Articles
PENGARUH PENGETAHUAN DAN FAKTOR KELUARGA TERHADAP KEBERLANGSUNGAN USAHA INDUSTRI GARAM DI KECAMATAN JANGKA
Mauiza, Mauliza;
Wahyuni, Sri;
Nova, Nova
Ekonomika Journal Vol 15 No 2 (2023): Ekonomika, September 2023
Publisher : Fakultas Ekonomi Universitas Almuslim Bireuen
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.51179/eko.v15i2.2547
This research aims to explain the influence of knowledge and family factors on the sustainability of the salt industry business in Panjang District. The type of data is primary data using quantitative research methods and multiple linear regression model analysis. The results of this research state that knowledge influences the sustainability of the salt industry business. Family factors influence the sustainability of the salt industry business. Simultaneously, knowledge and family factors influence the sustainability of the salt industry business in Panjang District by 20.6%.
PENGARUH PERTUMBUHAN EKONOMI DAN INDEKS PEMBANGUNAN MANUSIA TERHADAP PENERIMAAN PAJAK (Analisis Data Tahun 2012-2023)
Agustina, Agustina;
Wahyuni, Sri;
Asrida, Asrida
Ekonomika Journal Vol 16 No 1 (2024): Ekonomika, Maret 2024
Publisher : Fakultas Ekonomi Universitas Almuslim Bireuen
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.51179/eko.v16i1.2567
This research aims to analyze and explain the influence of Economic Growth and the Human Development Index on Tax Revenue during 2012-2023 in Indonesia. Quantitative research using multiple regression methods. The results of this research state that economic growth has a positive effect on tax revenue, and HDI also has a positive effect on tax revenue. The simultaneous contribution of economic growth factors and HDI to tax revenues is 89.8%.
PEMBELAJARAN BAHASA ARAB BERBASIS TEKNOLOGI INFORMASI DAN KOMUNIKASI DI KOTA PADANG
Ritonga, Mahyudin;
Nazir, Alwis;
Wahyuni, Sri
Arabiyat : Jurnal Pendidikan Bahasa Arab dan Kebahasaaraban Vol. 3 No. 1 (2016)
Publisher : Syarif Hidayatullah State Islamic University of Jakarta, Indonesia
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.15408/a.v3i1.2879
The integration of various fields of sciences and technology is vital in this digital era, including for educational purposes such as the utilization of Information and Communication Technology (ICT) in learning Arabic. However, an obstacle faced by educational institutions is they do not have a clear model in the use of ICT to apply in teaching learning process; therefore, it is an urgent need to conduct a study to find out the best model of ICT-based Arabic learning. This study used qualitative research method covering three stages, i.e. the preliminary, development and implementation phases. The research used purposive sampling and data collection techniques were observation, interviews and documentation. Data analysis technique was the analytical techniques developed by Miles and Hubermas. The result showed that the design of ICT-based Arabic learning model that developed at MTsN Kota Padang is "al-Hasshub al-ittishali model". It is a computerized-based Arabic communicative teaching model. By implementing this model, the material and other learning media are designed using a computer program. Moreover, the teacher served as a learning motivator and mediator on materials that need more explanation.DOI : 10.15408/a.v3i1.2879
DAMPAK PELAYANAN KANTOR P4MI KOTA TANGERANG DALAM MENINGKATKAN INDEKS KEPUASAN MASYARAKAT BERBASIS SISTEM INFORMASI MANAJEMEN
Amir, Mardiyanto;
Wahyuni, Sri;
Supratikta , Hadi
Multidisciplinary Indonesian Center Journal (MICJO) Vol. 1 No. 3 (2024): Vol. 1 No. 3 Edisi Juli 2024
Publisher : PT. Jurnal Center Indonesia Publisher
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.62567/micjo.v1i3.133
Untuk mendapatkan pemahaman mengenai tingkat kepuasan penduduk terhadap layanan yang disediakan di kantor P4MI kota Tangerang. maka dilakukan Survey Kepuasan Masyarakat. Survey ini dilakukan dengan cara menggunakan scan barcode melalui telepon seluler yang dimiliki pengguna jasa kantor P4MI kota Tangerang. Metode ini memudahkan masyarakat untuk mengisi survey. Metode ini juga dalam rangka peningkatan kualitas pelayanan dan mengikuti perkembangan jaman. Dari hasil perhitungan didapatkan bahwa tingkat kepuasan masyarakat ada diposisi sangat baik. Walaupun hasil survey menunjukan angka sangat baik namun masih perlu dilakukan pembenahan seperti kurang maksimalnya sarana penyejuk ruangan dan kurang terjaganya kebersihan kamar mandi yang digunakan oleh masyarakat saat mendapatkan pelayanan di kantor P4MI kota Tangerang.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti
Nuryady, Moh. Mirza;
Purwanti, Elly;
Aldina, Siti Nur;
Wahyuni, Sri;
Permana, Tutut Indria;
Khoiriyah, Zakiyatul;
Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.15408/kauniyah.v1i1.33726
AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers for the COX-1 gene of A. aegypti.
Gambaran Limfosit Pasca Vaksin Covid-19 Booster
Wahyuni, Sri;
Hasanah, Fathul Hidayatul
Pharmaqueous: Jurnal Ilmiah Kefarmasian Vol. 5 No. 2 (2023): Volume 5, Nomor 2, November 2023
Publisher : Universitas Al-Irsyad Cilacap
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.36760/jp.v5i2.316
COVID-19 merupakan penyakit yang disebabkan oleh virus SARS-CoV-2. Pada maret tahun 2020 WHO mengumumkan menjadi wabah global di dunia. Negara di dunia menanggapi wabah tersebut dengan berbagai respon. Banyak negara yang membatasi masuk dan keluar antar negara dan kebijakan- kebijakan darurat yang dibuat disetiap negara. Pemerintah Indonesia merespon kejadian tersebut dengan berbagai kebijakan. Penerapan protokol kesehatan, pemberlakuan kebijakan Pembatasan Sosial Berskala Besar (PSBB), serta kebijakan lainya. Pemerintah juga menggalakkan vaksin covid-19 untuk mengecegah penularan, mengurangi resiko sakit dan menurunkan angka kematian akibat covid-19. Vaksin merupakan produk biologi yang berfungsi membentuk antibodi spesifik terhadap penyakit tertentu. Vaksin covid-19 yang digalakkan pemerintah ada vaksin covid-19 tahap 1, tahap 2 , tahap 3 (booster). Vaksin tahap 1 dan 2 diharapkan membentuk antibody spesifik terhadap covid-19. Vaksin booster diharapkan mampu meregenerasi antibodi dan memperpanjang imunitas. Limfosit merupakan bagian dari leukosit agranulosit untuk membentuk antibody. Tujuan dari penelitian ini untuk mengetahui gambaran dari limfosit pasca vaksinasi covid-19 booster. Metode yang digunakan yaitu diskriptif dengan purposive sampling. Sampel penelitian yaitu mahasiswa IIK Bhakti wiyata Kediri yang sudah vaksin covid-19 booster yang memenuhi kriteria yang sudah ditetapkan peneliti. Sampel yang digunakan adalah darah dengan EDTA dan pemeriksaan limfosit pada penelitian ini mengunakan hematologi analyzer. Hasil penelitian dari 30 responden didapatkan limfosit menurun 2 responden, normal 22 responden, meningkat 6 responden. Nilai rata-rata kadar limfosit 28,39. Dapat disimpulkan bahwa gambaran limfosit pasca vaksinasi covid-19 ada yang menurun, normal dan meningkat. Terdapat beberapa hal yang bisa mempengaruhi kadar limposit.
The perversion of local novel morality and its implementation of learning faces a demographic bonus
Minto, Deri Wan;
Putriani, Ananda;
Wahyuni, Sri;
Francisco, Eleonor
SOSIOHUMANIORA: Jurnal Ilmiah Ilmu Sosial dan Humaniora Vol 10 No 1 (2024): Februari 2024
Publisher : LP2M Universitas Sarjanawiyata Tamansiswa
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.30738/sosio.v10i1.16246
The background is based on the phenomenon of deviating aspects of morality which often color Minangkabau novels. As a result, there are writers who criticize especially social problems that occur in local communities. The purpose of this research is to describe aspects of deviating aspects of morality in local novels, especially Ismet Fanany's Bulan Susut by Ismet Fanany and their implementation towards learning in schools in the face of the demographic bonus era. Qualitative and analytical descriptive methods form the basis of this research type and method. Based on the findings (1) Aspects of conscience with a total of 9 data findings with a percentage of 21.96%. (2) Aspects of freedom and responsibility with a total of 11 data findings with a percentage of 26.83%. (3) Aspects of rights and obligations with a total of 8 data findings with a percentage of 19.51%. (4) Aspects of values and norms with a total of 13 data findings with a percentage of 31.70%. Implications in this research are interpreted not to be taught research that is obtained openly which is direct in nature, but this research will utilize positive values as an effort to form good character for learning challenges in the era of demographic bonuses.
PENINGKATAN KEMAMPUAN MENGENAL HURUF PADA TEMA TANAMAN DI KELOMPOK B TK MARAQITTA’LIMAT TEMBENG PUTIK
Wahyuni, Sri;
Sabahiyah, Sabahiyah;
Hasanah, Niswatul;
Hadi, Mashal;
Humairo, Yunisa
NUSRA : Jurnal Penelitian dan Ilmu Pendidikan Vol. 4 No. 4 (2023): NUSRA: Jurnal Penelitian dan Ilmu Pendidikan, November 2023
Publisher : LPPM Institut Pendidikan Nusantara Global
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.55681/nusra.v4i4.1756
This research aims to determine the increase in the ability to recognize letters on the theme of plants in group B of Maraqitta'limat Tembeng Putik Kindergarten by using letter card games. This research is classroom action research consisting of two cycles. Research stages include planning, implementation, observation and reflection. The research subjects were group B, totaling 15 children, consisting of 10 boys and 5 girls. Data collection methods through interviews, observation and documentation. The instrument used in this research was an observation sheet on the ability to recognize letters which consisted of four indicators, namely naming letter symbols, matching letter symbols, composing words, and showing letters. Data were analyzed using a percentage formula to determine classical completeness in each cycle. The results of the research show that letter card games can improve children's ability to recognize letters. This increase can be seen from the children's classical completeness in cycle I, namely 60%, then increasing to 86% in cycle II. This is because children are very enthusiastic and motivated in learning. Through playing letter cards, children become more responsive so that their ability to recognize letters increases.
Pengembangan LKPD Berbantuan Aplikasi Canva Berbasis Etnomatematika untuk Meningkatkan Kemampuan Komunikasi Matematis Siswa
Wahyuni, Sri;
Ilmi, Nurul Khautsar;
Sari, Dira Puspita
NUSRA : Jurnal Penelitian dan Ilmu Pendidikan Vol. 5 No. 1 (2024): NUSRA: Jurnal Penelitian dan Ilmu Pendidikan, Februari 2024
Publisher : LPPM Institut Pendidikan Nusantara Global
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.55681/nusra.v5i1.2113
This development research aims to find out; (a) Validity of LKPD assisted by the Canva application on circle material based on ethnomathematics to improve students' mathematical communication skills, (b) Practicality of LKPD assisted by the Canva application on circle material based on ethnomathematics to improve students' mathematical communication skills and (c) Effectiveness of LKPD assisted by the Canva application on material Ethnomathematics-Based Circles to Improve Students' Mathematical Communication Skills. The type of research used is Research and Development (RnD). The research model used is the 4D Model (Define, Design, Development and Disseminate). The subjects in this research were 30 class VIII students at MTs Muhammadiyah Sidomulyo. The results of this research analysis are; (a) The LKPD developed meets the valid category and the percentage value obtained is 94.25% with the criteria "Very Appropriate" (b) The LKPD developed meets the practical category and the percentage value obtained is 93.33% with the criteria "Very Good" (3) The LKPD that was developed met the effective category with a complete learning result obtained by a percentage of 86.66% and students who completed the minimum KKM score, namely 27 students with classical completeness obtained a percentage of 90%. This shows that overall, the development of LKPD assisted by the Canva application on ethnomathematics-based circle material to improve the mathematical communication skills of class VIII students at MTs Muhammadiyah Sidomulyo is included in the valid, practical and effective category.
Penerapan Model Pembelajaran Realistic Mathemathic Education (RMA) untuk Meningkatkan Kemampuan Berpikir Kritis Siswa Kelas V SD Negeri 03 Mamben Lauk
Sabahiyah, Sabahiyah;
Wahyuni, Sri
NUSRA : Jurnal Penelitian dan Ilmu Pendidikan Vol. 5 No. 2 (2024): NUSRA: Jurnal Penelitian dan Ilmu Pendidikan, Mei 2024
Publisher : LPPM Institut Pendidikan Nusantara Global
Show Abstract
|
Download Original
|
Original Source
|
Check in Google Scholar
|
DOI: 10.55681/nusra.v5i2.2790
This research was motivated by the method used in teaching mathematics that did not involve students, and the teacher did not link the subject matter to the realities of everyday life so that students did not understand the material being studied. One effort to overcome this is by implementing a learning model that is related to the real world, namely the Realistic Mathematical Education (RME) learning model. The aim of this research is to improve students' critical thinking skills by applying the Realistic Mathematical Education (RME) learning model for class V SD Negeri 03 Mamben Lauk. This research is classroom action research, and was carried out over two cycles. Each cycle consists of four components, namely planning, acting, observing and reflecting. The subjects in this research were class V students at SD Negeri 03 Mamben Lauk with a total of 23 students, consisting of 10 boys and 13 girls. Data on students' critical thinking abilities was collected using written test techniques in the form of descriptions. Thinking ability data was analyzed descriptively. Based on the results of the analysis, it is known that the students' critical thinking skills in cycle I had a classical average of 73.47 and were in the medium category. Meanwhile in cycle II the classical average reached 82.83 and was in the high category. These results prove that the application of the Realistic Mathematics Education (RME) learning model can improve the critical thinking skills of class V students at SD Negeri 03 Mamben Lauk.