecistocirrus digitatus, Chabertia sp. were among the helminths detected. The Lucient Brump test indicated that among samples infected with helminths (n=29), 89.7% were mild, 6.9% were moderate and 3.4% were severely infected. Further, the study estimated that the level of burden with Balantidium coli was identified to be mild in 62.2%, moderate in 32.4%, and severe in 5.4% of the positive samples, respectively (n=37). This study indicates that during the commencement of the rainy season, the campaign of effective endoparasitic control could be advisable in the study area
Identifikasi Molekuler Blastocystis sp. pada Monyet Ekor Panjang (Macaca fascicularis) di Taman Nasional Baluran, Situbondo, Jawa Timur Kurniawati, Dyah Ayu; Suwanti, Lucia Tri; Lastuti, Nunuk Dyah Retno; Koesdarto, Setiawan; Suprihati, Endang; Mufasirin, Mufasirin; Pratiwi, Arif
Jurnal Medik Veteriner Vol. 3 No. 2 (2020): October
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jmv.vol3.iss2.2020.138-144

Abstract

Interaksi yang dekat antara monyet ekor panjang dengan manusia dapat meningkatkan risiko penularan penyakit zoonosis. Blastocystis sp. adalah protozoa gastrointestinal pada manusia dan hewan yang yang bersifat zoonosis. Penelitian ini bertujuan untuk mengidentifikasi Blastocystis sp. yang menginfeksi monyet ekor panjang melalui identifikasi molekuler. Identifikasi Blastocystis sp. pada penelitian ini menggunakan metode morfologis dan molekuler. Sebanyak 90 feses individu monyet ekor panjang Taman Nasional Baluran dilakukan pemeriksaan secara mikroskopis setelah dilakukan kultur pada Jones Medium. 28 dari sampel yang positif secara mikroskopis dilanjutkan dengan uji PCR dengan target primer barcode region yang mempunyai visualisasi 600bp. Tiga sampel dengan band positif 600bp dilanjutkan dengan squencing. Hasil sekuens diproses dalam BLAST dan MLST. Satu sampel yang terkonfirmasi sebagai Blastocystis sp. dengan infeksi campuran dari subtipe 1 alel 2 dan subtipe 3 alel 34. Hasil menunjukkan bahwa Blastocystis sp. terdapat pada monyet ekor panjang di Taman Nasional Baluran dengan prevalensi rendah.
Use of Disinfection Chamber to Prevent Covid-19 at the Faculty of Veterinary Medicine, Universitas Airlangga Warsito, Sunaryo Hadi; Mufasirin, Mufasirin; Yunus, Muchammad
Jurnal Medik Veteriner Vol. 4 No. 1 (2021): April
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jmv.vol4.iss1.2021.165-169

Abstract

Community empowerment at the Faculty of Veterinary Medicine and Animal Education Hospital (RSHP) Universitas Airlangga aimed to prevent Covid-19 among students, picket workers, employees, veterinarians, nurses, and the client who bring animals to RSHP. The program starts from observation to implementation in May-October 2020. Implementation of community empowerment program in collaboration with the KKN program in Surabaya. This program introduced the disinfection chamber model of an automatic sprayer that is safe for health and complies with the standard operating procedure (SOP) for the use of the disinfection chamber. The existence of a disinfection chamber at the entrance to the campus and RSHP has contributed a lot to prevent the spread of Covid-19. The post-test results showed an increase in public understanding of the existence of disinfection chamber as a way to reduce the spread of Covid-19 and implement health protocols and healthy lifestyles.
Prevalence of Gastrointestinal Parasites in Pigs in Bali Pinatih, Ayu Komang Ria Trie Dewi; Lastuti, Nunuk Dyah Retno; Kusnoto, Kusnoto; Mufasirin, Mufasirin; Yunus, Muchammad; Rahardjo, Dadik
Jurnal Medik Veteriner Vol. 7 No. 2 (2024): October
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jmv.vol7.iss2.2024.349-354

Abstract

This study aimed to identify gastrointestinal parasites in pigs in Bali. A total of 117 pig feces samples were collected in Buleleng Regency (n = 67) and Jembrana (n = 50). Samples were examined microscopically using native, sedimentation, and floating methods. The results reported the prevalence of gastrointestinal parasites infecting pigs in Bali was 94.8% (111/117) infected with protozoa, namely Eimeria sp. (90.5%), Entamoeba sp. (26.4%), Isospora suis (6.8%), and Balantidium sp. (5.1%), while 99.1% (116/117) were infected with helminths, namely Trichuris suis (71.7%), Strongyloides sp. (64.9%), Ascaris suum (49.5%), Oesophagostomum sp. (6.1%), Macracanthorhyncus sp. (2.5%), and Hyostrongylus sp. (0.8%). Based on the tree regression analysis reported that the rearing system was related to the degree of gastrointestinal parasite infection in pigs in Bali.
Co-Authors Abdul Samik Adi Sofyan Ansori, Muhammad Adiana Mutamsari Witaningrum Adikara, Tatang Santanu Al arif, Mohammad Anam Al Arif, Muhammad Anam Alasrorik, Muhammad Hizbulloh Alfina Azkiana Amalia Rosydinasari Rosydinasari Anam Al Arif andi jayawardhana Andi Jayawardhana Ardianto Ardianto Arif Pratiwi Arif Rahman Nurdianto Arimbi Aryaloka, Suhita Aryati Aryati Aryati Aryati Azizah Bilqis Nurkarimah Bagaskara, Ryan Bambang Sektiari Lukiswanto Benjamin Christoffel Tehupuring, Benjamin Christoffel Berlina, Cyrcilia Relita Boedi Setiawan Cindy Ercha Aulia Putri Dadik Rahardjo, Dadik Desty Shafira Dewi Purwatiningsih Dhimar Maulud Dyahningrum Dian Ayu Permatasari Didik Handijatno Djoko Legowo Djoko Legowo Doohan Mahendra Doohan Mahendra DWI PUTRI RAHMAWATI Dyah Ayu Kurniawati Dyah Ayu Kurniawati Eduardus Bimo Aksono Herupradoto Edward Yonas Kristijanto Eka Pramyrtha Hestianah Eka Pramyrtha Hestianah, Eka Pramyrtha Elok Apriliawati Emy Koestanti Sabdoningrum Endah Rochmatika Endang Suprihati Endang Suprihati Endang Suprihati Erma Safitri Fakhryyah Maharani Deviyanti Farezi, Reza Adrio Fauziah Fitri Hernanto Fedik Abdul Rantam Firdaus , Muhammad Aviv Fransiska Cicilia Beka Frida Aulya Arningdiah Galaxy Guardian Gunanti Mahasri Haditanojo, Wiyanto Hana Eliyani Hana Eliyani Hani Plumeriastuti Hanna Harnida, Hanna Hartono Hartono Hayuning Nurrodhiya Heni Puspitasari Herdiansyah, Akbar Dimas Hermin Ratnani Herry Agoes Hermadi Hidanah , Sri Hidanah, Sri Ihda Hanny, Khurun'In Fadia IMAM MUSTOFA Indasari, Elly Nur Ira Sari Yudaniayanti Istiana, Izzatul Iwan Sahrial Hamid Jayanti Dian Eka Sari, Jayanti Dian Joko Prastowo Jumria, Andi Kenconojati, Hapsari Khairullah, Aswin Rafif Khalissa Farah Alifia Koesdarto Koesdarto Kurniawan, Muhammad 'Ahdi Kurniawan, Muhammad ‘Ahdi Kurniawati, Dyah Ayu Kusnoto Kusnoto Kusnoto Kusnoto Kusnoto, Kusnoto Legowo, Djoko Lestari Wilujeng Lilik Maslachah Lisnanti, Ertika Fitri Lucia Tri Suwanti, Lucia Tri Luqman, Epy Muhammad Lutfiah Annisa Billa Luthfiyyah Nur Afifah Siswandi Mafruchati, Maslichah Maghfiroh, Nurutin Tutur Bifatikhatil M Masdiana C Padaga Melani Anggraini Melanie Aulia Ashfiyah Mira Fatmawati Fatmawati Mirni Lamid Mirni Lamid Mochammad Amin Alamsjah Mohamad Yusuf Mohammad Guritno Suryokusumo Moses, Ikechukwu Benjamin Mufa, Ramy Inas Mahirah Muhamad Amin Muhammad Ahdi Kurniawan Muhammad Al-Syafiq bin Abdul Halim Muhammad Ridwan Muslimah, Bintang Mustofa Helmi Effendi Mustofa Helmi Effendi Nedi Nedi Nenny Harijani Ni Komang Aprilina Widisuputri Nining Sari Virgandina Vinola Nizar Bachrudin Prihandono Nunuk D.R. Lastuti Nunuk Dyah Retno Lastuti Nunuk Dyah Retno Lastuti Nurdianti Nurdianti Nurdianto, Arif Rahman Nurfaizah, Diza Ulya Nusdianto Triakoso Nusdianto Triakoso Nuurin Ajrin Karim P Kumaladewi Paraswita Eindah Fitri Permata Sari, Dian Ayu Pinatih, Ayu Komang Ria Trie Dewi Poedji Hastoetik Poedji Hastutiek Poetranto, Emmanuel Djoko Pradana, Giffari Danindra Praja, Ratih Novita Pratama, Bima Putra Pratama, Ponasari Galuh Pratiwi, Arif Primarizky, Hardany Puput Ade Wahyuningtyas Puput, Sesa Purbowati, Tri Endah Puspikawati, Septa Indra Rahadju Ernawati Rahardjo, Adi Prijo Rahmandari, Dina Agylia Rahmatullah, Aldin Akbar Ramadhana Ramadhana Ramadhanty, Miladhiyah Nabila Ratna Damayanti Rekasni Adallin A/P Morgan A/P Morgan Retno Yuli Rimayanti Rina Vitriasari Riwu, Katty Hendriana Priscilia Romy Muhammad Dary Mufa Romziah Sidik Rosyta, Pegy Sabdoningrum, Emy Koestanti Saksono, Bayu Sapto Andriyono Sari, Fifin Kurnia Septian Hakim Susantoputro Setiawan Koesdarto Setiawan Kusdarto Sherly Ochtavia Silfia, Himatul Ilma Soeharsono Soeharsono Soetojo Soetojo Sri Agus Sudjarwo Sri Chusniati Sri Pantja Madyawati Sri Pantja Madyawati, Sri Pantja Sukarno, Gerda Sumartono Sumartono Sunarso, Agus Susilo, Rahadian Indarto Talita Yuanda Reksa Taufan Ary Handoko Tita Damayanti Lestari Tony Hartono Tri Suwanti, Lucia Tri Wahyu Suprayogi Trifena Pristi Anindyta Tyasningsih, Wiwiek Vindo Rossy Pertiwi Wahidan Qodiip Maulana Warda Nafalizza Efendi Warsito , Sunaryo Hadi Warsito, Sunaryo Hadi Warsito, Sunaryo Hadi Widi Nugroho Widya Paramita Lokapirnasari Widya Paramita Lokapirnasari Win Darmanto Wiwik Misaco Yuniarti Wiwik Misaco Yuniarti Wurlina, W Yudanianyi, Ira Sari Yudaniayanti , Irasari Yudhana, Aditya Yulianna Puspitasari Yunus, Muchammad ZULFAH